CN102229981B - Molecular breeding method for improving strength and micronaire value of cotton fibers - Google Patents
Molecular breeding method for improving strength and micronaire value of cotton fibers Download PDFInfo
- Publication number
- CN102229981B CN102229981B CN 201110127228 CN201110127228A CN102229981B CN 102229981 B CN102229981 B CN 102229981B CN 201110127228 CN201110127228 CN 201110127228 CN 201110127228 A CN201110127228 A CN 201110127228A CN 102229981 B CN102229981 B CN 102229981B
- Authority
- CN
- China
- Prior art keywords
- cotton
- molecule marker
- mic value
- strength
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a molecular breeding method for improving the strength and micronaire value of cotton fibers, which is specially applied to directionally improving the agronomic traits and breeding new varieties of crops (cotton). By detecting the cotton fiber quality of chromosome segment introgression lines of island cotton, an introgression line IL088-A7-3 is screened, the fiber strength of which is significantly increased and the micronaire value is significantly reduced. The introgression line which is used as the non-recurrent parent is hybridized with the early maturing upland cotton variety No.38 from the Xinjiang cotton-planting area which is used as the recurrent parent, then back-crossed in two generations and self-crossed in three generations, so as to screen a cotton new line which is excellent in both fiber strength and micronaire value through the auxiliary selection by using molecular marking. By use of the method provided by the invention, the high-quality high-yield cotton new line 'island cotton No.3 of Nanjing agricultural university' has been bred.
Description
(1)
Technical field:
The present invention is a kind of to utilize the molecular breeding method of sea island cotton chromosome segment introgressive line improvement cotton fiber strength and mic value, is exclusively used in all good New cotton lines (new variety) of quickly and efficiently seed selection and producd fibers intensity and mic value.
(2) background technology:
Cotton is global Important Economic crop.China is the big producing country of cotton, consumption big country and weaving big country.As Cotton Production big country, China main product cotton region covers 16 provinces, city (autonomous region), plants 7000-8,000 ten thousand mu of cotton areas throughout the year, and approximately 6,000,000 tons of gross outputs account for 1/4th of world's gross output.Along with the progress of textile technology, textile product also develops into high grade cotton yarn even reaches 100 fine sand from coarse yarn, and processing object also has general medium staple cotton to develop into middle long stapled cotton, long stapled cotton and super long stapled cotton.(the Wang Yanqin such as Wang Yanqin, Yang Wei China, Xu Hongxia, Zhou Dayun, Feng Xinai, Kuang Meng. Main Problems and suggestion in the China's Cotton Production. Chinese agronomy circular, 2009,25 (14): 86-90) chose 546 basic points in three large main product cotton regions in 2003-2007 years continuous 5 years, 2201 parts of cotton samples carry out fiber quality and detect average 28.8 mm of staple length that find China's upland cotton sample, luffing 24.0 ~ 34.7 mm mainly are in medium staple (28.0 ~ 31.0 mm) scope of medium staple cotton, namely in long scope; Average 28.3 cN/tex of strength, luffing 19.7-38.3 cN/tex, that majority is in is medium (26.0 ~ 29.0cN/tex) scopes, namely in to strong scope; Mic value is average 4.2, and luffing 2.0 ~ 5.2 is most in (3.7 ~ 4.9) scope.Cotton can satisfy the needs of textile industry substantially, but lacks length more than 31 mm, and strength is more than 34 cN/tex, and the extra best best kind of mic value between 3.7 ~ 4.2 satisfies the needs that spin 60 above high grade cotton yarns.
The genetic analysis of general cotton variety fibrous quality proterties all shows typical amounts character inheritance mode, is subject to environmental influence.In different segregating populations, additivity, dominant or epistasis effect all may be occupied an leading position.Utilizing the high-tenacity proterties of wild species and the fine quality gene recombination of sea island cotton gradually to blend transformation, is the main path that contemporary breeding man obtains high tenacity fibre.Sea island cotton is long breeding time, and in ripe evening, bell is little, and output is lower than upland cotton, but fiber finer is strong, is the high-count yarn spun raw material; And the output of upland cotton is high, wide adaptability, and fibrous quality is medium, but significantly is better than Asiatic cotton and cotton.The F of upland cotton, both hybridization of sea island cotton
1Can educate, phenotype is normal, and the hybrid vigour of obvious output, quality is arranged, and India, Israel, China successfully cultivate and goes to sea, the spread utilization on producing of land cross-fertilize seed.But the madness of the typical species hybridization of Posterity phenotype of both hybridization is separated, and the cotton breeding man is out for cultivating always both has the high yield of upland cotton, the new variety of sea island cotton high-quality is arranged again, never success.The application of molecular marking technique in fibrous quality improvement breeding greatly reduced the blindness of selecting in the breeding process, realizes that fast the external source elite germplasm permeates to Cultivar, has widened the hereditary basis of kind.Both at home and abroad the researchist has carried out a large amount of QTL Position Research to fibrous quality, and what have is used for the marker assisted selection breeding practice.
Chromosome segment introgressive line (Chromosome segment introgression lines, CSIL) be to utilize hybridization, backcross and whole genomic a series of near isogenic lines of nurse crop that molecular marker assisted selection (marker-assisted selection, MAS) makes up.Only from a chromosome segment that isozygotys of donor parents, and genomic rest part is identical with recurrent parent in its genome.It is to carry out genome research, the particularly ideal material of QTL location and Molecular design breeding.Wan Jianmin (Wan Jianmin. Perspectives of Molecular Design Breeding in Crops. Acta Agronomica Sinica, 2006,32(3): 455-462.) utilized the chromosome segment substitution line that is made up by japonica rice Asominori (recurrent parent) and long-grained nonglutinous rice IR24 (nonrecurrent parent) to carry out the practice of molecular breeding.
(3) summary of the invention
Technical problemA kind of molecular breeding method that utilizes sea island cotton chromosome segment introgressive line improvement cotton fiber strength and mic value, overcome and alleviate serious Linkage drag that sea-land hybridization exists and, be conducive to that fibre strength and the good genetic resources of mic value import in the upland cotton in the sea island cotton.Backcross and can recover the genetic background of recurrent parent, preserved simultaneously the favourable proterties of nonrecurrent parent, binding molecule marker assisted selection objective trait can rapidly and efficiently be cultivated all good New cotton lines of fibre strength and mic value.
Technical scheme
A kind of molecular breeding method that utilizes sea island cotton chromosome segment introgressive line improvement cotton fiber strength and mic value comprises:
1) take the new land of Xinjiang cotton kind early No. 38 as recurrent parent (♀), importing with the IL088-A7-3 chromosome segment is nonrecurrent parent (♂), hybridizes for 1 generation, in 2 generations that backcrossed, obtain BC
2F
1, per generation all is the mixed miscegenation of receiving;
2) auxiliary for the first time foreground selection: the BC of molecule marker
2F
1Plantation, use the CTAB method and extract DNA, adopt molecule marker primer pair NAU3028, NAU2887, NAU3380, NAU2002, NAU2108, NAU2186, JESPR65, JESPR228, NAU1362 on the IL088-A7-3 introgressed segment to carry out pcr amplification, select simultaneously
Contain(molecular weight is respectively 225bp to 9 molecule marker bands; 450bp; 395bp; 600bp; 350bp; 360bp; 145bp; 310bp; Individual plant selfing 335bp) obtains BC
2F
2, seed is pressed the individual plant results;
| Primer pair | Product size (bp) | Forward primer sequence (5 '-3 ') | Reverse primer sequence (5 '-3 ') |
| NAU3028 | 225 | GCTCACAAGTTCCAACATCA | AAGAAATTACAAGCCCATGC |
| NAU2887 | 450 | CACCATGAGCCACTAATTCA | ACACATTTTTCCCTTTTTGG |
| NAU3380 | 395 | CACCATGAGCCACTAATTCA | GAGAGACAGTGAGCAAACGA |
| NAU2002 | 600 | GCCCTTTTTGGTAGATGAAC | ATCACTTCAGCTGGGGTTT |
| NAU2108 | 350 | GGGGACTTCATCTGGTTCTA | CAGTAGGCCAAGTCTCTCGT |
| NAU2186 | 360 | CAAAACGCTTTCGAATACAA | GATTACACCGCAGAGTCCTT |
| JESPR65 | 145 | CCACCCAATTTAAGAAGAAATTG | GGTTAGTTGTATTAGGGTCGTTG |
| JESPR228 | 310 | CAGAACAACACCATCAACACTCTCAG | GGCAAGCAAAGCAAAACTC |
| NAU1362 | 335 | TCTGATTTGCTGATTGGAAA | CTTATTCGGACTTGGTTGCT |
3) the auxiliary for the second time foreground selection of molecule marker: plantation BC
2F
2, after DNA was extracted in every strain, recycling molecule marker primer pair NAU3028, NAU2887, NAU3380, NAU2002, NAU2108, NAU2186, JESPR65, JESPR228, NAU1362 determined BC
2F
2The genotype of individual plant, simultaneously
Only have(molecular weight is respectively 225bp to 9 molecule marker bands; 450bp; 395bp; 600bp; 350bp; 360bp; 145bp; 310bp; Individual plant selfing 335bp) obtains BC
2F
3, BC
2F
3Be the improved line of improvement cotton fiber strength and mic value, the BC of described improvement cotton fiber strength and mic value
2F
3Middle selection staple length 30.40-31.60 mm, fibre strength 32.6-34.5cN/tex, mic value 3.43-4.19, the heavy 5.08-5.85 g of single bell, the family of ginning outturn 38.2-41.3% is improved line " Nan Nonghai leads No. 3 ".The newer land of this strain fibre strength early significantly increases for No. 38, and the newer land of mic value early significantly reduces for No. No. 38, the new land of staple length and output and recurrent parent early No. No. 38 suitable.
Beneficial effect:Provided by the present invention
A kind of molecular breeding method that utilizes sea island cotton chromosome segment introgressive line improvement cotton fiber strength and mic valueCompare with traditional pyramiding breeding technology that backcrosses and to have following advantage: traditional pyramiding breeding technology that backcrosses exist the crossing work amount large, select poor reliability, the long defective of breeding cycle.By the molecular marker assisted selection objective trait, can in 2-3, rapidly and efficiently cultivate the New cotton line of the multiple target characters such as high yield, high-quality.
"
Nan Nonghai leads No. 3 " major advantage: so that sea island cotton chromosome segment introgressive line---IL088-A7-3 is as donor material, take new land early No. 38 as recurrent parent, early No. 38 quite to have obtained the new land of output and recurrent parent by molecular marker assisted selection, fibre strength significantly increases, the significantly reduced New cotton line of mic value " Nan Nonghai leads No. 3 ".The fibre strength 32.6-34.5cN/tex of this strain, mic value 3.43-4.19.
(4) description of drawings:
The New cotton line that Fig. 1 molecular marker assisted selection fibre strength and mic value are good
(5) biological preservation:
IL088-A7-3 be upland cotton (
Gossypium hirsutum.), on March 15th, 2011 was preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, address, and Institute of Microorganism, Academia Sinica, culture presevation number is CGMCC NO.4684.
(6) embodiment:
Selection parent:Agricultural University Of Nanjing's crop genetic and germplasm innovation National Key Laboratory Cotton Research Institute are take upland cotton Genetic standard line TM-1 as recurrent parent, sea island cotton sea 7124 product disease-resistant, high-quality are donor parents (nonrecurrent parent), at the advanced lines that backcrosses in conjunction with covering complete genomic SSR molecular marker assisted selection, cultivated 174 of the sea island cotton chromosome segment introgressive lines of domestic first cover upland cotton Genetic standard line TM-1 background, its genomic fraction of coverage reaches 83.5%.Detect by sea island cotton chromosome segment introgressive line being carried out continuous 2 years cotton fibre quality, filter out staple length and significantly be better than the introgressive line IL088-A7-3 that contrasts.This introgressive line staple length 31.26-31.7mm, fibre strength 34.4-34.5cN/tex, mic value 4.3-4.4, the heavy 6.7-6.8 g of single bell, ginning outturn 35.3-36.2%, individual plant bell count 15-19, plant height 95-105 cm.
The new land of Xinjiang cotton kind early No. 38 be the high yield of Agriculture Construction No.7 Division Agricultural Science Institute of Xinjiang Production Construction Army's seed selection, disease-resistant new cotton variety, 2008 by Xinjiang autonomous region crop varietal approval committee (variety certification number: new examining cotton 2008 No. 32).This kind staple length 30.62-31.28mm, fibre strength 31.8-32.1cN/tex, mic value 4.09-4.19, the heavy 6.45-6.56 g of single bell, ginning outturn 37.1-37.4%, individual plant bell count 8-12, plant height 80-85 cm.
Breed breeding:Winter in 2007 Sanya, Hainan take the new land of Xinjiang cotton kind early No. 38 as male parent, IL088-A7-3 is maternal preparing hybrid F
1Planted respectively the new land of delegation early No. 38 and F in summer in 2008 in testing station, Agricultural University Of Nanjing Jiangpu
1, take new land early No. 38 as male parent, F
1Be maternal preparing hybrid combination results BC
1F
1, ripe rear all mixed receipts.Winter in 2008 was planted respectively the new land of delegation early No. 38 and BC at Sanya, Hainan
1F
1, take new land early No. 38 as male parent, F
1Be maternal preparing hybrid combination results BC
2F
1, ripe rear all mixed receipts.Field management is carried out according to a conventional method.
Molecular marker assisted selection:Summer in 2009 was planted 3 row BC in testing station, Agricultural University Of Nanjing Jiangpu
2F
1Every row 10-12 strain, the blade that every strain collection 3-4 sheet does not launch is put into the eppendorf pipe of 1.5ml, and the freshly prepared Extraction buffer 600 μ l of adding precooling, electric drill grinds, application CTAB method (Paterson AH, Brubaker CL, Wendel JF. A rapid method for extraction of cotton (
GossypiumSpp.) genomic DNA suitable for RFLP or PCR analysis [J]. Plant Mol Biol Rep, 1993,11,2:122-127) extract DNA, adopt the molecule marker (table 1) on the IL088-A7-3 introgressed segment to carry out pcr amplification, amplification system 10
μL, dna profiling 1
μL, 94 ℃ of denaturation 5min, 94 ℃ of sex change 0.5min, 57 ℃ of renaturation 0.5min, 72 ℃ are extended 1min, and after 30 circulations, 72 ℃ are extended 10 min again, amplified production is through native polyacrylamide gel electrophoresis: gel strength is 8%, and electrophoretic buffer is 0.5 times of TBE, 170V constant voltage electrophoresis 1.5 hours.5 individual plant selfing that selection contains 3 molecule markers obtain BC
2F
2, seed is pressed the individual plant results.
Winter in 2009 is at each BC of Sanya, Hainan
2F
2Plant 3 row, every row 10-12 strain amounts to 15 row, the 150-180 strain, and every strain gathers blade, and behind the extraction DNA, the molecule marker that utilizes table 1 to provide is determined BC
2F
2The genotype of individual plant, selecting 3 marks all is that the individual plant selfing of isozygotying obtains 10 strain BC
2F
3
Field test:Summer in 2010, each BC
2F
3Plant 2 row in Xinjiang, every row 15-20 strain, twice repetition.After spending by the mixed cotton receiving of row after ripe, every row is got 12 gram gined cotton samples, repeats 2 times, send Henan cotton quality inspection center detection gined cotton quality.The BC of above-described improvement cotton fiber strength and mic value
2F
3Middle selection staple length 30.40-31.60 mm, fibre strength 32.6-34.5cN/tex, mic value 3.43-4.19, the heavy 5.08-5.85 g of single bell, the family of ginning outturn 38.2-41.3% is improved line " Nan Nonghai leads No. 3 ".The newer land of this strain fibre strength early significantly increases for No. 38, and the newer land of mic value early significantly reduces for No. 38, the new land of staple length and output and recurrent parent early No. 38 suitable.
The SSR molecule marker of table 1 IL088-A7-3 introgressed segment
| Primer pair | Product size (bp) | Forward primer sequence (5 '-3 ') | Reverse primer sequence (5 '-3 ') |
| NAU3028 | 225 | GCTCACAAGTTCCAACATCA | AAGAAATTACAAGCCCATGC |
| NAU2887 | 450 | CACCATGAGCCACTAATTCA | ACACATTTTTCCCTTTTTGG |
| NAU3380 | 395 | CACCATGAGCCACTAATTCA | GAGAGACAGTGAGCAAACGA |
| NAU2002 | 600 | GCCCTTTTTGGTAGATGAAC | ATCACTTCAGCTGGGGTTT |
| NAU2108 | 350 | GGGGACTTCATCTGGTTCTA | CAGTAGGCCAAGTCTCTCGT |
| NAU2186 | 360 | CAAAACGCTTTCGAATACAA | GATTACACCGCAGAGTCCTT |
| JESPR65 | 145 | CCACCCAATTTAAGAAGAAATTG | GGTTAGTTGTATTAGGGTCGTTG |
| JESPR228 | 310 | CAGAACAACACCATCAACACTCTCAG | GGCAAGCAAAGCAAAACTC |
| NAU1362 | 335 | TCTGATTTGCTGATTGGAAA | CTTATTCGGACTTGGTTGCT |
Annotate: JESPR is from (Reddy O U K such as Reddy, Pepper A E, Abdurakhmonov I Y, Saha S, Jenkins J N, Brooks T D, Bolek Y, El2Zik K M1 The identification of dinucleotide and trinucleotide microsatellite repeat loci from cotton G. hir sutum L. J Cotton Sci, 2001, the sequence of 5:103-113) announcing; The primer of NAU numbering is developed (Han Z G, Guo W Z, Song X L, et al. Genetic mapping of EST-derived microsatellites from the diploid by this laboratory from the EST-SSR sequence
Gossypium arboreumIn allotetraploid cotton. Mol Gen Genomics, 2004,272:308-327; Han Z G, Wang C B, Song X L, et al. Characteristics, development and mapping of
Gossypium hirsutumDerived EST-SSRs in allotetraploid cotton. Theor Appl Genet, 2006,112:430-439; Wangzhen Guo, Caiping Cai, Changbiao Wang, et al. A preliminary analysis of genome structure and composition in Gossypium hirsutum. BMC Genomics, 2008,9:314-331.). all primer information can be downloaded from website www.cottonmarkers.org.
Sequence table
＜110〉Agricultural University Of Nanjing
＜120〉a kind of molecular breeding of improveing cotton fiber strength and mic value
Method
＜130〉specification sheets
<140> 00
<141> 2011-04-11
<160> 18
<170> PatentIn version 3.1
<210> 1
<211> 20
<212> DNA
＜213〉synthetic
<220>
＜221〉NAU3028 forward primer sequence
<222> (1)..(20)
<400> 1
gctcacaagt tccaacatca 20
<210> 2
<211> 20
<212> DNA
＜213〉synthetic
<220>
＜221〉NAU3028 reverse primer sequence
<222> (1)..(20)
<400> 2
aagaaattac aagcccatgc 20
<210> 3
<211> 20
<212> DNA
＜213〉synthetic
<220>
＜221〉NAU2887 forward primer sequence
<222> (1)..(20)
<400> 3
caccatgagc cactaattca 20
<210> 4
<211> 20
<212> DNA
＜213〉synthetic
<220>
＜221〉NAU2887 reverse primer sequence
<222> (1)..(20)
<400> 4
acacattttt ccctttttgg 20
<210> 5
<211> 20
<212> DNA
＜213〉synthetic
<220>
＜221〉NAU3380 forward primer sequence
<222> (1)..(20)
<400> 5
caccatgagc cactaattca 20
<210> 6
<211> 20
<212> DNA
＜213〉synthetic
<220>
＜221〉NAU3380 reverse primer sequence
<222> (1)..(20)
<400> 6
gagagacagt gagcaaacga 20
<210> 7
<211> 20
<212> DNA
＜213〉synthetic
<220>
＜221〉NAU2002 forward primer sequence
<222> (1)..(20)
<400> 7
gccctttttg gtagatgaac 20
<210> 8
<211> 19
<212> DNA
＜213〉synthetic
<220>
＜221〉NAU2002 reverse primer sequence
<222> (1)..(19)
<400> 8
atcacttcag ctggggttt 19
<210> 9
<211> 20
<212> DNA
＜213〉synthetic
<220>
＜221〉NAU2108 forward primer sequence
<222> (1)..(20)
<400> 9
ggggacttca tctggttcta 20
<210> 10
<211> 20
<212> DNA
＜213〉synthetic
<220>
＜221〉NAU2108 reverse primer sequence
<222> (1)..(20)
<400> 10
cagtaggcca agtctctcgt 20
<210> 11
<211> 20
<212> DNA
＜213〉synthetic
<220>
＜221〉NAU2186 forward primer sequence
<222> (1)..(20)
<400> 11
caaaacgctt tcgaatacaa 20
<210> 12
<211> 20
<212> DNA
＜213〉synthetic
<220>
＜221〉NAU2186 reverse primer sequence
<222> (1)..(20)
<400> 12
gattacaccg cagagtcctt 20
<210> 13
<211> 23
<212> DNA
＜213〉synthetic
<220>
＜221〉JESPR65 forward primer sequence
<222> (1)..(23)
<400> 13
ccacccaatt taagaagaaa ttg 23
<210> 14
<211> 23
<212> DNA
＜213〉synthetic
<220>
＜221〉JESPR65 reverse primer sequence
<222> (1)..(23)
<400> 14
ggttagttgt attagggtcg ttg 23
<210> 15
<211> 26
<212> DNA
＜213〉synthetic
<220>
＜221〉JESPR228 forward primer sequence
<222> (1)..(26)
<400> 15
cagaacaaca ccatcaacac tctcag 26
<210> 16
<211> 19
<212> DNA
＜213〉synthetic
<220>
＜221〉JESPR228 reverse primer sequence
<222> (1)..(19)
<400> 16
ggcaagcaaa gcaaaactc 19
<210> 17
<211> 20
<212> DNA
＜213〉synthetic
<220>
＜221〉NAU1362 forward primer sequence
<222> (1)..(20)
<400> 17
tctgatttgc tgattggaaa 20
<210> 18
<211> 20
<212> DNA
＜213〉synthetic
<220>
＜221〉NAU1362 reverse primer sequence
<222> (1)..(20)
<400> 18
cttattcgga cttggttgct 20
Claims (1)
1.
A kind of molecular breeding method that utilizes sea island cotton chromosome segment introgressive line improvement cotton fiber strength and mic value,Comprise:
1) take the new land of Xinjiang cotton kind early No. 38 as recurrent parent ♀, importing with the IL088-A7-3 chromosome segment is nonrecurrent parent ♂, hybridizes for 1 generation, 2 generations acquisition BC backcrosses
2F
1, per generation all is the mixed miscegenation of receiving; The IL088-A7-3 preserving number is CGMCC NO.4684;
2) auxiliary for the first time foreground selection: the BC of molecule marker
2F
1Plantation, use the CTAB method and extract DNA, adopt molecule marker primer pair NAU3028, NAU2887, NAU3380, NAU2002, NAU2108, NAU2186, JESPR65, JESPR228, NAU1362 on the IL088-A7-3 introgressed segment to carry out pcr amplification, select simultaneously
Contain9 molecule marker bands are respectively 225bp; 450bp; 395bp; 600bp; 350bp; 360bp; 145bp; 310bp; The individual plant selfing of 335bp obtains BC
2F
2, seed is pressed the individual plant results;
3) the auxiliary for the second time foreground selection of molecule marker: plantation BC
2F
2, after DNA was extracted in every strain, recycling molecule marker primer pair NAU3028, NAU2887, NAU3380, NAU2002, NAU2108, NAU2186, JESPR65, JESPR228, NAU1362 determined BC
2F
2The genotype of individual plant, simultaneously
Only have9 molecule marker bands are respectively 225bp; 450bp; 395bp; 600bp; 350bp; 360bp; 145bp; 310bp; The individual plant selfing of 335bp obtains BC
2F
3, BC
2F
3Middle selection staple length 30.40-31.60 mm, fibre strength 32.6-34.5cN/tex, mic value 3.43-4.19, the heavy 5.08-5.85 g of single bell, the family of ginning outturn 38.2-41.3% is the improved line of improveing cotton fiber strength and mic value.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110127228 CN102229981B (en) | 2011-05-17 | 2011-05-17 | Molecular breeding method for improving strength and micronaire value of cotton fibers |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110127228 CN102229981B (en) | 2011-05-17 | 2011-05-17 | Molecular breeding method for improving strength and micronaire value of cotton fibers |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102229981A CN102229981A (en) | 2011-11-02 |
| CN102229981B true CN102229981B (en) | 2013-04-10 |
Family
ID=44842586
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110127228 Expired - Fee Related CN102229981B (en) | 2011-05-17 | 2011-05-17 | Molecular breeding method for improving strength and micronaire value of cotton fibers |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102229981B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103509861A (en) * | 2013-08-12 | 2014-01-15 | 南京农业大学 | Molecular breeding method for synchronously improving length, strength, and fineness of cotton fiber through polymerizing chromosome segment introgression lines |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103392587A (en) * | 2013-06-26 | 2013-11-20 | 江苏省农业科学院 | Breeding method for improving lint percentage and micronaire value of green fiber cotton |
| CN110093345B (en) * | 2019-05-09 | 2020-11-10 | 江苏省农业科学院 | SSR molecular marker related to cotton fiber strength and micronaire value and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1144881C (en) * | 2002-11-07 | 2004-04-07 | 南京农业大学 | Method for assortative breeding cotton variety by molecular-marking, auxiliary modifying and backcross aggregate |
| CN1528912A (en) * | 2003-10-21 | 2004-09-15 | 南京农业大学 | Cotton high-strong fiber gene major gene site and moloecular labelling thereof |
-
2011
- 2011-05-17 CN CN 201110127228 patent/CN102229981B/en not_active Expired - Fee Related
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103509861A (en) * | 2013-08-12 | 2014-01-15 | 南京农业大学 | Molecular breeding method for synchronously improving length, strength, and fineness of cotton fiber through polymerizing chromosome segment introgression lines |
| CN103509861B (en) * | 2013-08-12 | 2015-05-13 | 南京农业大学 | Molecular breeding method for synchronously improving length, strength, and fineness of cotton fiber through polymerizing chromosome segment introgression lines |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102229981A (en) | 2011-11-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102229979B (en) | Molecular breeding method capable of improving length of cotton fibers by using gossypium barbadense chromosome segment introgression line | |
| CN103571852B (en) | Sea island cotton chromosome segment and a SSR marker thereof that significantly can increase upland cotton ginning outturn | |
| CN102925436B (en) | Cotton highly-verticillium wilt resistant major QTL (quantitative trait locus) and SSR molecular marker thereof | |
| CN103497949B (en) | The molecule marker relevant with cotton fiber strength from sea island cotton sea 1 and application thereof | |
| CN101492738B (en) | Onion cytoplasmic male sterility SCAR mark and uses thereof | |
| CN101760510A (en) | Research and utilization progress of wheat dwarf stem gene | |
| CN104313016B (en) | The molecular labeling of the QTL/ major gene resistance relevant with cotton verticillium wilt resistance | |
| CN102229982B (en) | Molecular breeding method for improving cotton fiber length, fiber strength, and micronaire value | |
| CN110305980B (en) | Breeding method and application of anti-clubroot high-oleic-acid rape | |
| CN101487056B (en) | Method for assistantly screening anti-stripe rust wheat, and special primer therefor | |
| CN106755432B (en) | Upland cotton chromosome segment capable of remarkably increasing sea island cotton ginning outturn, SSR marker primer and application thereof | |
| CN102229981B (en) | Molecular breeding method for improving strength and micronaire value of cotton fibers | |
| CN105524999A (en) | Molecular marker linked with sea island cotton fiber length of cotton | |
| CN105132570A (en) | Primer combination assisting in screening stripe-rust-resistant wheat and application of primer combination | |
| CN101773067B (en) | Method for recurrently and selectively breeding non-glutinous rice by using recessive cytoblast sterile material | |
| CN102229980B (en) | Molecular breeding method for improving micronaire value of cotton by using chromosome segment introgression lines of island cotton | |
| CN107058485A (en) | One can significantly improve the heavy upland cotton chromosome segment of island cotton boll and its SSR label primer and application | |
| CN110607382B (en) | SNP molecular marker of single ring weight major gene from Xinluzao 24 | |
| CN102517396B (en) | Molecular breeding method for breeding new anti-verticillium cotton seed | |
| CN104278028B (en) | It is positioned at haynaldia villosa 6VS DNA and penetrates into wheat anti-powdery mildew NIL sequence and application | |
| CN104531886A (en) | Identification method of D1 type rice cytoplasmic sterile line and hybrid combination thereof | |
| CN103509861B (en) | Molecular breeding method for synchronously improving length, strength, and fineness of cotton fiber through polymerizing chromosome segment introgression lines | |
| CN107980618B (en) | Molecular breeding method for improving strength of cotton fibers by using chr.7 single QTL (quantitative trait locus) fragment replacement line | |
| CN108184652B (en) | Molecular breeding method for improving cotton fiber length by using chr.19 single QTL fragment replacement line | |
| CN101986829B (en) | Pyramiding breeding method for culturing excellent-taste high-yield rice variety resisting stripe virus disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130410 Termination date: 20150517 |
|
| EXPY | Termination of patent right or utility model |