CN102229982B

CN102229982B - Molecular breeding method for improving cotton fiber length, fiber strength, and micronaire value

Info

Publication number: CN102229982B
Application number: CN2011101272527A
Authority: CN
Inventors: 张天真; 王鹏; 郭旺珍; 曹志斌
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2011-05-17
Filing date: 2011-05-17
Publication date: 2012-11-07
Anticipated expiration: 2031-05-17
Also published as: CN102229982A

Abstract

The invention relates to a molecular breeding method for improving cotton fiber lengths, fiber strengths, and micronaire values. The method is applied in oriented improving of crop (cotton) agronomic properties, and in selective breeding of novel breeds. According to the invention, cotton fiber quality detection is carried out upon gossypium barbadense chromosome segment introgression lines (CSIL), and an introgression line IL080-D6-1 with substantially increased fiber length and fiber strength, and substantially reduced micronaire value is selected. The introgression line is regarded as a non-backcross parent, and Xinluzao No.38, which is a breed from Xinjiang cotton region, is regarded as a backcross parent. Crossing is carried out between the two. The resulting breeds are backcrossed for 2 generations and self for 3 generations. With molecular marker auxiliary selection, a novel cotton line with good fiber length, fiber strength, and micronaire value is obtained. With the method, a novel high-quality and high-yield cotton line, which is Nannong gossypium barbadense No.2, is obtained.

Description

A kind of molecular breeding method of improveing cotton fiber length, fibre strength and mic value

(1) technical field: a kind of molecular breeding method that utilizes sea island cotton chromosome segment introgressive line improvement cotton fiber length, fibre strength and mic value of the present invention is exclusively used in all good cotton new lines (new variety) of seed selection quickly and efficiently and producd fibers length, fibre strength and mic value.

(2) background technology:

Cotton is global important cash crop.China is the big producing country of cotton, consumption big country and weaving big country.As cotton production big country, China main product cotton region covers 16 provinces, city (autonomous region), plants 7000-8,000 ten thousand mu of cotton areas throughout the year, and about 6,000,000 tons of gross output accounts for 1/4th of world's gross output.Along with the progress of textile technology, textile product also develops into high grade cotton yarn even reaches 100 spun yarn from coarse yarn, and processing object also develops into middle long stapled cotton, long stapled cotton and ultra long stapled cotton by general medium staple cotton.(Wang Yanqin, Yang Wei China, Xu Hongxia such as Wang Yanqin; Zhou Dayun, Feng Xinai, it is violent to rectify. subject matter that exists in the China's Cotton Production and suggestion. Chinese agronomy circular; 2009; 25 (14): 86-90) chose 546 basic points in three big main product cotton regions in 2003-2007 years continuous 5 years, 2201 parts of cotton samples carry out fiber quality and detect average 28.8 mm of staple length that find China's upland cotton sample, luffing 24.0 ~ 34.7 mm; Mainly be in medium staple (28.0 ~ 31.0 mm) scope of medium staple cotton, promptly in long scope; Fracture specific tenacity average 28.3 cN/tex, luffing 19.7-38.3 cN/tex, that majority is in is medium (26.0 ~ 29.0cN/tex) scopes, promptly in to strong scope; Mic value is average 4.2, and luffing 2.0 ~ 5.2 is most in (3.7 ~ 4.9) scope.The China cotton can be satisfied the needs of textile industry basically, but lacks length more than 31 mm, and the fracture specific tenacity is more than 34 cN/tex, and the extra best best kind of mic value between 3.7 ~ 4.2 satisfies the needs that spin 60 above high grade cotton yarns.

The genetic analysis of general cotton variety fibrous quality proterties all shows typical amounts character inheritance mode, is subject to environmental influence.In different segregating populations, additivity, dominance or epistasis effect all possibly occupied an leading position.Utilizing the high-tenacity proterties of wild species and the fine quality gene recombination of sea island cotton gradually to blend transformation, is the main path that contemporary breeding man obtains high tenacity fibre.Sea island cotton is long breeding time, and in ripe evening, bell is little, and output is lower than upland cotton, but fiber finer is strong, is the high-count yarn spun raw material; And the output of upland cotton is high, wide adaptability, and fibrous quality is medium, but significantly is superior to Asiatic cotton and cotton.The F of upland cotton, both hybridization of sea island cotton ₁Can educate, phenotype is normal, and the hybrid vigour of tangible output, quality is arranged, and India, Israel, China successfully cultivate and goes to sea, land cross-fertilize seed big area utilization and extention on producing.But the offspring of both hybridization shows the madness of typical species hybridization and separates, and the cotton breeding man is out for cultivating always both has the high yield of upland cotton, sea island cotton fine new variety is arranged, never success again.The application of molecular marking technique in fibrous quality improvement breeding significantly reduced the blindness of selecting in the breeding process, and Rapid Realization external source elite germplasm permeates to Cultivar, has widened the hereditary basis of kind.Both at home and abroad the researchist has carried out a large amount of QTL Position Research to fibrous quality, and what have is used for the marker assisted selection breeding practice.

Chromosome segment introgressive line (Chromosome segment introgression lines; CSIL) be to utilize hybridization; Backcross and molecular marker assisted selection (marker-assisted selection, a series of near isogenic lines of the nurse crop whole genome that MAS) makes up.Only from a chromosome segment that isozygotys of donor parents, and genomic rest part is identical with recurrent parent in its genome.It is to carry out genome research, the particularly ideal material of QTL location and molecular designing breeding.Wan Jianmin (Wan Jianmin. the breeding of crop molecular designing. Acta Agronomica Sinica; 2006,32 (3): 455-462.) utilized the chromosome segment substitution line that makes up by japonica rice Asominori (recurrent parent) and long-grained nonglutinous rice IR24 (nonrecurrent parent) to carry out the practice of molecular breeding.

(3) summary of the invention

A kind of molecular breeding method that utilizes sea island cotton chromosome segment introgressive line improvement cotton fiber length, fibre strength and mic value of technical problem; Overcome and alleviate serious chain burden that sea-land hybridization exists and filial generation and separate to the two poles of the earth are mad, help in the good genetic resources importing upland cotton of fibrous quality in the sea island cotton.Backcross and can recover the genetic background of recurrent parent, preserved the favourable proterties of nonrecurrent parent simultaneously, binding molecule marker assisted selection objective trait can rapidly and efficiently be cultivated all good cotton new lines of staple length, fibre strength and mic value.

A kind of molecular breeding method that utilizes sea island cotton chromosome segment introgressive line improvement cotton fiber length, fibre strength and mic value of technical scheme comprises:

1) with the new land of Xinjiang cotton kind early No. 38 be recurrent parent (♀), be nonrecurrent parent (♂) with IL080-D6-1 chromosome segment introgressive line, hybridized for 1 generation, in 2 generations of backcrossing, obtain BC ₂F ₁, per generation all is to mix to receive miscegenation;

2) molecule marker is auxiliary selects for the first time: BC ₂F ₁Plantation, application of ct scan AB method is extracted DNA, and the molecule marker primer that adopts IL080-D6-1 to import on the fragment carries out pcr amplification to NAU3677, NAU2679, NAU6588, NAU1454, and (molecular weight is respectively 180bp to select to contain 4 molecule marker bands simultaneously; 500bp; 300bp; Individual plant selfing 300bp) obtains BC ₂F ₂, seed is pressed the individual plant results;

Primer is right	Product size (bp)	Forward primer sequence (5 '-3 ')	Reverse primer sequence (5 '-3 ')
				NAU3677	180	TGATACAATCAGCCAAACACA	GGCATTTGCAGGTTTTATTT
NAU2679	500	TGGCTGAACTTTGCAATTTA	AAGCAAGGGAGGTAATCCTT
				NAU6588	300	TCCAACTTCAGCTCTGACAA	ATGCCAAAGTCACAAAGTCA
NAU1454	300	GCTGAAGACGGTTGAGTTTT	ACACCTTCCCCTTATTCTCC

3) molecule marker is auxiliary selects for the second time: plantation BC ₂F ₂, every strain utilizes the molecule marker primer that NAU3677, NAU2679, NAU6588, NAU1454 are confirmed BC after extracting DNA again ₂F ₂The genotype of individual plant, (molecular weight is respectively 180bp to have only 4 molecule marker bands simultaneously; 500bp; 300bp; Individual plant selfing 300bp) obtains BC ₂F ₃, BC ₂F ₃Be the improved line of improvement cotton fiber length, fibre strength and mic value.The BC of described improvement cotton fiber length, fibre strength and mic value ₂F ₃The middle staple length 32.00-33.70mm that selects, fibre strength 34.4-35.7cN/tex, mic value 3.01-3.45, the heavy 5.55-6.05 g of single bell, the family of ginning outturn 36.8-37.2% is improved line " Nan Nonghai leads No. 2 ".The new land of this strain staple length and fibre strength early significantly increases for No. 38, and the new land of mic value early significantly reduces for No. 38, the new land of output and recurrent parent early No. 38 suitable.

Beneficial effect: a kind of molecular breeding method of the improvement of sea island cotton chromosome segment introgressive line cotton fiber length, fibre strength and mic value and traditional pyramiding breeding compared with techniques of backcrossing utilized provided by the present invention has following advantage: the defective that workload is big, select poor reliability, breeding cycle length is hybridized in traditional technological existence of the pyramiding breeding of backcrossing.Through the molecular marker assisted selection objective trait, can in 2-3, rapidly and efficiently cultivate the cotton new lines of multiple target characters such as high yield, high-quality.

The major advantage of " Nan Nonghai leads No. 2 ": with sea island cotton chromosome segment introgressive line---IL080-D6-1 is a donor material; With new land early No. 38 be recurrent parent; Early No. 38 quite to have obtained the new land of output and recurrent parent through molecular marker assisted selection; Staple length and fibre strength significantly increase, the significantly reduced cotton new lines of mic value " Nan Nonghai leads No. 2 ".The staple length 32.00-33.70mm of this strain, fibre strength 34.4-35.7cN/tex, mic value 3.01-3.45.

(4) description of drawings:

The cotton new lines that Fig. 1 molecular marker assisted selection staple length, fibre strength and mic value are good

(5) biological preservation:

IL080-D6-1 be upland cotton ( Gossypium hirsutum.), be preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, address on March 15th, 2011: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, culture presevation number is CGMCC NO.4685.

(6) embodiment:

Select the parent: Agricultural University Of Nanjing's crop genetic and germplasm innovation National Key Laboratory Cotton Research Institute are that TM-1 is a recurrent parent with upland cotton heredity standard; Disease-resistant, fine sea island cotton sea 7124 strains are donor parents (nonrecurrent parent); Combine to cover complete genomic SSR molecular marker assisted selection at the advanced lines of backcrossing; Cultivated domestic first cover upland cotton heredity standard and be 174 of the sea island cotton chromosome segment introgressive lines of TM-1 background, its genomic fraction of coverage reaches 83.5%.Detect through sea island cotton chromosome segment introgressive line being carried out continuous 2 years cotton fibre quality, filter out staple length and significantly be superior to the introgressive line IL080-D6-1 that contrasts.This introgressive line staple length 31.5-32.5mm, fibre strength 32.7-33.5cN/tex, mic value 4.2-4.3, the heavy 6.8-7.2 g of single bell, ginning outturn 36.8-38.8%, individual plant bell count 15-19, plant height 90-95 cm.

The new land of Xinjiang cotton kind early No. 38 be the high yield of Agriculture Construction No.7 Division Agricultural Science Institute of Xinjiang Production Construction Army's seed selection, disease-resistant new cotton variety, 2008 through Xinjiang autonomous region crop varietal approval committee (variety certification number: new examining cotton 2008 No. 32).This kind staple length 30.62-31.28mm, fibre strength 31.8-32.1cN/tex, mic value 4.09-4.19, the heavy 6.45-6.56 g of single bell, ginning outturn 37.1-37.4%, individual plant bell count 8-12, plant height 80-85 cm.

Breed breeding: winter in 2007 in Sanya, Hainan with the new land of Xinjiang cotton kind early No. 38 be male parent, IL080-D6-1 is maternal preparing hybrid F ₁Planted the new land of delegation early No. 38 and F respectively in summer in 2008 in testing station, Agricultural University Of Nanjing Jiangpu ₁, with new land early No. 38 be male parent, F ₁Be maternal preparing hybrid combination results BC ₁F ₁, ripe back is all mixed and is received.Planted the new land of delegation early No. 38 and BC respectively in winter in 2008 in Sanya, Hainan ₁F ₁, with new land early No. 38 be male parent, F ₁Be maternal preparing hybrid combination results BC ₂F ₁, ripe back is all mixed and is received.Field management is undertaken by ordinary method.

Molecular marker assisted selection: summer in 2009 is plantation 3 row BC in testing station, Agricultural University Of Nanjing Jiangpu ₂F ₁Every capable 10-12 strain, every strain collection 3-4 sheet not unfolded blade is put into the eppendorf pipe of 1.5ml, and adds the freshly prepared extraction damping fluid 600 μ l of precooling; Electric drill grinds; Application of ct scan AB method (Paterson AH, Brubaker CL, Wendel JF. A rapid method for extraction of cotton ( GossypiumSpp.) genomic DNA suitable for RFLP or PCR analysis [J]. Plant Mol Biol Rep; 1993,11,2:122-127) extract DNA; The molecule marker (table 1) that adopts IL080-D6-1 to import on the fragment carries out pcr amplification, amplification system 10 μL, dna profiling 1 μL, 94 ℃ of preparatory sex change 5min, 94 ℃ of sex change 0.5min, 57 ℃ of renaturation 0.5min; 72 ℃ are extended 1min, and after 30 circulations, 72 ℃ are extended 10 min again; Amplified production is through native polyacrylamide gel electrophoresis: gel strength is 8%, and electrophoretic buffer is 0.5 times of TBE, 170V constant voltage electrophoresis 1.5 hours.5 individual plant selfing that selection contains 4 molecule markers obtain BC ₂F ₂, seed is pressed the individual plant results.

Winter in 2009 is each BC in Sanya, Hainan ₂F ₂Plant 3 row, every capable 10-12 strain amounts to 15 row, the 150-180 strain, and blade is gathered in every strain, and behind the extraction DNA, the molecule marker that utilizes table 1 to provide is confirmed BC ₂F ₂The genotype of individual plant, selecting 4 marks all is that the individual plant selfing of isozygotying obtains 10 strain BC ₂F ₃

Identify in the field: summer in 2010, each BC ₂F ₃Plantation 2 row in Xinjiang, every capable 15-20 strain, twice repetition.After cotton was received by row is mixed in ripe back, every row was got 12 gram gined cotton samples, repeats 2 times, send Henan cotton quality inspection center to detect the gined cotton quality.The BC of above-described improvement cotton fiber length, fibre strength and mic value ₂F ₃The middle staple length 32.00-33.70mm that selects, fibre strength 34.4-35.7cN/tex, mic value 3.01-3.45, the heavy 5.55-6.05 g of single bell, the family of ginning outturn 36.8-37.2% is improved line " Nan Nonghai leads No. 2 ".The new land of this strain staple length and fibre strength early significantly increases for No. 38, and the new land of mic value early significantly reduces for No. 38, the new land of output and recurrent parent early No. 38 suitable.

Table 1 IL080-D6-1 imports segmental SSR molecule marker

Annotate: the primer of NAU numbering is developed (Han Z G, Guo W Z, Song X L, et al. Genetic mapping of EST-derived microsatellites from the diploid by this laboratory from the EST-SSR sequence Gossypium arboreumIn allotetraploid cotton. Mol Gen Genomics, 2004,272:308-327; Han Z G, Wang C B, Song X L, et al. Characteristics, development and mapping of Gossypium hirsutumDerived EST-SSRs in allotetraploid cotton. Theor Appl Genet, 2006,112:430-439; Wangzhen Guo; Caiping Cai; Changbiao Wang; Et al. A preliminary analysis of genome structure and composition in Gossypium hirsutum. BMC Genomics, 2008,9:314-331.). all primer information can be downloaded by www.cottonmarkers.org from the website.

Sequence table

< 110>Agricultural University Of Nanjing

< 120>a kind of molecular breeding method of improveing cotton fiber length, fibre strength and mic value

< 130>specification sheets

<140> 00

<141> 2011-04-11

<160> 8

<170> PatentIn?version?3.1

<210> 1

<211> 21

<212> DNA

< 213>synthetic

<220>

< 221>NAU3677 forward primer sequence

<222> (1)..(21)

<400> 1

tgatacaatc?agccaaacac?a 21

<210> 2

<211> 20

<212> DNA

< 213>synthetic

<220>

< 221>NAU3677 reverse primer sequence

<222> (1)..(20)

<400> 2

ggcatttgca?ggttttattt 20

<210> 3

<211> 20

<212> DNA

< 213>synthetic

<220>

< 221>NAU2679 forward primer sequence

<222> (1)..(20)

<400> 3

tggctgaact?ttgcaattta 20

<210> 4

<211> 20

<212> DNA

< 213>synthetic

<220>

< 221>NAU2679 reverse primer sequence

<222> (1)..(20)

<400> 4

aagcaaggga?ggtaatcctt 20

<210> 5

<211> 20

<212> DNA

< 213>synthetic

<220>

< 221>NAU6588 forward primer sequence

<222> (1)..(20)

<400> 5

tccaacttca?gctctgacaa 20

<210> 6

<211> 20

<212> DNA

< 213>synthetic

<220>

< 221>NAU6588 reverse primer sequence

<222> (1)..(20)

<400> 6

atgccaaagt?cacaaagtca 20

<210> 7

<211> 20

<212> DNA

< 213>synthetic

<220>

< 221>NAU1454 forward primer sequence

<222> (1)..(20)

<400> 7

gctgaagacg?gttgagtttt 20

<210> 8

<211> 20

<212> DNA

< 213>synthetic

<220>

< 221>NAU1454 reverse primer sequence

<222> (1)..(20)

<400> 8

acaccttccc?cttattctcc 20

Claims

1. A kind of molecular breeding method that utilizes sea island cotton chromosome segment introgressive line improvement cotton fiber length, fibre strength and mic value,Comprise:

1) with the new land of Xinjiang cotton kind early No. 38 be that recurrent parent is maternal, be the nonrecurrent parent male parent with IL080-D6-1 chromosome segment introgressive line, hybridized for 1 generation, 2 generations acquisition BC backcrosses ₂F ₁, per generation all is mix to receive miscegenation, the culture presevation of said IL080-D6-1 chromosome segment introgressive line number is CGMCC NO.4685;

2) molecule marker is auxiliary selects for the first time: BC ₂F ₁Plantation, application of ct scan AB method is extracted DNA, and the molecule marker primer that adopts IL080-D6-1 to import on the fragment carries out pcr amplification to NAU3677, NAU2679, NAU6588, NAU1454, selects to contain 4 molecule marker bands simultaneously and is respectively 180bp; 500bp; 300bp; The individual plant selfing of 300bp obtains BC ₂F ₂, seed is pressed the individual plant results;

Primer is right Product size bp Forward primer sequence 5 '-3 ' Reverse primer sequence 5 '-3 ' NAU3677 　　180 　TGATACAATCAGCCAAACACA 　GGCATTTGCAGGTTTTATTT NAU2679 　　500 　TGGCTGAACTTTGCAATTTA 　AAGCAAGGGAGGTAATCCTT NAU6588 　　300 　TCCAACTTCAGCTCTGACAA 　ATGCCAAAGTCACAAAGTCA NAU1454 　　300 　GCTGAAGACGGTTGAGTTTT 　ACACCTTCCCCTTATTCTCC

3) molecule marker is auxiliary selects for the second time: plantation BC ₂F ₂, every strain utilizes the molecule marker primer that NAU3677, NAU2679, NAU6588, NAU1454 are confirmed BC after extracting DNA again ₂F ₂The genotype of individual plant has only 4 molecule marker bands to be respectively 180bp simultaneously; 500bp; 300bp; The individual plant selfing of 300bp obtains BC ₂F ₃, at BC ₂F ₃The middle staple length 32.00-33.70mm that selects; Fibre strength 34.4-35.7cN/tex, mic value 3.01-3.45, the heavy 5.55-6.05 g of single bell; The family of ginning outturn 36.8-37.2% is the improved line of improveing cotton fiber length, fibre strength and mic value.