CN101979408A - Cotton ageing related transcription factor and coded gene and application thereof - Google Patents

Cotton ageing related transcription factor and coded gene and application thereof Download PDF

Info

Publication number
CN101979408A
CN101979408A CN 201010523844 CN201010523844A CN101979408A CN 101979408 A CN101979408 A CN 101979408A CN 201010523844 CN201010523844 CN 201010523844 CN 201010523844 A CN201010523844 A CN 201010523844A CN 101979408 A CN101979408 A CN 101979408A
Authority
CN
China
Prior art keywords
cotton
transcription factor
seq
ghnac7
senescence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 201010523844
Other languages
Chinese (zh)
Inventor
蒯本科
邱凯
魏强
梁宁菁
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fudan University
Original Assignee
Fudan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University filed Critical Fudan University
Priority to CN 201010523844 priority Critical patent/CN101979408A/en
Publication of CN101979408A publication Critical patent/CN101979408A/en
Pending legal-status Critical Current

Links

Images

Abstract

The invention belongs to the technical field of plant gene engineering, and particularly relates to a cotton ageing related transcription factor and a coded gene and application thereof. The cotton ageing related transcription factor is from upland cotton and named GhNAC7, and the amino acid sequence of the transcription factor is expressed as SEQ ID No.2. The nucleotide sequence of the coded gene of the cotton ageing related transcription factor is expressed as SEQ ID No.1 or a polynucleotide for coding SEQ ID No.2 amino acid sequence. The gene can be used for research on a cotton anti-aging molecular mechanism and improvement on delaying the plant leaf ageing property, and provides a theoretical basis for delaying cotton leaf ageing through gene engineering in future to improve the cotton yield.

Description

Cotton senescence-associated transcription factor and encoding gene thereof and application
Technical field
The invention belongs to the plant gene engineering technology field, be specifically related to grow cotton senescence-associated transcription factor and an encoding gene and an application.
Background technology
Plant senescence is meant the process that an organ or whole plants vital functions fail gradually, is physiological a series of deterioration processes before natural death, is the result (Li Qing of long-term evolution and natural selection, Zhu Yuxian, Molecular Plant Breeding, the 1st volume, the 3rd phase, 2003).Research about plant senescence mainly is to concentrate in the research of leaf senile.In the leaf senile process, (Gepstein S, Genome Biology, 5 (3): 212,2004 all take place much to change in cellularstructure, Physiological and Biochemical Metabolism and gene expression regulation etc.; Chandlee JM, Physiologia Plantarum, 113:1-8,2001; Nam HG, Trends Plant Sci, 8 (6): 272-277,2003).At physiology, biological chemistry and molecular biology aspect have many (Yoshida S. Current Opinion in Plant Biology, 6:79-84,2003 reported about leaf senile; Larry et al, Physiol Plant, 101:746-753,1997; Nam HG, Curr Opin Biotech, 8:200-207,1997; Smart CM, New Phytol, 126:419-448,1994; Nam HG, Annu Rev Plant Biol, 58:115-36,2007; Betania et al Trends Plant Sci, 5 (7): 278-282. 2000).
NAC is a peculiar class transcription factor in the higher plant, its name derives from 3 genes of the 90's of last century discovery: petunia NAM gene, Arabidopis thaliana ATAF1/2 and CUC2 gene (Aida M, et al, Plant Cell, 9 (6): 841 – 857,1997).
The topmost constructional feature of NAC transcription factor is the NAC structural domain that each member's N end contains high conservative, whole N end regions can be divided into 5 subdomains (A, B, C, D, E), wherein subdomain A, C, D high conservative, contain nuclear localization signal (nuclear localization signals in subdomain C, the D sequence, NLS), may appraise and decide relevant (the Kikuchi K of identification of certain cis element on position and the promotor with transcription factor, et al, Mol Gen Genet, 262 (6): 1047 – 1051,2000; Ooka H, et al, DNA Res, 10 (6): 239-247,2003).The E subdomain is in NAP, AtNAC3, ATAF and OsNAC3 subfamily camber conservative (Ooka H, et al, DNA Res, 10 (6): 239-247,2003).The C end is transcriptional activation function district (transcrip tional activation regions, TARs), diversity with height, the common feature of this end are the frequency height that some amino acid such as Serine, Threonine, proline(Pro), L-glutamic acid repeat.2003, Ooka etc. found 105 NAC transcription factors by full genome analysis in Arabidopis thaliana, then find 75 NAC members in paddy rice.By the aminoacid sequence of NAC structural domain relatively, they are divided into 2 big nations, 3 subtribes (OsNAC3, ATAF, NAM).According in recent years the report, NAC family be divided into again be 5 subtribes (OsNAC3, ATAF, NAM, AtNAC3, NAP).
The NAC transcription factor is at plant apical meristem and floral organ differentiation (Sablowski, et al, Cell, 92 (1): 93 – 103,1998), lateral root forms (Mitsuda N, et al, Plant Cell, 17 (11): 2993 – 3006,2005), secondary wall thickens (Xie Q, et al, Genes Dev, 14 (23): 3024 – 3036, biological (Hegedus D, et al, Plant Mol. Biol of specific growth course of plant and opposing such as 2000), 53:383-397,2003) with abiotic stress process (Nogueira FT, Plant Science, 169:93 – 106,2005) all play an important role in, the NAC transcription factor also plays important regulation (GUO YF, GAN S, Plant Journal at senescence process of plant, 46 (4): 601-612,2006).Studies show that the NAC transcription factor is built up in growth and development of plant, device palace, hormone regulation and defence are resisted aspects such as multiple biology and abiotic stress and brought into play important effect.Compared to the transcription factor of MYB class, bZIP class and WRKY class, the correlative study of NAC transcription factor is less.
AtNAP is a kind of transcription factor in the Arabidopis thaliana NAC family.Guo etc. (GUO YF, GAN S, Plant Journal, 46 (4): 601-612,2006) discover, AtNAPIn regulation and control Arabidopis thaliana aging course, play an important role; AtNAPOnly in old and feeble blade, express, and AtNAPExpression amount become positive correlation with the aging degree of blade, variation tendency and old and feeble marker gene SAG12Consistent; The arabidopsis mutant body AtnapNo matter be all to occur leaf senile hysteresis phenotype under the self-sow state or under dark induction state; Induce AtNAPWhen crossing expression, aging phenomenon in advance appears significantly in transfer-gen plant; Further discover paddy rice, string bean NAPAll can the complementary arabidopsis mutant body of allos AtnapStagnant green phenotype, illustrate that the NAP transcription factor plays an important role in the plant senescence in regulation and control.
Cotton is one of important cash crop, for the mankind provide clothing necessary cotton fibre.Along with expanding economy and growth in the living standard, the demand of cotton fibre is improved constantly, the cotton production-demand gap constantly enlarges.Our cultivated area is very limited, thereby improves the basic way that the cotton per unit area yield becomes solution cotton production-demand gap.Cotton whenever grows up to a big bell, needs two or three leaf to carry out photosynthesis, makes nutrition, could satisfy growth needs.During the land for growing field crops produced, even if there is not the harm of disease worm, and liquid manure was in liberal supply, and the cotton buds and bolls exfoliation rate reaches 60 ~ 70%.Cotton premature senescence is the subject matter of restriction output of cotton, and solving early ageing is one of key of cotton yield breeding.Research to the cotton aging in the past focuses mostly in plant physiology aspect such as hormonal readiness, removes active oxygenase etc.Cotton premature senescence mainly is to be caused by the Physiology and biochemistry effect that cotton self inherited genetic factors determines, and also few from the research of research of molecular genetics angle and transformation cotton premature senescence problem.The invention provides one with the old and feeble relevant transcription factor of cotton, for from the aging of molecular genetics angle research cotton, and it is all significant to improve the senescence characteristics of cotton by genetic engineering.
Summary of the invention
The purpose of this invention is to provide relevant NAP transcription factor and an encoding gene and the application of old and feeble regulation and control that grow cotton.
Cotton senescence-associated transcription factor provided by the present invention, derive from upland cotton ( Gossypium hirsutumL.), name is called GhNAC7, be protein, or have with the amino acid residue sequence of SEQ ID NO.2 identical active by SEQ ID NO.2 deutero-protein through replacement, disappearance or the interpolation of one or several amino-acid residue the amino acid residue sequence of SEQ ID NO.2 with SEQ ID NO.2 amino acid residue sequence.
The encoding gene of cotton GhNAC7 transcription factor is one of following Nucleotide.
1) dna sequence dna shown in the SEQ ID NO.1.
2) polynucleotide of aminoacid sequence shown in the coding SEQ ID NO.2.
In the sequence table, SEQ ID NO.1 is by 861 based compositions; SEQ ID NO.2 is made up of 286 amino-acid residues.
The present invention also comprises the expression vector of the encoding gene of described cotton senescence-associated transcription factor GhNAC7.
The present invention also comprises the clone of the encoding gene of described cotton senescence-associated transcription factor GhNAC7.
The present invention also comprises the application of encoding gene in the old and feeble regulatory molecule mechanism of cotton of described cotton senescence-associated transcription factor GhNAC7.
The present invention also comprises the application of encoding gene in delaying the plant senescence character improvement of described cotton senescence-associated transcription factor GhNAC7.
Description of drawings
Fig. 1 is a GhNAC7 encoding sequence total length amplified production gel electrophoresis spectrum.
Fig. 2 is that the evolutionary tree of GhNAC7 and other plant senescence associated transcription factor is analyzed.
Fig. 3 is GhNAC7 and other plant senescence associated transcription factor sequence homology analysis.
Fig. 4 is dark processing wild-type Arabidopis thaliana in the time of 4 days, Atnap, complementary transfer-gen plant excised leaf phenotype.
Fig. 5 is a wild-type under 45 days the state of normal growth, Atnap, the phenotype of complementary transfer-gen plant.
Embodiment
The acquisition of embodiment 1, cotton senescence-associated transcription factor encoding gene.
1.1 RNA extracts
Select for use upland cotton as material, take from the right old and feeble about 0.1g of blade material that yellow takes place.After liquid nitrogen fully grinds, transfer to the 1.5ml centrifuge tube, add 1ml (invitrogen company), behind the mixing, room temperature was placed 15 minutes, added the 0.2ml chloroform: primary isoamyl alcohol (24:1), acutely shake after 15 seconds room temperature and placed 5 minutes, 13000rpm, 4 ℃ are centrifugal 15 minutes.Get supernatant liquor and add the equal-volume Virahol, careful mixing, room temperature was placed 15 minutes, 13000rpm, 4 ℃ are centrifugal 15 minutes.70% washing with alcohol precipitation, drying at room temperature 15 minutes.Be dissolved in an amount of ddH that handled through 0.1% DEPC 2In the O water, be stored in-80 ℃ standby.
1.2 cDNA first chain is synthetic and reverse transcription PCR
Adopt the cDNA first chain synthetic agent box of Shen, Shanghai energy lottery industry biotech company (SHBC), total RNA reverse transcription is become cDNA according to operational guidance.Reaction system and reaction conditions are respectively: total RNA of 2 μ g preparation, and 0.5 μ l RNase inhibitor adds deionized water to the 8.5 μ l that DEPC handled, 65 ℃ of the Oligo of 2 μ l (dT), 18 primer., 5min, room temperature is placed 10min, the brief centrifugal 5s of 13000rpm.Add 4 μ l, 5 * First-Strand buffer more successively, 0.5 μ l RNase Inhibitor, 2 μ l 100mM DTT, 2 μ l dNTP, 1 μ l MMLV Reverse Transcriptase.Careful mixing; 37 ℃ of reverse transcriptions 1 hour, 90 ℃ 5 minutes; Cooled on ice; 13000rpm of short duration centrifugal 5 seconds, deposit in-20 ℃ stand-by
1.3 RT-PCR amplification GhNAC7The encoding sequence total length.
According to GhNAC7Gene order has designed two primer GhNAC7F(5'ATGGAAACAAAAACCAGCTC TGAC 3') and GhNAC7R:(5'TTACTGAAATTGATACAGCATGGGA 3') (SEQ ID NO.3) as the primer of PCR reaction.The PCR reaction system is 50 μ l, and reaction conditions is: 94 ℃ of pre-sex change 5min, and 94 ℃ of sex change 30s, 60 ℃ of renaturation 30s, 72 ℃ are extended 60s, circulate 38 times.72 ℃ are fully extended 10min.The PCR product of gained is separated the segment that obtains one section about 861bp through 1% agarose gel electrophoresis.After reclaiming and being cloned into TAKARA pMD-19-T carrier,, obtain by the order-checking of Shanghai Ying Jun company by TA GhNAC7The total length of encoding sequence.
Embodiment 2: cotton senescence-associated transcription factor GhNAC7 functional analysis.
2.1 sequence comparing analysis
Use the homology of Genedoc software analysis GhNAC7 and other species.Analytical results shows that GhNAC7 not only has 5 conservative in NAC family subdomains, and E subdomain high conservative.The GenBank accession number of Arabidopis thaliana AtNAP, Kidney bean PvNAP, soybean GmNAP is respectively: NP_564966.1, AAK84884.1, AAY46121.1.
In order to analyze the phylogenetic relationship of GhNAC7, set up the phylogenetic tree of GhNAC7 with other species NAP with MEGA software with other species senescence-associated transcription factors NAP.The result shows that GhNAC7 is nearest with the sibship of soybean GmNAP.Kidney bean (kidney bean) cuts shape clover (medicago), soybean (soybean), Arabidopis thaliana (arabidopsis), potato wild species (nightshade), willow (populus), wheat (wheat), paddy rice (rice), tomato (tomato), petunia (petunia), the NAP sequence accession number of potato (potato) is respectively: AAK84884, AC140030_19.1, AAY46121, NP_564966.1, AAU90314, gw1.X.1066.1, AAU08785, NP_912423, AAU43923, AAM34773, AAU12055.
2.2 GhNAC7Functional analysis.
2.2.1 complementary Arabidopis thaliana AtnapPlant expression vector construction
With a pair of forward and reverse primer NOS-F and NOS-R, be template with the pCAMBIA1301 carrier that has the NOS terminator, the NOS terminator pcr amplification of 231bp is come out, be connected into the pMD19-T carrier after adding A, the sequence verification sequence is accurate.With PstI and HindIII enzyme NOS terminator fragment enzyme is scaled off again, in the corresponding restriction enzyme site of subclone in the multiple clone site of binary vector pPZP221, the engineered vector called after pPZP221-NOS that obtains.
Will GhNAC7Complete coding region come out by pcr amplification with the primer Gh1-F and the Gh1-R that have added EcoRI and SalI restriction enzyme site respectively, with corresponding digestion with restriction enzyme PCR product, be connected to the exactness of sequence verification sequence behind pBluescript II KS (+) cloning vector, the engineered vector called after pSK-GhNAC7 that obtains.
With a pair of forward and reverse primer Gh2-F and Gh2-R amplification AtNAPThe promoter fragment of the about 2K in gene A TG upstream is connected into the pMD19-T carrier, sequence verification after adding A.With SacI and EcoRI restriction endonuclease the promoter fragment enzyme is scaled off, be connected on the pSK-GhNAC7 carrier of cutting with the same enzyme enzyme, obtain the pSK-pAtNAP-GhNAC7 engineered vector.
With SacI and SalI enzyme with the P on the pSK-pAtNAP-GhNAC7 AtNAP :: GhNAC7The fragment enzyme scales off, and is cloned into on two kinds of identical enzymes pPZP221-NOS carrier that enzyme is cut simultaneously, obtains final pPZP221-P AtNAP The complementary carrier of-GhNAC7-NOS.
NOS-F：5'?TCACTGCAGGTTTCTTAAGATTGAATCCTGTT?3'
NOS-R：5'?CTCAAGCTTCCCGATCTAGTAACATAGATGAC?3'?（SEQ?ID?NO.4）
Gh1-F：5'?GAGGAATTCATGGAAACAAAAACCAGCTCTGAC?3'
Gh1-R：5'?GCGTCGACTTACTGAAATTGATACAGCATGGGA?3'?（SEQ?ID?NO.5）
Gh2-F：5'?ACGAGCTCCGTCATCTCATCCTAATCCTCAT?3'
Gh2-R：5'?GCGAATTCGATTTTCAGACAATTTAGAAAACAATC?3'（SEQ?ID?NO.6）。
2.2.2 Agrobacterium-mediated Transformation.
2.2.2.1 LBA4404 Agrobacterium competent cell preparation
1) containing rifomycin 40 μ g/ml, rules on the YEB solid medium of Streptomycin sulphate 100 μ g/ml, cultivate 48h-72h for 28 ℃;
2) choose single bacterium colony to containing rifomycin 40 μ g/ml, 28 ℃ are cultured to OD in the YEB liquid nutrient medium of Streptomycin sulphate 100 μ g/ml 6000.5;
3) cooled on ice bacterium liquid, 5000rpm, 4 ℃ of 10 minutes collection thalline;
4) 1mM Hepes pH 7.0 washings are 3 times, again with the washing of 10% glycerine once;
5) the suspension thalline divides to install in the 1.5ml centrifuge tube every pipe 40 μ l in 3ml 10% glycerine.
2.2.2 Agrobacterium-mediated Transformation
1) 200ng plasmid DNA adds and carries out electricity by following condition behind the 40 μ l Agrobacterium competent cell mixings and transform:
U 1.8?KV
R 200?Ω
C 25?μF
2) 800 μ l SOC liquid nutrient mediums are added in the electric shock back, cultivate 1h for 28 ℃;
3) 4000rpm collected thalline in 10 minutes, was suspended among the 200 μ l SOC, was coated in to contain 100 μ g/ml spectinomycins, and Rifampin 40 μ g/ml on the Streptomycin sulphate 100 μ g/ml LB solid mediums, are inverted for 28 ℃ and cultivate 48h-72h.
2.2.3 agriculture bacillus mediated Arabidopis thaliana transforms.
2.2.3.1 Arabidopis thaliana matrix is cultivated:
Matrix components: vermiculite: black earth: perlite 9: 3:0.5
Nutrient solution prescription:
Figure 776150DEST_PATH_IMAGE003
After matrix is soaked into nutritive medium, seed is sowed in the earthen bowl, covers, place under 4 ℃ of dark conditions, change (16h L/8h D) illumination after 2 days over to, cultivate under 23 ℃ of conditions with preservative film.Arabidopis thaliana grows into that bolting blooms can be for transforming.
2.2.3.2 Agrobacterium is prepared
1) inoculation carry the purpose expression vector Agrobacterium to containing in an amount of antibiotic YEB substratum, 28 ℃, 220rpm shakes bacterium and is cultured to OD 6001.2;
2) 5000rpm, 4 ℃ of 10 minutes centrifugal collection thalline;
3) thalline is suspended in 5% the sucrose solution again, and transfers to OD 6000.8;
4) add Silwet L-77 to final concentration be 0.03%.
2.2.3.3 Arabidopis thaliana transforms
Get the Arabidopis thaliana material, be inverted and soak over-ground part in ready Agrobacterium solution, rocked about 3 seconds, take out, be placed under the concealment condition, the 24h that preserves moisture changes normal condition over to and cultivates.
2.2.3.4 Arabidopis thaliana transformant screening
Collect the seed that transforms the back Arabidopis thaliana.Seed 0.1% HgCl 2Surface sterilization 5 minutes, aseptic water washing 4 times is suspended in the agarose of 0.1 %, by 2000 seeds of every flat board (diameter 15cm) (about 40mg), is layered on gentamicin 100mg/L, on the 1/2MS substratum then.Flat board was placed 4 ℃ of dark refrigerators 2 days, transfer to (16h L/8h D) illumination, cultivate under 23 ℃ of conditions.Can filter out transfer-gen plant about about two weeks with gentamicin resistance.The plant of tool resistance is transferred to matrix cultivate, and results T 1For seed.
2.2.4 GhNAC7Complementary Arabidopis thaliana AtnapThe transfer-gen plant phenotypic evaluation
The T of results 1, place after 2 days in 4 ℃ of dark refrigerators through being layered on behind the surface sterilization on the MS substratum that contains the 100mg/L gentamicin for the transfer-gen plant seed, transfer to (16h L/8h D) illumination, cultivate under 23 ℃ of conditions.The culture dish that is covered with the moistening filter paper of one deck is cut and placed to the 6th leaf of the Arabidopis thaliana in 3 weeks of normal growth, 23 ℃ of dark processing 4 days.The result shows, GhNAC7Can be complementary AtnapThe phenotype that the mutant leaf senile lags behind, dark processing is after 4 days, and each transfer-gen plant excised leaf all has yellow in various degree, and most of strain is that the blade yellowing is near the wild-type Arabidopis thaliana.
Simultaneously, under the normal growth state, observe complementary transgenic line, the phenotype of the old and feeble hysteresis mutant of wild-type and Arabidopis thaliana.The result shows GhNAC7Can be complementary AtnapThe phenotype that the mutant leaf senile lags behind.

Claims (5)

1. the senescence-associated transcription factor that grows cotton, it is characterized in that it being the protein of amino acid residue sequence shown in the SEQ ID NO:2, or have with the amino acid residue sequence of SEQ ID NO:2 identical active by SEQ ID NO:2 deutero-protein through replacement, disappearance or the interpolation of one or several amino-acid residue the amino acid residue sequence of SEQ ID NO:2.
2. the encoding gene of cotton senescence-associated transcription factor GhNAC7 is characterized in that its nucleotides sequence classifies the nucleotide sequence shown in the SEQ ID NO:1 as, perhaps is the polynucleotide sequence of aminoacid sequence shown in the coding SEQ ID NO:2.
3. contain expression vector just like the encoding gene of the described cotton senescence-associated transcription factor of claim 2 GhNAC7.
4. contain clone just like the encoding gene of the described cotton senescence-associated transcription factor of claim 2 GhNAC7.
5. as the application of encoding gene in delaying the old and feeble character improvement of plant leaf of cotton senescence-associated transcription factor GhNAC7 as described in the claim 2.
CN 201010523844 2010-10-29 2010-10-29 Cotton ageing related transcription factor and coded gene and application thereof Pending CN101979408A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 201010523844 CN101979408A (en) 2010-10-29 2010-10-29 Cotton ageing related transcription factor and coded gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 201010523844 CN101979408A (en) 2010-10-29 2010-10-29 Cotton ageing related transcription factor and coded gene and application thereof

Publications (1)

Publication Number Publication Date
CN101979408A true CN101979408A (en) 2011-02-23

Family

ID=43599957

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 201010523844 Pending CN101979408A (en) 2010-10-29 2010-10-29 Cotton ageing related transcription factor and coded gene and application thereof

Country Status (1)

Country Link
CN (1) CN101979408A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110872342A (en) * 2018-08-14 2020-03-10 中国农业科学院棉花研究所 Plant senescence-associated protein GhWRKY91, and coding gene and application thereof
CN111454987A (en) * 2020-04-29 2020-07-28 河南大学 Application of GhNAC091 gene in improving plant photosynthesis efficiency and strong light tolerance

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
《GenPept》 20090806 Chan,A.等 XP_002522466.1 1 1 , *
《GenPept》 20091011 Leiva-Ampuero,A.等 ACX47024 1 1 , *
《GenPept》 20100516 Jaillon,O.等 CBI31935.3 1 1 , *
《复旦学报(自然科学版)》 20101025 郭玉娟等 高羊茅中衰老相关转录因子AtNAP同源基因的克隆及功能分析 544-551、557 6 第49卷, 第5期 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110872342A (en) * 2018-08-14 2020-03-10 中国农业科学院棉花研究所 Plant senescence-associated protein GhWRKY91, and coding gene and application thereof
CN110872342B (en) * 2018-08-14 2022-02-11 中国农业科学院棉花研究所 Plant senescence-associated protein GhWRKY91, and coding gene and application thereof
CN111454987A (en) * 2020-04-29 2020-07-28 河南大学 Application of GhNAC091 gene in improving plant photosynthesis efficiency and strong light tolerance
CN111454987B (en) * 2020-04-29 2021-12-07 河南大学 Application of GhNAC091 gene in improving plant photosynthesis efficiency and strong light tolerance

Similar Documents

Publication Publication Date Title
Feng et al. TaEXPB7-B, a β-expansin gene involved in low-temperature stress and abscisic acid responses, promotes growth and cold resistance in Arabidopsis thaliana
CN109456982B (en) Application of rice OsMYB6 gene and encoding protein thereof in drought resistance and salt resistance
US20160160230A1 (en) Transgenic maize
CN106868021B (en) Gene OsNAC1 for controlling rice seed size and application thereof
US11613760B2 (en) Compositions and methods for increasing plant growth and improving multiple yield-related traits
CN107746846B (en) IbABF4 gene for coding sweet potato bZIP transcription factor and application thereof
CN110643618A (en) Jatropha curcas MYB transcription factor JcMYB16 gene and application thereof in improving drought resistance of plants
CN104903444A (en) Nucleic acid imparting high-yielding property to plant, method for producing transgenic plant with increased yield, and method for increasing plant yield
CN103102401A (en) Application of GmMYB73 in cultivating stress tolerance transgenic plants
CN109628475B (en) Application of brassinolide synthetic gene PaCYP724B1 in regulation and control of plant branches
KR101291365B1 (en) Gene Implicated in Drought Stress Tolerance and Growth Accelerating and Transformed Plants with the Same
CN111087457A (en) Protein NGR5 for improving nitrogen utilization rate and crop yield, and coding gene and application thereof
CN101979408A (en) Cotton ageing related transcription factor and coded gene and application thereof
CN113136398B (en) GsHA24 protein and application of related biological material thereof in regulation and control of stress tolerance of plants
CN102850446A (en) Transcription factor for regulating and controlling plant leaf senescence and application of transcription factor
CN105175522B (en) Crowtoe AP2/ERF transcription factors and its encoding gene and application
CN101928339B (en) Bambusa affinis 'viridiflavus' aging associated transcription factor, coding gene thereof and use thereof
CN102731634B (en) Pleiotropic gene associated protein from wheat, encoding gene thereof and application
CN102010465A (en) Brassica campestris aging-related transcription factor and coding gene and application thereof
CN105586347A (en) Tobacco drought response gene NtRDP1 as well as encoded protein and application thereof
CN101993479B (en) Plant stress tolerance related transcription factor TaWRKY1 as well as coding gene and application thereof
Zhang et al. Overexpression of Malus hupehensis MhSHN1 gene enhances salt and osmotic stress tolerance in transgenic tobacco plants
CN103626856A (en) Transcription factor AtGT4, coding gene thereof and applications
CN114736911B (en) Tomato SlBTB19 gene, protein and application thereof in improving low temperature resistance of plants
CN114214334B (en) Application of gene EsH2A.3 from salt mustard in regulation and control of salt tolerance of plants

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20110223