CN110872342B

CN110872342B - Plant senescence-associated protein GhWRKY91, and coding gene and application thereof

Info

Publication number: CN110872342B
Application number: CN201810920463.8A
Authority: CN
Inventors: 喻树迅; 顾丽姣; 魏恒玲; 王寒涛; 王聪聪; 马亮; 苏政政
Original assignee: Institute of Cotton Research of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Cotton Research of Chinese Academy of Agricultural Sciences
Priority date: 2018-08-14
Filing date: 2018-08-14
Publication date: 2022-02-11
Anticipated expiration: 2038-08-14
Also published as: CN110872342A

Abstract

The invention discloses a plant senescence-associated protein GhWRKY91, and a coding gene and application thereof. The protein provided by the invention is the protein shown in a sequence 1 in a sequence table. Nucleic acid molecules encoding such proteins are also within the scope of the invention. The invention also protects the application of the protein: regulating the senescence process of plants; regulating and controlling the aging process of plant leaves; inhibiting the senescence process of plants; inhibiting the aging process of plant leaves; regulating and controlling the aging process in the drought stress environment of the plant; regulating and controlling the aging process of plant leaves in drought stress environment; regulating and controlling the drought resistance of the plant; improve the drought resistance of the plants. The invention also provides a method for preparing a transgenic plant, which comprises the following steps: the gene is introduced into the original plant to obtain the transgenic plant with the senescence process being delayed. The invention has great theoretical value for the research of plant senescence mechanism. Has great application value for cultivating premature senility resistant plants, in particular to premature senility resistant cotton.

Description

Plant senescence-associated protein GhWRKY91, and coding gene and application thereof

Technical Field

The invention relates to a plant senescence-associated protein GhWRKY91, and a coding gene and application thereof.

Background

Senescence is an integral part of plant development and is the final stage of development. During senescence, leaf cells undergo highly coordinated changes in structure, metabolism, and gene expression. The earliest, most obvious change in cell structure is chloroplast disintegration. Metabolically, carbon metabolism (photosynthesis) is replaced by the catabolism of chloroplasts and macromolecular substances such as proteins, membrane lipids, RNA, etc. At the molecular level, the above changes are accompanied by changes in gene expression.

Senescence is programmed cell death. Leaf senescence plays an important role in physiological activities such as the circulation and reuse of nutrient elements. The leaf assimilation function reduction caused by aging limits the crop yield.

Cotton is an important economic crop and textile raw material in China, and has no substitutable effect on the development of the national economy of China. The contradiction of land competition of grain and cotton in China is prominent, the contradiction of land competition of grain and cotton can be relieved by breeding and popularizing the short-season cotton variety, but the precocity of the short-season cotton is often accompanied with premature senility. In the production of cotton, the premature senility of cotton causes the reduction of boll weight, the reduction of clothes content and the reduction of fiber strength and maturity, thus reducing the yield and quality of cotton.

Disclosure of Invention

The invention aims to provide a plant senescence-associated protein GhWRKY91, and a coding gene and application thereof.

The protein provided by the invention is obtained from upland cotton (Gossypium hirsutum) and is named GhWRKY91 protein, and is (a1) or (a2) or (a3) or (a4) as follows:

(a1) protein shown as a sequence 1 in a sequence table;

(a2) a fusion protein obtained by attaching a tag to the N-terminus or/and the C-terminus of the protein of (a 1);

(a3) a plant senescence-associated protein obtained by substituting and/or deleting and/or adding one or more amino acid residues in (a 1);

(a4) a protein derived from upland cotton, having 98% or more identity to (a1) and associated with plant senescence.

The labels are specifically shown in table 1.

TABLE 1 sequences of tags

Label (R)	Residue of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL
HA	9	YPYDVPDYA

The protein can be synthesized artificially, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

Nucleic acid molecules encoding such proteins are also within the scope of the invention. The nucleic acid molecule is a DNA molecule or an RNA molecule.

The DNA molecule (named GhWRKY91 gene) for coding the protein is (b1) or (b2) or (b3) as follows:

(b1) the coding region is a DNA molecule shown as a sequence 2 in a sequence table;

(b2) a DNA molecule derived from gossypium hirsutum and having 95% or more identity to (b1) and encoding said protein;

(b3) a DNA molecule which hybridizes under stringent conditions with the nucleotide sequence defined in (b1) and encodes said protein.

An expression cassette, a recombinant vector or a recombinant microorganism containing the GhWRKY91 gene all belong to the protection scope of the invention.

The recombinant expression vector containing the gene can be constructed by using the existing expression vector. When the gene is used for constructing a recombinant expression vector, any one of enhanced, constitutive, tissue-specific or inducible promoters can be added in front of the transcription initiation nucleotide, and can be used alone or combined with other plant promoters; in addition, when the gene is used to construct a recombinant expression vector, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codons or adjacent regions initiation codons, etc., but must be in the same reading frame as the coding sequence to ensure proper translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene. In order to facilitate identification and screening of the transgenic plant or the transgenic microorganism, an expression vector to be used may be processed, for example, a gene for expressing an enzyme or a luminescent compound which produces a color change in the plant or the microorganism, a gene for an antibiotic marker having resistance or a chemical-resistant agent marker, etc. From the viewpoint of safety of transgenes, the transformed plants or microorganisms can be directly screened phenotypically without adding any selectable marker gene.

The recombinant expression vector may specifically be: the recombinant plasmid is obtained by inserting a DNA molecule shown in a sequence 2 in a sequence table between XbaI enzyme cutting sites and SmaI enzyme cutting sites of the pBI121 plasmid.

The invention also protects the application of GhWRKY91 protein, which is (c1), (c2), (c3), (c4), (c5), (c6), (c7), (c8), (c9) or (c 10):

(c1) regulating the senescence process of plants;

(c2) regulating and controlling the aging process of plant leaves;

(c3) inhibiting the senescence process of plants;

(c4) inhibiting the aging process of plant leaves;

(c5) regulating and controlling the aging process in the drought stress environment of the plant;

(c6) regulating and controlling the aging process of plant leaves in drought stress environment;

(c7) inhibiting the senescence process in plant drought stress environments;

(c8) inhibiting the aging process of plant leaves in drought stress environment;

(c9) regulating and controlling the drought resistance of the plant;

(c10) improve the drought resistance of the plants.

The plant is a dicotyledonous plant or a monocotyledonous plant. The dicot may be a cotton plant or an arabidopsis plant. The cotton plant may be upland cotton. The arabidopsis plant may specifically be colombian ecotype arabidopsis thaliana.

The invention also protects the application of the GhWRKY91 gene, which is (d1), (d2), (d3), (d4), (d5), (d6), (d7), (d8), (d9) or (d 10):

(d1) cultivating a transgenic plant with the changed senescence trait;

(d2) cultivating transgenic plants with the changed leaf senescence traits;

(d3) cultivating transgenic plants with delayed senescence process;

(d4) cultivating transgenic plants with delayed leaf senescence process;

(d5) cultivating a transgenic plant with improved premature senility;

(d6) cultivating transgenic plants with improved leaf senilism;

(d7) cultivating a transgenic plant with a delayed senescence process in a drought stress environment;

(d8) cultivating a transgenic plant with a delayed leaf senescence process in a drought stress environment;

(d9) cultivating a transgenic plant with changed drought resistance;

(d10) cultivating the transgenic plant with enhanced drought resistance.

The invention also provides a method for preparing a transgenic plant, which comprises the following steps: the GhWRKY91 gene is introduced into the original plant to obtain the transgenic plant with delayed senescence process. The gene can be specifically introduced into the starting plant by any of the above recombinant expression vectors. The recombinant expression vector carrying the gene can be transformed into a starting plant by a conventional biological method such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, conductance, agrobacterium mediation and the like. The starting plant is a dicotyledonous plant or a monocotyledonous plant. The dicot may be a cotton plant or an arabidopsis plant. The cotton plant may be upland cotton. The arabidopsis plant may specifically be colombian ecotype arabidopsis thaliana. The senescence process delaying may specifically be leaf senescence process delaying.

The invention also provides a plant breeding method, which comprises the following steps: increasing the content and/or activity of GhWRKY91 protein in the target plant, thereby delaying the aging process of the target plant. The target plant is a dicotyledonous plant or a monocotyledonous plant. The dicot may be a cotton plant or an arabidopsis plant. The cotton plant may be upland cotton. The arabidopsis plant may specifically be colombian ecotype arabidopsis thaliana. The process for delaying the senescence of the target plant can be specifically the process for delaying the senescence of the target plant leaves.

The invention also provides a method for preparing a transgenic plant, which comprises the following steps: the GhWRKY91 gene is introduced into the original plant to obtain the transgenic plant with enhanced drought resistance. The gene can be specifically introduced into the starting plant by any of the above recombinant expression vectors. The recombinant expression vector carrying the gene can be transformed into a starting plant by a conventional biological method such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, conductance, agrobacterium mediation and the like. The starting plant is a dicotyledonous plant or a monocotyledonous plant. The dicot may be a cotton plant or an arabidopsis plant. The cotton plant may be upland cotton. The arabidopsis plant may specifically be colombian ecotype arabidopsis thaliana. The drought resistance enhancement is embodied as delaying of the senescence process in drought stress environment. The senescence process delaying may specifically be leaf senescence process delaying.

The invention also provides a plant breeding method, which comprises the following steps: the content and/or activity of GhWRKY91 protein in the target plant is increased, so that the drought resistance of the target plant is enhanced. The target plant is a dicotyledonous plant or a monocotyledonous plant. The dicot may be a cotton plant or an arabidopsis plant. The cotton plant may be upland cotton. The arabidopsis plant may specifically be colombian ecotype arabidopsis thaliana. The method for enhancing the drought resistance of the target plant is specifically embodied in the process of delaying the aging process of the target plant in the drought stress environment. The senescence process delaying may specifically be leaf senescence process delaying.

The invention has great theoretical value for the research of plant senescence mechanism. Has great application value for cultivating premature senility resistant plants, in particular to premature senility resistant cotton.

Drawings

FIG. 1 shows the relative expression level of the GhWRKY91 gene.

FIG. 2 is a photograph of the natural senescence phenotype in step four.

FIG. 3 shows the relative expression amounts of AtSAG12 gene and AtSAG13 gene in step four.

Fig. 4 is a schematic diagram of the division of zones in the nutrition bowl.

FIG. 5 is a photograph of the drought treatment phenotype in step five.

FIG. 6 shows the relative expression amounts of step five AtSAG12 gene and AtSAG13 gene.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

A new protein is found from Gossypium hirsutum Miq 74, which is shown as a sequence 1 in a sequence table (273aa) and named as GhWRKY91 protein. The GhWRKY91 protein has a relative molecular weight of 29.82kDa and an isoelectric point of 5.13. The gene encoding the GhWRKY91 protein is named as GhWRKY91 gene. In the cDNA of No. 74 of Gossypium hirsutum, the coding frame of the GhWRKY91 gene is shown as sequence 2 (822bp) in the sequence table.

Examples of the following,

Construction of recombinant expression vector

1. Extracting mature leaves of the plant of Gossypium hirsutum 74 in the full-bloom stage, and extracting total RNA.

2. And (3) carrying out reverse transcription on the total RNA obtained in the step (1) to obtain cDNA.

3. And (3) taking the cDNA obtained in the step (2) as a template, carrying out PCR amplification by adopting a primer pair consisting of F1 and R1, and recovering a PCR amplification product.

F1：5’-CTAGTCTAGAATGGACAGCGGTGGTAG-3’；

R1：5’-TCCCCCGGGTCAGCAGATCCCAACCTG-3’。

4. And (3) double-digesting the PCR amplification product obtained in the step (3) by using restriction enzymes XbaI and SmaI, and recovering a digested product.

5. The pBI121 plasmid was digested with restriction enzymes XbaI and SmaI, and the vector backbone was recovered.

6. And (3) connecting the enzyme digestion product obtained in the step (4) with the vector skeleton obtained in the step (5) to obtain the recombinant plasmid pBI121-GhWRKY 91. According to the sequencing result, the structure of the recombinant plasmid pBI121-GhWRKY91 is described as follows: a DNA molecule shown in a sequence 2 of a sequence table is inserted between XbaI and SmaI enzyme cutting sites of a pBI121 plasmid.

Second, obtaining transgenic plants

1. The recombinant plasmid pBI121-GhWRKY91 is introduced into Agrobacterium tumefaciens LBA4404 to obtain the recombinant Agrobacterium tumefaciens.

2. And (3) transforming the recombinant agrobacterium obtained in the step (1) into Columbia arabidopsis by adopting an inflorescence dip-dyeing method, then culturing a plant, and harvesting mature seeds, namely T0 generation seeds.

3. Disinfecting T0 generation seeds, sowing the seeds on a 1/2MS culture medium plate containing 50mg/L, vernalizing the seeds for 3 days at 4 ℃, transferring the seeds to a climatic test box, culturing the plants for about 10 days (the plants which grow normally are positive plants, the plants which turn yellow and do not grow any more are negative plants), transplanting the positive plants to a flowerpot, culturing the plants for 1 month, and carrying out PCR identification (adopting a primer pair consisting of F2 and R2, if the plants which obtain amplification products are positive, if no plants which obtain any amplification products are negative), thus obtaining the T0 generation PCR positive plants.

F2：5’-GACGCACAATCCCACTATCC-3’；

R2：5’-TCAGCAGATCCCAACCTG-3’。

4. Selfing the T0 PCR positive plants and obtaining seeds to obtain T1 generation seeds; and (3) culturing and identifying the seeds of the T1 generation according to the method in the step 3 to obtain PCR positive plants of the T1 generation.

5. Selfing the T1 PCR positive plants and obtaining seeds to obtain T2 generation seeds; and (3) culturing and identifying the seeds of the T2 generation according to the method in the step 3 to obtain PCR positive plants of the T2 generation.

6. Selfing the T2 PCR positive plants and obtaining seeds to obtain T3 generation seeds; randomly sampled statistically significant T3 seed generations were grown and identified according to the procedure of step 3.

For a certain T2 PCR positive plant, if the plants grown from the seeds (sample) of T3 generations obtained by selfing are all PCR positive, the T2 PCR positive plant and the selfed progeny thereof are a homozygous transgenic line.

7. T3 generation plants of 3 homozygous transgenic lines (OE91-12, OE91-13, OE91-20) were tested at random: extracting total RNA and carrying out reverse transcription to obtain cDNA, taking an arabidopsis UBQ10 gene as an internal reference gene, and detecting the relative expression level of the GhWRKY91 gene by fluorescent quantitative PCR. Columbia type Arabidopsis thaliana was used as a control for the transgenic lines.

The primer pairs for detecting the GhWRKY91 gene are as follows:

F3：5’-GCTGAATCTCCTCCTCCTTCT-3’；

R3：5’-CGGGAACCTTCAACGTCCTT-3’。

the primer pair for detecting the UBQ10 gene is as follows:

F4：5’-AGATCCAGGACAAGGAAGGTATTC-3’；

R4：5’-CGCAGGACCAAGTGAAGAGTAG-3’。

the relative expression level of the GhWRKY91 gene is shown in FIG. 1. Columbia ecotype Arabidopsis thaliana (expressed by WT) has no expression, and GhWRKY91 gene in each transgenic plant is highly expressed.

Thirdly, obtaining of empty vector plants

Replacing the recombinant plasmid pBI121-GhWRKY91 with the plasmid pBI121 to obtain a transgenic empty vector plant according to the operation of the step two.

Fourth, identification under Normal culture conditions

The T3 seeds (20 seeds per strain), the T3 seeds (20 seeds) of the empty vector-transferred strain, the seeds (20 seeds) of Columbia ecotype Arabidopsis thaliana (20 seeds) of 3 homozygous transgenic strains (OE91-12, OE91-13, OE91-20) were examined:

1. the seeds were vernalized for 3 days and then seeded in 1/2MS medium for 10 days of plating.

2. After completion of step 1, the seedlings were transplanted into pots (4 plants per pot) filled with a culture medium (obtained by mixing 1 part by volume of nutrient soil and 1 part by volume of vermiculite), and then cultured. The culture conditions are as follows: 22 ℃, 16 hours of light/8 hours of darkness and a light intensity of 100 mu mol m^-2s^-1。

Photographs were taken after 25 days and 39 days of culture in step 2, respectively. The photograph is shown in FIG. 2, WT represents Columbia ecotype Arabidopsis thaliana. After 25 days of culture, yellow senescence leaves were observed in Columbia ecotype Arabidopsis thaliana and the transgenic empty vector plants, and no yellow senescence leaves were observed in the transgenic line plants. After 39 days of culture, a large number of yellow senescent leaves can be observed in Columbia ecotype arabidopsis and the transgenic empty vector plants (the phenotypes of the yellow senescent leaves and the transgenic empty vector plants have no significant difference), and the number of the yellow senescent leaves of the transgenic line plants is far less than that of the Columbia ecotype arabidopsis.

After culturing for 25 days in the step 2, taking the rosette leaves of the plants, extracting total RNA and carrying out reverse transcription to obtain cDNA, taking an arabidopsis UBQ10 gene as an internal reference gene, and detecting the relative expression quantity of the AtSAG12 gene and the AtSAG13 gene by adopting fluorescent quantitative PCR. Primer pair for detecting AtSAG12 gene: TCCAATTCTATTCGTCTGGTGTGT, respectively; CCACTTTCTCCCCATTTTGTTC are provided. Primer pair for detecting AtSAG13 gene: GTGCCAGAGACGAAACTC, respectively; r6: GCTGTAAACTCTGTGGTC are provided. The results are shown in FIG. 3, where WT represents Columbia ecotype Arabidopsis thaliana. The relative expression levels of two senescence genes in Columbia ecotype Arabidopsis and the transgenic empty vector plant have no obvious difference. Compared with Columbia ecotype Arabidopsis thaliana, the relative expression level of two senescence genes of the transgenic line plant is obviously reduced.

The result shows that the natural senescence of leaves can be inhibited by over-expressing the GhWRKY91 gene.

Fifth, identification under drought conditions

The T3 generation seeds (24 seeds per strain), seeds of Columbia ecotype Arabidopsis thaliana (24 seeds) were examined for 3 homozygous transgenic lines (OE91-12, OE91-13, OE 91-20):

2. Normal Condition treatment (i.e., control treatment)

After completion of step 1, the seedlings were transplanted into a nutrition pot containing a culture medium (obtained by mixing 1 part by volume of nutrient soil and 1 part by volume of vermiculite uniformly) and cultured for 11 days, then subjected to normal watering management, and cultured for 5 days. The culture conditions are as follows: 22 ℃, 16 hours of light/8 hours of darkness, light intensity of 100 mu molm^-2s^-1.1 nutrition pot (nutrition pot 1) is arranged, the nutrition pot is divided into 4 areas, the area division is schematically shown in figure 4(WT represents Columbia ecotype Arabidopsis), and each area has 8 strains.

3. Drought treatment

After completion of step 1, the seedlings were transplanted into a nutrition pot containing a culture medium (obtained by mixing 1 part by volume of nutrient soil and 1 part by volume of vermiculite uniformly) and cultured for 11 days, and then a 15% PEG600 solution was poured (once drenched) and cultured for 5 days. The culture conditions are as follows: 22 ℃, 16 hours of light/8 hours of darkness and a light intensity of 100 mu mol m^-2s^-1. 2 nutrition pots (nutrition pot 2 and nutrition pot 3) were set, each nutrition pot was divided into 4 regions, and the region division is schematically shown in FIG. 4(WT represents Columbia ecotype Arabidopsis), and each region had 8 strains per line.

After completion of step 2 and step 3, a photograph was taken. The photograph is shown in FIG. 5. Under normal conditions, the phenotype of Columbia ecotype arabidopsis and the transgenic plant has no obvious difference. After drought treatment, Columbia ecotype arabidopsis thaliana has senescence phenotype such as etiolation of leaves, and transgenic arabidopsis thaliana does not have senescence phenotype.

And (3) after the step 2 and the step 3 are finished, taking the rosette leaves of the plants, extracting total RNA and performing reverse transcription to obtain cDNA, taking the Arabidopsis UBQ10 gene as an internal reference gene, and detecting the relative expression quantity of the AtSAG12 gene and the AtSAG13 gene by adopting fluorescent quantitative PCR. Primer pair for detecting AtSAG12 gene: TCCAATTCTATTCGTCTGGTGTGT, respectively; CCACTTTCTCCCCATTTTGTTC are provided. Primer pair for detecting AtSAG13 gene: GTGCCAGAGACGAAACTC, respectively; r6: GCTGTAAACTCTGTGGTC are provided. The results are shown in FIG. 6. Compared with Columbia ecotype Arabidopsis thaliana, the relative expression level of two senescence genes of the transgenic line plant is obviously reduced.

The result shows that the overexpression of the GhWRKY91 gene can inhibit drought-induced leaf senescence.

SEQUENCE LISTING

<110> Cotton research institute of Chinese academy of agricultural sciences

<120> plant senescence-associated protein GhWRKY91, and coding gene and application thereof

<130> GNCYX181716

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 273

<212> PRT

<213> Gossypium hirsutum

<400> 1

Met Asp Ser Gly Gly Ser Ser Ser Ser Ser Phe Arg Lys Val Arg Asn

1 5 10 15

Pro Phe Val Thr Asp Gln Glu Leu Glu Glu Ser Asp Asn Val Ser Ser

20 25 30

Val Thr Gly Ala Glu Ser Pro Pro Pro Ser Thr Thr Lys Lys Gly Lys

35 40 45

Arg Ser Met Gln Lys Arg Val Val Ser Val Pro Ile Lys Asp Val Glu

50 55 60

Gly Ser Arg Leu Lys Gly Glu Gly Ala Pro Pro Ser Asp Ser Trp Ala

65 70 75 80

Trp Arg Lys Tyr Gly Gln Lys Pro Ile Lys Gly Ser Pro Tyr Pro Arg

85 90 95

Gly Tyr Tyr Arg Cys Ser Ser Ser Lys Gly Cys Pro Ala Arg Lys Gln

100 105 110

Val Glu Arg Ser Arg Val Asn Pro Thr Met Leu Val Ile Thr Tyr Ser

115 120 125

Cys Glu His Asn His Ala Trp Pro Ala Ser Arg His Asn Asn Thr Ser

130 135 140

Ala Lys Gln Ala Ala Ala Ala Ala Ala Gly Glu Ala Ser Glu Ser Pro

145 150 155 160

Thr Lys Ser Ser Thr Ala Val Lys His Glu Pro Ser Thr Ser Gln Pro

165 170 175

Asp Thr Glu Pro Asp Ser Gly Met Glu Asp Gly Phe Ala Cys Leu Thr

180 185 190

Glu Asp Ser Ile Leu Thr Thr Gly Asp Glu Phe Ala Trp Phe Gly Glu

195 200 205

Met Glu Thr Thr Ser Ser Thr Val Leu Glu Ser Pro Leu Phe Ser Glu

210 215 220

Arg Asp Asn Ser Glu Ala Asp Asp Thr Ala Met Ile Phe Pro Met Arg

225 230 235 240

Glu Glu Asp Glu Ser Leu Phe Ala Asp Leu Glu Glu Leu Pro Glu Cys

245 250 255

Ser Phe Val Phe Arg His Gln Arg Asn Val Gly Pro Gln Val Gly Ile

260 265 270

Cys

<210> 2

<211> 822

<212> DNA

<213> Gossypium hirsutum

<400> 2

atggacagcg gtggtagtag cagcagcagt ttcaggaaag ttaggaaccc ttttgtcact 60

gaccaagaat tagaagaaag tgacaacgtt tcgtcagtaa ctggagctga atctcctcct 120

ccttctacta ctaaaaaagg taaaagatcc atgcagaaaa gagtggtgtc agtaccaatc 180

aaggacgttg aaggttcccg ccttaaaggt gagggtgctc caccgtctga ttcttgggca 240

tggcggaagt acggccaaaa acctatcaaa gggtcacctt acccgagggg ttattaccgg 300

tgtagtagct caaagggatg tccggcgagg aaacaagtcg agaggagccg tgtaaaccct 360

acaatgttag tgatcacata ctcttgcgaa cacaatcacg cttggcctgc ttctagacac 420

aacaacacat ccgctaaaca agcggcggcg gcggcggcgg gggaagcttc cgagtcaccg 480

actaaatcca gcacagctgt aaagcacgag ccgtccacgt cgcaaccgga tacggaaccg 540

gattcaggga tggaagatgg cttcgcttgt ctgacggagg attcgattct tacgacgggg 600

gatgaattcg cttggttcgg ggagatggaa accacgtcgt cgacggtatt ggagagcccg 660

ttgttttcgg aaagggataa cagtgaggcg gatgacacgg cgatgatttt ccccatgagg 720

gaagaagacg aatcgttatt cgctgatctc gaagagttgc cggagtgctc gtttgtgttt 780

cggcaccaac ggaatgtggg accacaggtt gggatctgct ga 822

Claims

The application of GhWRKY91 protein is (c4) or (c 8):

(c4) inhibiting the aging process of plant leaves;

(c8) inhibiting the aging process of plant leaves in drought stress environment;

the GhWRKY91 protein is a protein shown in a sequence 1 in a sequence table;

the plant is a cotton plant or an arabidopsis plant.
2. The application of the nucleic acid molecule for encoding the GhWRKY91 protein is as follows (d4) or (d 8):

(d4) cultivating transgenic plants with delayed leaf senescence process;

(d8) cultivating a transgenic plant with a delayed leaf senescence process in a drought stress environment;

the GhWRKY91 protein is a protein shown in a sequence 1 in a sequence table;

the plant is a cotton plant or an arabidopsis plant.
3. Use according to claim 2, characterized in that: the coding region of the nucleic acid molecule for coding the GhWRKY91 protein is shown as a sequence 2 in a sequence table.
4. A method of making a transgenic plant comprising the steps of: introducing a nucleic acid molecule for encoding GhWRKY91 protein into an original plant to obtain a transgenic plant with a delayed leaf senescence process;

the GhWRKY91 protein is a protein shown in a sequence 1 in a sequence table;

the starting plant is a cotton plant or an arabidopsis plant.
5. The method of claim 4, wherein: the coding region of the nucleic acid molecule for coding the GhWRKY91 protein is shown as a sequence 2 in a sequence table.
6. A method of plant breeding comprising the steps of: increasing the content of GhWRKY91 protein in the target plant, thereby delaying the aging process of the target plant leaves;

the GhWRKY91 protein is a protein shown in a sequence 1 in a sequence table;

the target plant is a cotton plant or an arabidopsis plant.