CN116063434B

CN116063434B - OsLTPL23 protein and application of encoding gene thereof in regulation of rice disease resistance

Info

Publication number: CN116063434B
Application number: CN202211342972.XA
Authority: CN
Inventors: 贾彦凤; 李全林; 翟文学
Original assignee: Institute of Genetics and Developmental Biology of CAS
Current assignee: Institute of Genetics and Developmental Biology of CAS
Priority date: 2022-10-31
Filing date: 2022-10-31
Publication date: 2024-01-26
Anticipated expiration: 2042-10-31
Also published as: CN116063434A

Abstract

The invention discloses an OsLTPL23 protein and application of a coding gene thereof in regulating and controlling rice disease resistance. The invention provides an OsLTPL23 protein which is SEQ ID NO: 1. Nucleic acid molecules encoding the OsLTPL23 protein are also within the scope of the invention. The invention also provides application of the OsLTPL23 protein or the nucleic acid molecule encoding the OsLTPL23 protein in regulating and controlling plant bacterial blight resistance. The abundance of the OsLTPL23 protein or the nucleic acid molecule encoding the OsLTPL23 protein is increased, and the disease resistance of plants against bacterial leaf blight is enhanced. The abundance of the OsLTPL23 protein or the nucleic acid molecule encoding the OsLTPL23 protein is reduced, and the disease resistance of plants against bacterial leaf blight is reduced. The invention can be used in the fields of rice germplasm resource improvement and genetic breeding, can also be used for cultivating rice varieties resistant to bacterial leaf blight, and has good market application prospect.

Description

OsLTPL23 protein and application of encoding gene thereof in regulation of rice disease resistance

Technical Field

The invention belongs to the technical field of biology, in particular to the field of plant genetic engineering, and relates to an OsLTPL23 protein and application of a coding gene thereof in regulating and controlling rice disease resistance.

Background

Rice (Oryzae sativa l.) is one of the most important food crops in the world, and the maintenance of stable yield is a major strategic requirement for guaranteeing food safety and promoting economic development. Bacterial leaf blight is one of the most serious bacterial diseases in rice production, and is caused by invasion of a pathogenic variant (Xanthomonas oryzae pv. Oryzae, xoo) of Xanthomonas oryzae into rice leaves through wounds or water holes, so that the yield of the rice can be reduced by 20-30%, 50% or even the yield can be increased to be out of order when the rice is serious, the rice quality can be reduced, serious threat is formed to grain safety, and the economic benefit of rice production is restricted.

Resistance gene-mediated disease-resistant breeding is considered as the most effective measure for preventing and controlling bacterial leaf blight of rice in current agricultural production, and the key of constructing an ecological environment-friendly disease prevention and control measure depends on the excavation of the resistance gene, so that the identification of a new bacterial leaf blight resistance gene of rice has important application value for rice disease-resistant breeding and is beneficial to guaranteeing the grain safety of China.

Disclosure of Invention

The invention aims to provide an OsLTPL23 protein and application of a coding gene thereof in regulating and controlling rice disease resistance.

The invention provides a protein, which is derived from rice (Oryzae sativa L.) and named as OsLTPL23 protein, and is (a 1) or (a 2) or (a 3) or (a 4):

(a1) SEQ ID NO: 1;

(a2) A fusion protein obtained by connecting a label to the N end or/and the C end of the (a 1);

(a3) A protein derived from rice and having 98% or more identity with (a 1) and having a function of controlling bacterial blight disease resistance of plants;

(a4) And (b) the protein (a 1) is subjected to substitution and/or deletion and/or addition of one or more amino acid residues and has the function of regulating and controlling bacterial blight disease resistance of plants.

The labels are specifically shown in table 1.

TABLE 1 sequence of tags

Label (Label)	Residues	Sequence(s)
			Poly-Arg	5-6 (usually 5)	RRRRR
Poly-His	2-10 (usually 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL
HA	9	YPYDVPDYA

The protein can be synthesized artificially or obtained by synthesizing the coding gene and then biologically expressing.

Nucleic acid molecules encoding the OsLTPL23 protein are also within the scope of the invention.

In particular, the nucleic acid molecule is a DNA molecule.

Specifically, the nucleic acid molecule encoding the OsLTPL23 protein is an OsLTPL23 gene.

The OsLTPL23 gene is specifically represented by the following (b 1) or (b 2) or (b 3) or (b 4):

(b1) The coding region is shown in SEQ ID NO:2, a DNA molecule shown in fig. 2;

(b2) SEQ ID NO: 3;

(b3) A DNA molecule that hybridizes to (b 1) or (b 2) under stringent conditions and encodes an OsLTPL23 protein;

(b4) A DNA molecule derived from rice and having more than 90% identity to (b 1) or (b 2) and encoding an OsLTPL23 protein.

Expression cassettes, recombinant vectors or recombinant microorganisms containing said nucleic acid molecules are all within the scope of the invention.

Recombinant vectors containing the nucleic acid molecules can be constructed using existing plant expression vectors. When the nucleic acid molecule is used for constructing a recombinant vector, any one of enhanced, constitutive, tissue-specific or inducible promoters can be added before the transcription initiation nucleotide, and can be used alone or in combination with other plant promoters; in addition, when constructing a recombinant vector using the nucleic acid molecule, enhancers, including translational or transcriptional enhancers, may be used, which may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene. In order to facilitate the identification and selection of transgenic plants or transgenic microorganisms, the expression vectors used may be processed, for example by adding genes which express enzymes or luminescent compounds which produce a color change in the plants or microorganisms, antibiotic markers which are resistant or marker genes for chemical resistance, etc. From the viewpoint of transgenic safety, transformed plants or microorganisms can be screened phenotypically without adding any selectable marker gene.

The invention also provides application of the OsLTPL23 protein or the nucleic acid molecule encoding the OsLTPL23 protein in regulating and controlling plant bacterial blight resistance. The regulation is positive regulation. The abundance of the OsLTPL23 protein or the nucleic acid molecule encoding the OsLTPL23 protein is increased, and the disease resistance of plants against bacterial leaf blight is enhanced. The abundance of the OsLTPL23 protein or the nucleic acid molecule encoding the OsLTPL23 protein is reduced, and the disease resistance of plants against bacterial leaf blight is reduced.

The invention also protects application of the OsLTPL23 protein or the nucleic acid molecule for encoding the OsLTPL23 protein as a positive regulation target in cultivation of plants with improved bacterial blight disease resistance. The positive regulation target means that the plant disease resistance against bacterial leaf blight is enhanced by promoting the increase of the abundance of the OsLTPL23 protein or the nucleic acid molecule encoding the OsLTPL23 protein.

The invention also protects application of the OsLTPL23 protein or the nucleic acid molecule encoding the OsLTPL23 protein as a negative regulation target in cultivation of plants with improved bacterial blight susceptibility. The negative regulation target means that the plant has enhanced susceptibility to bacterial leaf blight by promoting the decrease in the abundance increase of the OsLTPL23 protein or a nucleic acid molecule encoding the OsLTPL23 protein.

The invention also provides a method for cultivating transgenic plants, comprising the following steps: and introducing a nucleic acid molecule encoding the OsLTPL23 protein into a target plant to obtain a transgenic plant with bacterial leaf blight disease resistance higher than that of the target plant.

The invention also provides a method for cultivating transgenic plants, comprising the following steps: and inhibiting the expression of a nucleic acid molecule encoding the OsLTPL23 protein in the target plant to obtain a transgenic plant with bacterial leaf blight disease susceptibility higher than that of the target plant.

The invention also protects the use of any of the above methods in plant breeding.

The object of the plant breeding is to obtain plants with enhanced bacterial leaf blight disease resistance.

The object of the plant breeding is to obtain plants with enhanced bacterial leaf blight susceptibility.

Any of the above plants may be monocotyledonous or dicotyledonous.

Any of the above plants may be a gramineous plant.

Any of the above plants may be a oryza plant.

Any of the above plants may be plants of the subfamily japonica.

Any of the above plants may be rice.

Illustratively, the plant may be rice Nippon.

The bacterial leaf blight is caused by bacterial leaf blight bacteria.

The bacterial leaf blight is caused by a pathogenic variant of Xanthomonas oryzae.

Illustratively, the bacterial leaf blight bacteria are bacterial leaf blight bacteria physiological race PXO61.

The invention discovers that: the over-expression of the OsLTPL23 gene can obviously enhance the disease resistance of rice to bacterial blight, and the inhibition of the expression of the OsLTPL23 gene can obviously enhance the susceptibility of rice to bacterial blight. The invention can be used in the fields of rice germplasm resource improvement and genetic breeding, can also be used for cultivating rice varieties resistant to bacterial leaf blight, and has good market application prospect.

Drawings

FIG. 1 is a graph showing the results of example 1.

FIG. 2 shows the sequencing results of 2 homozygous gene editing plants in example 2.

FIG. 3 shows two mutant proteins formed in homozygous gene editing plants of example 2.

FIG. 4 shows the results of bacterial leaf blight resistance identification in example 2.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Unless otherwise indicated, the quantitative tests in the examples below were all performed in triplicate, and the results averaged. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified. The agrobacterium EHA105 and the agrobacterium EHA105/pSoup are products of Beijing Bomaide gene technology Co., ltd, and the product catalog numbers are BC307-01 and BC313-01 respectively. Paddy Nippon (Oryza sativa L. Spp. Japonica), belonging to japonica rice, and denoted by NIP. The rice bacterial leaf blight bacteria used in the examples are Philippine bacterial leaf blight physiological race PXO61.

Vector PMDC43 (vector PMDC 43) is described in the following literature: mark Curtis and Ueli Grossniklaus.A Gateway TM cloning vector set for high-throughput functional analysis of genes in plants Physiology 2003,133,462-469. Vector PMDC43 has the hygromycin B resistance gene.

OsLTPL23 protein derived from rice is shown in SEQ ID NO: 1. In the rice cDNA, the open reading frame of the encoding OsLTPL23 protein is shown in SEQ ID NO: 2. In rice genome DNA, the OsLTPL23 gene is shown in SEQ ID NO:3 (the gene comprises 2 exons, located at positions 85-434 and 568-577, respectively).

Example 1 preparation and identification of OsLTL23 Gene-overexpressing plants

1. Construction of the overexpression vector

1. Extracting total RNA of the rice Japanese sunny leaves, and carrying out reverse transcription to obtain cDNA.

2. And (2) taking the cDNA obtained in the step (1) as a template, and carrying out PCR amplification by adopting a primer pair consisting of the OsLTPL23-cloning-F and the OsLTPL23-cloning-R to obtain an amplification product.

OsLTPL23-cloning-F：5'-ATGGCTCGCGCGGCGAATAA-3'；

OsLTPL23-cloning-R：5'-TCAGTGCACCCTGGAGCAGTCGG-3'。

3. And 2, taking the amplification product obtained in the step 2 as a template, adopting a primer pair consisting of the OsLTPL23-OE-F and the OsLTPL23-OE-R to carry out PCR amplification, and recovering the amplification product.

OsLTPL23-OE-F：5'-TGAACTATACAAAGGCGCGCCAATGGCTCGCGCGGCGAATAA-3'；

OsLTPL23-OE-R：5'-CTCTAGAACTAGTTAATTAATCAGTGCACCCTGGAGCAGTCGG-3'。

In OsLTPL23-OE-F and OsLTPL23-OE-R, the underlined parts are homologous bases for the subsequent seamless cloning steps.

4. Vector pMDC43 was digested with the restriction enzymes Pac I and Asc I to recover a vector backbone of about 10730 bp.

5. And (3) connecting the amplification product recovered in the step (3) and the vector skeleton recovered in the step (4) through seamless cloning to obtain the recombinant plasmid pMDC43-OsLTPL23. Sequencing verification results show that compared with the vector pMDC43, the recombinant plasmid pMDC43-OsLTPL23 only has the following differences: with SEQ ID NO:2 replaces a small fragment between the Pac I and Asc I cleavage sites in the vector pMDC43.

2. Acquisition of recombinant Agrobacterium

Recombinant plasmid pMDC43-OsLTPL23 was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium containing recombinant plasmid pMDC43-OsLTPL23, designated Agrobacterium EHA105-pMDC43-OsLTPL23.

The vector pMDC43 was introduced into Agrobacterium EHA105 to obtain a recombinant Agrobacterium containing the vector pMDC43, designated Agrobacterium EHA105-pMDC43.

3. Preparation of OsLTL23 gene over-expression plant

1. The embryogenic callus infected with rice Japanese sunny is soaked in agrobacterium EHA105-pMDC43-OsLTPL23, and then co-culture, screening culture (screening conditions: 50mg/L hygromycin B and 400mg/L carbenicillin), differentiation culture and rooting culture are sequentially carried out to obtain 28T 0 generation regenerated plants.

2. The T0 generation regenerated plant is taken as a test plant, and the transgenic plant is identified and screened by PCR.

PCR identification method: taking leaves of a plant to be tested, extracting genome DNA, adopting a primer pair consisting of hpt-F and hpt-R to carry out PCR identification, and if 480bp amplification products are shown, obtaining the plant to be tested as a transgenic plant.

hpt-F：5'-AGCGAGAGCCTGACCTATTG-3'；

hpt-R：5'-CTCCATACAAGCCAACCACG-3'。

3. Selfing the T0 generation transgenic plant, harvesting seeds and cultivating the seeds into a plant, namely a T1 generation plant. And (3) carrying out PCR identification on the T1 generation plants, wherein the method is the same as the step (2). For a T0 generation transgenic plant, if the T1 generation plants obtained by selfing are all transgenic plants, the T0 generation plant is a homozygous transgenic plant line.

A plurality of homozygous transgenic lines including the OELTPL23-1 line and the OELTPL23-6 line were obtained.

4. Preparation of empty control plants

The agrobacterium EHA105-pMDC43 is used to replace the agrobacterium EHA105-pMDC43-OsLTPL23, and the third step is the same.

A homozygous transplantable vector line (indicated by EMPTY) was obtained.

5. Detection of relative expression level of OsLTPL23 Gene

Test plants: rice plants of Nippon, T1 generation plants of OELTPL23-1 strain, T1 generation plants of OELTPL23-6 strain, and T1 generation plants of transgenic homozygous strain. 3-5 strains per strain.

Extracting total RNA of the tested plant, and carrying out reverse transcription to obtain cDNA. The cDNA is used as a template, the rice action gene is used as an internal reference gene, and the relative expression level of the OsLTPL23 gene is detected by fluorescent quantitative PCR.

The primers used to identify the action gene were as follows:

Actin-qRT-F：5'-TGCTATGTACGTCGCCATCCAG-3'；

Actin-qRT-R：5'-AATGAGTAACCACGCTCCGTCA-3'。

primers used to identify the OsLTPL23 gene were as follows:

OsLTPL23-qRT-F：5'-CGAGCGCGGTGACATGC-3'；

OsLTPL23-qRT-R：5'-TGGTCTGCTGCTTGAGGC-3'。

the transcriptional expression level of the OsLTPL23 gene in the plants tested is shown in a of fig. 1. Compared with rice Japanese sunny plants, the transcription expression level of the OsLTPL23 gene in the transgenic over-expression plants is obviously increased. Compared with the rice Japanese sunny plant, the transcription expression level of the OsLTPL23 gene in the transgenic empty carrier plant has no obvious difference.

6. Identification of bacterial leaf blight resistance

Test plants: rice plants of Nippon, T1 generation plants of OELTPL23-1 strain, T1 generation plants of OELTPL23-6 strain, and T1 generation plants of homozygous empty vector strain. 20 strains per line.

The test plants are planted in a farm test base of Ping Xi Fu of Changping area in Beijing, single plants are planted, and normal cultivation and management are carried out. Inoculating bacterial leaf blight bacteria of rice by artificial leaf-cutting method in the tillering stage of rice, inoculating 3-5 leaves (bacterial liquid concentration is 1×10) ⁹ cfu/mL). After 21 days of inoculation of bacterial leaf blight bacteria, the leaf spot damage phenotype of the plant leaves is observed, and the leaf spot length statistics is carried out.

The plant leaf phenotype photographs are shown in FIG. 1B (scale bar, 2 cm). The statistical result of the lesion length is shown in C of figure 1. Compared with rice Japanese sunny plants, the OsLTPL23 gene over-expression plants all show a phenotype of shortened bacterial leaf blight and disease spots, and the disease spot length is reduced by 33.01% and 29.45%, respectively. Compared with the rice Japanese sunny plant, the phenotype and the lesion length of the empty vector transfer plant are not significantly different.

Example 2 preparation and identification of OsLTPL23 Gene-edited plants

1. Construction of Gene editing vector

Target sequences were screened by pre-experiments. Target sequence: TAAGTATGTGGCGGCGGTGATGG. In the target sequence, the underlined part is the PAM (Protospacer Adjacent Motif) sequence.

Recombinant plasmid OsLTPL23-Cas9 was prepared. The recombinant plasmid OsLTPL23-Cas9 is a circular double-stranded DNA molecule, and the full sequence of the circular double-stranded DNA molecule is shown as SEQ ID NO: 4. In the recombinant plasmid OsLTPL23-Cas9, the 488 th to 507 th bits encode sgRNA and the 2692 th to 6822 th bits encode Cas9 protein.

2. Acquisition of recombinant Agrobacterium tumefaciens

The recombinant plasmid OsLTPL23-Cas9 is introduced into agrobacterium EHA105/pSoup to obtain recombinant agrobacterium containing the recombinant plasmid OsLTPL23-Cas9, which is named agrobacterium EHA105-OsLTPL23-Cas9.

3. Preparation of OsLTPL23 Gene-edited plant

1. The embryogenic callus infected with rice Nippon Temminck is soaked by agrobacterium EHA105-OsLTPL23-Cas9, and then co-culture, screening culture (screening conditions: 50mg/L hygromycin B and 400mg/L carbenicillin), differentiation culture and rooting culture are sequentially carried out, so that 30T 0 generation regenerated plants are obtained.

2. And taking the T0 generation regenerated plant as a test plant, and screening a gene editing plant.

The screening method comprises the following steps: taking leaves of a plant to be tested, extracting genome DNA, carrying out PCR amplification by adopting a primer pair consisting of OsLTPL 23-Deaction-F and OsLTPL 23-Deaction-R, and then recovering an amplification product and sequencing; rice japan was used as a wild-type control for the test plants; if the sequencing result of the PCR amplification product of the test plant is different from the sequencing result of the PCR amplification product of the wild type control, the test plant is a gene editing plant.

OsLTPL23-Dection-F：CACCCACACCACACTCCACT；

OsLTPL23-Dection-R：TAGCGTAGGGGATGTTGACG。

Of the 30 regenerated plants, 7 were gene-edited plants.

3. And (3) normally culturing the gene editing plants obtained in the step (2), respectively selfing and harvesting seeds, and culturing the seeds into plants, namely T1 generation plants.

4. And taking the T1 generation plant as a test plant, and screening homozygous gene editing plants.

The screening method comprises the following steps: taking leaves of a plant to be tested, extracting genome DNA, carrying out PCR amplification by adopting a primer pair consisting of OsLTPL 23-Deaction-F and OsLTPL 23-Deaction-R, and then recovering an amplification product and sequencing; rice japan was used as a wild-type control for the test plants; if the sequencing result of the PCR amplification product of the test plant is homozygous and different from the sequencing result of the PCR amplification product of the wild type control, the test plant is a homozygous gene editing plant.

2 homozygous gene editing-type plants were obtained, designated osltpl23-1 and osltpl23-2 plants, respectively.

The sequencing results of 2 homozygous gene editing type plants are shown in FIG. 2. Due to gene editing, NO SEQ ID NO:1, but two muteins are formed, see fig. 3.

5. And (3) normally culturing the osltpl23-1 plant obtained in the step (4), selfing and harvesting seeds, and culturing the seeds into plants, namely T2 generation plants of the osltpl23-1 plant line.

6. And (3) normally culturing the osltpl23-2 plant obtained in the step (4), selfing and harvesting seeds, and culturing the seeds into plants, namely T2 generation plants of the osltpl23-2 plant line.

4. Identification of bacterial leaf blight resistance

Test plants: rice plants of Nippon, T2 generation plants of osltpl23-1 strain, T2 generation plants of osltpl23-2 strain. 20 strains per line.

The procedure is as in step six of example 2.

The photograph is shown in FIG. 4A (scale bar, 2 cm). The lesion length statistics are shown in FIG. 4B. Compared with the rice Japanese sunny plant, the gene editing plants all show the phenotype that bacterial leaf blight disease spots become longer, and the disease spot length is respectively increased by 20.59 percent and 31.56 percent.

The results of example 1 and example 2 show that the OsLTPL23 protein positively regulates the disease resistance of rice against bacterial blight of rice.

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims

Application of OsLTPL23 protein or nucleic acid molecule encoding OsLTPL23 protein in regulating and controlling bacterial leaf blight resistance of plants; the OsLTPL23 protein is shown in SEQ ID NO:1 is shown in the specification; the plant is rice.
2. The use according to claim 1, wherein:

the nucleic acid molecule encoding the OsLTPL23 protein is as follows (b 1) or (b 2):

(b1) The coding region is shown in SEQ ID NO:2, a DNA molecule shown in fig. 2;

(b2) SEQ ID NO:3, and a DNA molecule shown in 3.
Application of OsLTPL23 protein or nucleic acid molecule encoding OsLTPL23 protein as positive regulation target in cultivation of plants with improved bacterial blight disease resistance; the OsLTPL23 protein is shown in SEQ ID NO:1 is shown in the specification; the plant is rice.
4. A use according to claim 3, wherein:

the nucleic acid molecule encoding the OsLTPL23 protein is as follows (b 1) or (b 2):

(b1) The coding region is shown in SEQ ID NO:2, a DNA molecule shown in fig. 2;

(b2) SEQ ID NO:3, and a DNA molecule shown in 3.
Application of OsLTPL23 protein or nucleic acid molecule encoding OsLTPL23 protein as negative regulation target in cultivation of plant with improved bacterial blight susceptibility; the OsLTPL23 protein is shown in SEQ ID NO:1 is shown in the specification; the plant is rice.
6. The use according to claim 5, wherein:

the nucleic acid molecule encoding the OsLTPL23 protein is as follows (b 1) or (b 2):

(b1) The coding region is shown in SEQ ID NO:2, a DNA molecule shown in fig. 2;

(b2) SEQ ID NO:3, and a DNA molecule shown in 3.
7. A method of growing a transgenic plant comprising the steps of: introducing a nucleic acid molecule encoding an OsLTPL23 protein into a target plant to obtain a transgenic plant with bacterial leaf blight disease resistance higher than that of the target plant; the OsLTPL23 protein is shown in SEQ ID NO:1 is shown in the specification; the plant is rice.
8. The method of claim 7, wherein:

the nucleic acid molecule encoding the OsLTPL23 protein is as follows (b 1) or (b 2):

(b1) The coding region is shown in SEQ ID NO:2, a DNA molecule shown in fig. 2;

(b2) SEQ ID NO:3, and a DNA molecule shown in 3.
9. A method of growing a transgenic plant comprising the steps of: inhibiting the expression of a nucleic acid molecule encoding an OsLTPL23 protein in a target plant to obtain a transgenic plant with bacterial leaf blight susceptibility higher than that of the target plant; the OsLTPL23 protein is shown in SEQ ID NO:1 is shown in the specification; the plant is rice.
10. The method of claim 9, wherein:

the nucleic acid molecule encoding the OsLTPL23 protein is as follows (b 1) or (b 2):

(b1) The coding region is shown in SEQ ID NO:2, a DNA molecule shown in fig. 2;

(b2) SEQ ID NO:3, and a DNA molecule shown in 3.
11. Use of the method according to claim 7 or 8 in breeding bacterial leaf blight disease resistance of rice.