CN111909250B - Protein INVAN6, coding gene thereof and application thereof in breeding male sterile line of corn - Google Patents

Protein INVAN6, coding gene thereof and application thereof in breeding male sterile line of corn Download PDF

Info

Publication number
CN111909250B
CN111909250B CN201910387858.0A CN201910387858A CN111909250B CN 111909250 B CN111909250 B CN 111909250B CN 201910387858 A CN201910387858 A CN 201910387858A CN 111909250 B CN111909250 B CN 111909250B
Authority
CN
China
Prior art keywords
sequence
protein
invan6
maize
dna molecule
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910387858.0A
Other languages
Chinese (zh)
Other versions
CN111909250A (en
Inventor
金危危
黄伟
李云飞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Agricultural University
Original Assignee
China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Agricultural University filed Critical China Agricultural University
Priority to CN201910387858.0A priority Critical patent/CN111909250B/en
Publication of CN111909250A publication Critical patent/CN111909250A/en
Application granted granted Critical
Publication of CN111909250B publication Critical patent/CN111909250B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
    • C12N15/8289—Male sterility
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Botany (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses a protein INVAN6, a coding gene thereof and application thereof in breeding a male sterile line of corn. The male fertility of the maize to be tested is fertile, wherein the amino acid residue at position 276 from the N-terminal of the protein INVAN6 is only aspartic acid or asparagine. The male fertility of the maize to be tested, in which the amino acid residue at position 276 from the N-terminal of the protein INVAN6 is aspartic acid and asparagine, is sterile. The type of the 276 th amino acid residue of the protein INVAN6 from the N-terminal can be used as a test object to predict male fertility of the maize to be tested. The invention has great application value.

Description

Protein INVAN6, coding gene thereof and application thereof in breeding male sterile line of corn
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a protein INVAN6, a coding gene thereof and application thereof in breeding a male sterile line of corn.
Background
Corn is one of the most important grain crops in China, and the total yield of the corn is the top of various crops. The corn seeding area in 2016 is about 3.67 ten thousand hectares, and the total yield reaches 2.19 ten thousand tons. Corn is not only a food crop and a feed crop, but also an important raw material for modern industry. Therefore, the high yield and the stable yield of the corn are realized, and the high-yield corn is beneficial to guaranteeing the food safety and the industrial production in China.
Most of corns planted in China are hybrid seeds, a plurality of links are involved in the seed production process, and castration of female parents is one of the most critical links. The traditional female parent castration method comprises manual castration, mechanical castration and chemical castration, but the methods have the defects of high cost, incomplete castration, environmental pollution and the like. Compared with the traditional emasculation mode, the method for producing the hybrid seeds by using the male sterile line has stable heredity, avoids the process of artificial emasculation, has no side effect on the environment and has high purity of the hybrid seeds. Male sterility includes cytoplasmic sterility and nuclear sterility. Wherein, the genetic stability of the genic male sterile gene is controlled by a single locus, and the genic male sterile gene has important application prospect in cross breeding.
In higher flowering plants such as maize, normal development of anthers and normal meiotic processes of pollen mother cells are critical for the formation of viable pollen. At present, the cloned partial recessive male sterility genes (such as MS22, MS33 and IPE1) and dominant nuclear sterility genes (such as MS45) in corn have mutations which affect the differentiation of anther parietal cells or the development of tapetum. The cloned meiotic genes (such as PHSI, AFD1 and DSY2) in corn are recessive inheritance, and the fertility of male and female gametes of the mutants is influenced. Although many genic male sterile genes have been cloned, in hybrid seed production, a sterile line needs to be screened by using a recessive genic male sterile gene and a dominant genic male sterile gene. Traditionally, the screening is carried out through genes (such as endosperm color genes, yellow-green seedling genes and the like) linked with sterile genes, but the problems of loose linkage and inaccurate identification exist. In order to solve the problem, the SPT technology is pioneered to develop, the recessive fertility restorer gene (such as Ms45) or dominant sterile gene (such as Ms44) and the grain fluorescent gene are linked to construct the SPT maintainer line or sterile line, and the sterile line is screened out through fluorescence, so that great convenience is provided for the utilization of the nuclear sterile gene. Therefore, the screening of new genic male-sterile genes can enrich breeding resources and solve the application difficulty of the genic male-sterile genes.
A promoter is a DNA sequence located upstream of a gene and is capable of activating RNA polymerase to bind to a template DNA, allowing it to bind precisely to the template DNA and having specificity for transcription initiation. In general, eukaryotic promoters have three types of conserved sequences including TATA-box, CAAT-box and GC-box, and other upstream promoter elements which can be recognized and combined by different transcription regulatory factors, thereby regulating the temporal and spatial expression of genes. Promoters can be classified into constitutive promoters, inducible promoters and tissue-specific promoters according to their mode of action and function. At present, the constitutive promoter is widely applied, for example, the Ubi promoter is used for researching the over-expression of the promoter gene in corn and rice; since constitutive promoters continue to stably regulate gene expression, they may increase the burden on plants, and may cause defects in plant growth and development due to ectopic expression of regulatory genes. Tissue-specific promoters, which regulate gene expression only in specific organs or tissues, can be better used to regulate the expression of genes of interest. The development of pollen mother cell into male gamete through meiosis process is one of the core parts of reproductive development, so that the development of pollen mother cell specific promoter can artificially express target gene in pollen mother cell, regulate reproductive development process or combine other techniques to only produce heritable variation in male gamete, and has important application value.
Disclosure of Invention
The invention aims to breed a plant male sterile line.
The invention firstly protects protein INVAN6, and protein INVAN6 can be W1) or W2) as follows:
w1) comprises a section I, a section II and a section III in sequence from the N end to the C end;
the segment II can be an amino acid residue;
the segment I can be a1) or a2) or a3) as follows:
a1) the amino acid sequence is a polypeptide shown in1 st to 275 th position from the N terminal of a sequence 5 in a sequence table;
a2) a polypeptide related to plant male fertility obtained by replacing the polypeptide shown in a1) by one or more amino acid residues;
a3) a polypeptide which has 80% or more than 80% of identity with the polypeptide shown in a1) or a2), is derived from corn and is related to male fertility;
the segment III may be b1) or b2) or b3) as follows:
b1) the amino acid sequence is polypeptide shown as 277 th to 562 th sites from the N terminal of a sequence 5 in a sequence table;
b2) a polypeptide related to plant male fertility obtained by replacing the polypeptide shown in b1) by one or more amino acid residues;
b3) a polypeptide which has 80% or more than 80% identity with the polypeptide represented by b1) or b2), is derived from corn, and is related to male fertility;
w2) is linked to the N-terminal or/and C-terminal of W1).
The term "identity" as used in a3) above, refers to sequence similarity to the native amino acid sequence. "identity" includes an amino acid sequence having 80%, or 85% or more, or 90% or more, or 95% or more identity to the amino acid sequence shown at positions 1 to 275 from the N-terminus of sequence 5 in the sequence listing of the present invention.
The term "identity" as used in b3) above means sequence similarity to the native amino acid sequence. "identity" includes an amino acid sequence having 80%, or 85% or more, or 90% or more, or 95% or more identity to the amino acid sequence shown at the 277 th to 562 th positions from the N-terminus of sequence 5 in the sequence listing of the present invention.
In the protein INVAN6, the segment ii may be an aspartic acid residue or an asparagine residue.
The protein INVAN6 may be composed of the segment I, the segment II and the segment III in sequence from N-terminal to C-terminal.
The protein INVAN6 may be specifically c1) or c2) or c3) or c4) as follows:
c1) the amino acid sequence is a protein shown as a sequence 5 in a sequence table (namely a protein INVAN6-WT mentioned in the embodiment);
c2) the amino acid sequence is a protein shown as a sequence 1 in a sequence table (namely a protein INVAN6-Mei mentioned in the embodiment);
c3) a protein which is obtained by replacing and/or deleting and/or adding one or more amino acid residues in the segment I and/or the segment III of the protein shown in the c1) or the c2) and is related to the male fertility of the plant;
c4) a protein having 80% or more identity to the protein represented by c1) or c2), derived from maize and related to male fertility.
The term "identity" as used in c4) above refers to sequence similarity to the native amino acid sequence. "identity" includes an amino acid sequence having 80%, or 85% or more, or 90% or more, or 95% or more identity to the amino acid sequence shown in sequence 1 or sequence 5 in the sequence listing of the present invention.
Nucleic acid molecules encoding any of the proteins INVAN6 described above are also within the scope of the invention.
The nucleic acid molecule encoding the protein INVAN6 can be any one of the following DNA molecules d1) -d 10):
d1) the coding region is a DNA molecule shown as a sequence 8 in a sequence table;
d2) the nucleotide sequence is a DNA molecule shown as a sequence 6 in a sequence table;
d3) the nucleotide sequence is a DNA molecule shown as a sequence 7 in a sequence table;
d4) the nucleotide sequence is a DNA molecule shown as a sequence 8 in a sequence table;
d5) the coding region is a DNA molecule shown as a sequence 4 in a sequence table;
d6) the nucleotide sequence is a DNA molecule shown in a sequence 2 in a sequence table;
d7) the nucleotide sequence is a DNA molecule shown in a sequence 3 in a sequence table;
d8) the nucleotide sequence is a DNA molecule shown as a sequence 4 in the sequence table;
d9) a DNA molecule having 75% or more identity to a nucleotide sequence defined in any one of d1) -d8) and encoding the protein INVAN 6;
d10) a DNA molecule which hybridizes with any one of the nucleotide sequences defined by d1) -d8) under strict conditions and codes for the protein INVAN 6.
Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.
The term "identity" as used in d9) above refers to sequence similarity to the native nucleic acid sequence. "identity" includes a nucleotide sequence having 75%, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity to a nucleotide sequence of the protein consisting of the amino acid sequence represented by sequence 5 in the sequence listing of the present invention, or a nucleotide sequence of the protein consisting of the amino acid sequence represented by sequence 1 in the sequence listing of the present invention.
Sequence 6 in the sequence table is composed of 7863 nucleotides (full length of gene). The sequence 7 in the sequence table consists of 2656 nucleotides (cDNA sequence). Sequence 8 in the sequence table is composed of 1689 nucleotides (coding region). The nucleotide of sequence 6, sequence 7 or sequence 8 in the sequence table encodes an amino acid sequence shown as sequence 5 in the sequence table. Sequence 2 in the sequence table is composed of 7863 nucleotides (gene full length). The sequence 3 in the sequence table consists of 2656 nucleotides (cDNA sequence). Sequence 4 in the sequence table is composed of 1689 nucleotides (coding region). The nucleotide of sequence 2, sequence 3 or sequence 4 in the sequence table encodes an amino acid sequence shown as sequence 1 in the sequence table.
Expression cassettes, recombinant vectors, recombinant microorganisms or transgenic cell lines containing said nucleic acid molecules also belong to the scope of protection of the present invention.
The invention also protects Z1) or Z2).
Z1) the protein INVAN6 or the nucleic acid molecule of any one of the above in regulating the male fertility of plants also belongs to the protection scope of the invention.
Z2) the protein INVAN6 or the nucleic acid molecule thereof in breeding a plant male sterile line and/or a plant male sterile maintainer line also belongs to the protection scope of the invention.
The invention also protects a breeding method of the plant male sterile line, which can enable a male fertile plant to express the protein INVAN6-Mei to obtain a transgenic plant; the transgenic plant is the plant male sterile line.
In the breeding method, the protein INVAN6-Mei can be e1) or e2) or e3) as follows:
e1) the amino acid sequence is protein shown as a sequence 1 in a sequence table;
e2) a fusion protein obtained by connecting labels to the N end or/and the C end of the protein shown in the sequence 1 in the sequence table;
e3) and (b) the protein shown in e1) or e2) is subjected to substitution and/or deletion and/or addition of one or more amino acid residues to obtain the protein with the same function.
In the above breeding method, the expression of the protein INVAN6-Mei in the male-fertile plant can be achieved by introducing a nucleic acid molecule encoding the protein INVAN6-Mei into the male-fertile plant. Said "introducing into a male-fertile plant a nucleic acid molecule encoding the protein INVAN 6-Mei" can be achieved by introducing into a male-fertile plant a recombinant vector; the recombinant vector can be a recombinant plasmid obtained by inserting a nucleic acid molecule encoding the protein INVAN6-Mei into an expression vector. In the recombinant vector, the plant pollen mother cell specific promoter promotes the expression of the coding gene of the protein INVAN 6-Mei. The nucleotide sequence of the plant pollen mother cell specific promoter can be shown as a sequence 9 in a sequence table.
In any of the above methods, the male fertile plants express only the protein INVAN6-WT as mentioned in the examples, i.e.the genotype is +/+ or mei025/mei025 as mentioned in the examples. The transgenic plants or plant male sterile lines express both the protein INVAN6-Mei and the protein INVAN6-WT, i.e.the genotype is the example mentioned Mei025/+ or Mei025/Mei 025.
The nucleic acid molecule encoding the protein INVAN6-Mei as described in any one of the above paragraphs may be a DNA molecule as described in any one of the following h1) -h 6):
h1) the coding region is a DNA molecule shown as a sequence 4 in a sequence table;
h2) the nucleotide sequence is a DNA molecule shown in a sequence 2 in a sequence table;
h3) the nucleotide sequence is a DNA molecule shown in a sequence 3 in a sequence table;
h4) the nucleotide sequence is a DNA molecule shown as a sequence 4 in the sequence table;
h5) a DNA molecule having 75% or more identity to the nucleotide sequence defined in any one of h1) -h4) and encoding the protein INVAN 6-Mei;
h6) a DNA molecule which hybridizes with any one of the nucleotide sequences defined by h1) -h4) under strict conditions and codes for the protein INVAN 6-Mei.
Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.
The term "identity" as used in h5) above refers to sequence similarity to the native nucleic acid sequence. "identity" includes a nucleotide sequence having 75%, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity to a nucleotide sequence of the protein consisting of the amino acid sequence shown in sequence 1 of the sequence listing of the present invention.
Sequence 2 in the sequence table is composed of 7863 nucleotides (gene full length). The sequence 3 in the sequence table consists of 2656 nucleotides (cDNA sequence). The sequence 4 in the sequence table consists of 1689 nucleotides (coding region). The nucleotide of sequence 2, sequence 3 or sequence 4 in the sequence table encodes an amino acid sequence shown as sequence 1 in the sequence table.
The recombinant vector can be specifically the recombinant plasmid pCAMBIA3300M/proINVAN6: INVAN6-Mei mentioned in the examples. The recombinant plasmid pCAMBIA3300M/proINVAN6: INVAN6-Mei contains nucleotide sequences shown in sequence 9 and sequence 4 in the sequence table.
In the breeding method, the transgenic plant can be specifically JM55 or JM63 mentioned in the examples. The male fertile plant at this time was maize B73-329.
Hereinbefore, the label may be the label shown in table 1.
TABLE 1 sequence of tags
Label (R) Residue(s) of Sequence of
Poly-Arg 5-6 (typically 5) RRRRR
FLAG
8 DYKDDDDK
Strep-tagII 8 WSHPQFEK
c-myc 10 EQKLISEEDL
Hereinbefore, said substitution and/or deletion and/or addition of one or several amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.
As described above, the protein may be synthesized artificially, or may be obtained by synthesizing the encoding gene and then performing biological expression.
The invention also protects a method for predicting male fertility of the corn to be tested.
The method for predicting male fertility of the maize to be tested, which is provided by the invention, can be specifically S1): detecting the 276 th amino acid residue type of the protein INVAN6 of the corn to be detected from the N terminal; the male fertility of the maize to be tested is fertile, wherein the amino acid residue type at the 276 th position of the protein INVAN6 from the N terminal is only aspartic acid or asparagine; the male fertility of the maize to be tested, in which the amino acid residue at position 276 from the N-terminus of the protein INVAN6 is aspartic acid or asparagine, is sterile.
The method for predicting male fertility of the maize to be tested, which is provided by the invention, can be specifically S2): detecting the 276 th codon nucleotide sequence in the specific transcript of the total RNA of the corn to be detected; the specific transcript can be RNA transcribed from a gene coding for the protein INVAN6, wherein the 1 st codon is an initiation codon; male fertility of the maize to be tested for "the nucleotide sequence of codon 276 of a particular transcript encodes only aspartic acid or asparagine" is fertile; the male fertility of the maize under test for which the nucleotide sequence of codon 276 of the particular transcript encodes aspartic acid and asparagine is sterile.
The method for predicting male fertility of the maize to be tested, which is provided by the invention, can be specifically S3): detecting the 826 th nucleotide species of the coding gene of the protein INVAN6 from the 5' end in the total DNA of the corn to be detected; the male fertility of the maize to be tested, in which the 826 th nucleotide type of the coding gene of the protein INVAN6 from the 5' end is G or A, is fertile; the male fertility of the maize to be tested, in which the 826 th nucleotide species of the gene coding for the protein INVAN6 from the 5' end are G and A, is sterile.
The method for predicting male fertility of the maize to be tested, which is provided by the invention, can be specifically S4): detecting whether the total DNA of the corn to be detected has a DNA molecule A and a DNA molecule B; the DNA molecule A can be at least one of a DNA molecule shown in a sequence 2 of a sequence table, a DNA molecule shown in a sequence 3 of the sequence table and a DNA molecule shown in a sequence 4 of the sequence table; the DNA molecule B can be at least one of a DNA molecule shown in a sequence 6 of a sequence table, a DNA molecule shown in a sequence 7 of the sequence table and a DNA molecule shown in a sequence 8 of the sequence table; the male fertility of the corn to be detected, which only has the DNA molecule B or the DNA molecule A in the total DNA of the corn to be detected, is fertile; the male fertility of the corn to be detected with the DNA molecule B and the DNA molecule A in the total DNA of the corn to be detected is sterile.
The invention also protects B1) or B2) or B3).
B1) The protein INVAN6 is applied to prediction of male fertility of corn to be detected by taking the amino acid residue type at 276 th position from N terminal as a detection object.
B2) The application of the nucleotide sequence of 276 th codon in the specific transcript as a detection object in predicting male fertility of the maize to be detected; the specific transcript may be RNA transcribed from the gene encoding the protein INVAN6, wherein the 1 st codon is the initiation codon.
B3) The application of the 862 nd nucleotide species of the encoding gene of the protein INVAN6 from the 5' end as a detection object in predicting male fertility of the maize to be detected.
The invention also protects the application of the substance A, the substance B or the substance C in predicting male fertility of the corn to be tested.
The substance A may be a substance for detecting the species of the amino acid residue at position 276 from the N-terminus of the protein INVAN 6.
The substance B can be a substance for detecting the nucleotide sequence of 276 th codon in a specific transcript; the specific transcript may be RNA transcribed from the gene encoding the protein INVAN6, wherein the 1 st codon is the initiation codon.
The substance C may be a substance for detecting the type of nucleotide at position 826 from the 5' end of the gene encoding the protein INVAN 6.
The invention also protects the application of the complete product A, the complete product B or the complete product C in predicting male fertility of the corn to be tested.
The kit A can be the substance A and a carrier recorded with the method A; the method A can be as follows: the male fertility of the maize to be tested is fertile, wherein the amino acid residue type at the 276 th position of the protein INVAN6 from the N terminal is only aspartic acid or asparagine; the male fertility of the maize to be tested, in which the amino acid residue at position 276 from the N-terminus of the protein INVAN6 is aspartic acid or asparagine, is sterile.
The kit B can be the substance B and a carrier recording the method B; the method B can be as follows: male fertility of the maize to be tested for "the nucleotide sequence of codon 276 of a particular transcript encodes only aspartic acid or asparagine" is fertile; the male fertility of the maize under test for which the nucleotide sequence of codon 276 of the particular transcript encodes aspartic acid and asparagine is sterile.
The kit C can be the substance C and a carrier recorded with the method C; the method can be as follows: the male fertility of the maize to be tested, in which the 826 th nucleotide type of the coding gene of the protein INVAN6 from the 5' end is G or A, is fertile; the male fertility of the maize to be tested, in which the 826 th nucleotide species of the gene coding for the protein INVAN6 from the 5' end are G and A, is sterile.
The double-site or multi-site mutant gene formed by mutation of 276 th amino acid residue from the N-terminal of the protein INVAN6 and mutation of other amino acid residues in the protein INVAN6 also belongs to the protection scope of the invention.
The application of the double-site or multi-site mutant gene formed by mutation of 276 th amino acid residue from the N terminal of the protein INVAN6 and mutation of other amino acid residues in the protein INVAN6 in predicting male fertility of the maize to be tested also belongs to the protection scope of the invention.
The invention also protects A1) or A2).
A1) The specific DNA molecule is used as the specific promoter of plant pollen mother cell or its application.
A2) The application of the specific DNA molecule in promoting the expression of target genes.
The nucleotide sequence of any one of the specific DNA molecules is shown as a sequence 9 in a sequence table.
The invention also protects a method for expressing the target gene.
The method for expressing a target gene protected by the present invention may specifically be the method A, wherein any of the above-mentioned specific DNA molecules is used as a plant pollen mother cell specific promoter or promoter to promote the expression of the target gene.
The method for expressing a target gene, which is protected by the invention, can be specifically the method B, and comprises the following steps: the expression of a gene of interest is initiated by inserting any of the specific DNA molecules described above upstream of any gene of interest or enhancer.
The expression of any of the above-mentioned target genes may be specifically expression of the target gene in a pollen mother cell of a plant.
Above, identity can be evaluated with the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.
Above, the plant may be any one of F1) to F8) as follows: F1) a dicotyledonous plant; F2) a monocot plant; F3) a gramineous plant; F4) corn; F5) maize inbred line B73; F6) corn B73-329.
Experiments prove that the type of the 276 th amino acid residue of the protein INVAN6 from the N terminal can be used as a detection object to predict the male fertility of the maize to be detected. The invention has great application value.
Drawings
FIG. 1 shows plant morphology, anther morphology and pollen fertility of wild type, heterozygous mutant and homozygous mutant.
FIG. 2 is the meiotic process of wild-type maize pollen mother cells.
FIG. 3 shows the meiotic process of heterozygous mutant pollen mother cells.
FIG. 4 shows the expression analysis of mei025 gene.
FIG. 5 shows the effect of mei025 gene on maize pollen fertility.
FIG. 6 shows the results of obtaining and identifying maize transgenic for Mei025 gene.
FIG. 7 shows the cloning of the specific promoter of pollen mother cells.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention.
The experimental procedures in the following examples are conventional unless otherwise specified.
The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.
The quantitative tests in the following examples, all set up three replicates and the results averaged.
Maize inbred line B73 is described in the following documents: schnable P S, Ware D, Fulton R S, et al, the B73 Maize Genome: complete, Diversity, and Dynamics [ J ]. Science,2015, 326(5956): 1112-.
The Maize mutant Mei025-Mei025 is stored in a Maize genetic cooperation germplasm resource library (Maize Genetics Cooperation Stockcenter) with the number 505F, and the concrete information is shown in website: https:// www.maizegdb.org/data _ center/stockid 415491.
Maize B73-329 is described in the following documents: zhang M, Cao Y, Wang Z, et al.A. retrotransfer Poson in an HKT1 family sodium transducer housings variation of leaf Na + exclusion and salt tolerance in mail [ J ]. New Phytologist, 2017.
The pollen fertility detection method comprises the following steps: taking anther of the corn to be detected in the pollen-dispersing period, mashing the anther by using a dissecting needle, dyeing the anther by using an Alexander dyeing method, and then calculating the pollen fertility, wherein the pollen fertility is the number of fertile pollen in the investigation pollen (namely the red dyed pollen)/the total number of the investigation pollen multiplied by 100%.
Example 1 map-based cloning of the Mei025 Gene associated with Male sterility in maize
Phenotypic identification of maize mutant Mei025-Mei025
1. Maize mutant Mei025-Mei025 was planted and the phenotype was observed.
The results show that the partial maize mutant Mei025-Mei025 appears to be male sterile and the partial maize mutant Mei025-Mei025 appears to be male fertile.
2. After the step 1 is completed, the male sterile individual plant in the maize mutant Mei025-Mei025 is used as a female parent, B73 is used as a male parent for hybridization, and a hybrid F1 generation is obtained. In the F1 generation hybrid, the segregation ratio of male fertile plants and male sterile plants was 1: 1.
3. After the step 2 is finished, backcrossing is carried out by taking the male sterile single plant in the hybrid F1 generation as a female parent and taking B73 as a male parent to obtain BC 1 F 1 And (4) a group. BC 1 F 1 In the population, the segregation ratio of male fertile plants to male sterile plants is 1: 1.
4. After completion of step 3, at BC 1 F 1 Backcrossing with the male sterile individual plant as female parent and B73 as male parent to obtain BC 2 F 1 And (4) a group. BC 2 F 1 In the population, the segregation ratio of male fertile plants to male sterile plants is 1: 1.
5. After completion of step 4, at BC 2 F 1 Backcrossing with the male sterile individual plant as female parent and B73 as male parent to obtain BC 3 F 1 And (4) a group. BC 3 F 1 In the population, the segregation ratio of male fertile plants to male sterile plants is 1: 1.
6. After completion of step 5, at BC 3 F 1 Backcrossing with the male sterile individual plant as female parent and B73 as male parent to obtain BC 4 F 1 And (4) a group. BC 4 F 1 In the population, the segregation ratio of male fertile plants to male sterile plants is 1: 1.
The above results indicate that the male sterility phenotype in the maize mutant Mei025-Mei025 is controlled by a dominant gene. According to the nomenclature of maize mutants, the dominant gene is designated as the Mei025 gene and the recessive gene (i.e., the wild-type gene) is designated as the + or Mei025 gene. Hereinafter, the maize mutant Mei025-Mei025 having the genotype Mei025/+ (or Mei025/Mei025) is referred to as a heterozygous mutant, the maize mutant Mei025-Mei025 having the genotype Mei025/Mei025 is referred to as a homozygous mutant, and the maize having the genotype +/+ (or Mei025/Mei025) is referred to as a wild type.
It was also found that the heterozygous mutant had a very low proportion of fertile pollen. Collecting pollen selfing or sister crossing of the heterozygous mutant plants to obtain an F2 population, and then carrying out genotype analysis. The analytical results were as follows: the segregation ratio of male fertile plants and male sterile plants in the F2 population is 1: 1; the genotype is determined according to the linked molecular markers, and the result shows that the male plants with better fertility in the F2 population contain Mei025/Mei025 and Mei025/Mei025 genotypes with the ratio of 1: 1.
In the powder scattering stage, the phenotypes of heterozygous mutant, homozygous mutant and wild type were observed. The results are as follows: the plant morphology of the heterozygous mutant, the homozygous mutant and the wild type is not obviously different (see A in figure 1); the heterozygous mutant showed no leakage of anthers (see B in FIG. 1) and significant shriveling of anthers (see C in FIG. 1) compared to the homozygous mutant or the wild type.
And (3) respectively taking the pollen of the heterozygous mutant, the homozygous mutant and the wild type, dyeing by an Alexander dyeing method, and performing fertility investigation. The results are shown in FIG. 1D and FIG. 1E. The results show that both homozygous mutant and wild type pollen can be stained, indicating that fertile pollen exists, but compared with wild type, the pollen fertility of homozygous mutant is obviously lower; pollen from heterozygous mutants could not be stained, indicating the absence of viable pollen. When the wild type pollen is used for pollinating the wild type mutant, the heterozygous mutant and the homozygous mutant respectively, the female ears can bear normal fruits, and the development of female gametes in the mutant is not influenced (shown as F in figure 1).
The research also finds that the homozygous mutant and the wild type are subjected to orthogonal or reverse crossing, and the obtained offspring genotypes are all heterozygotes and all represent male sterility.
The above results indicate that the heterozygous mutant is male sterile, whereas the homozygous mutant is substantially fertile.
In order to determine the period and the part of the generation of the male sterility of the heterozygous mutant, the inventor firstly determines the plant genotype in the backcross population through the molecular marker which is closely linked with the sterile gene, fixes the male ears of the heterozygous mutant and the wild type in the meiosis period respectively, and observes the meiosis process of the pollen mother cell through DAPI staining.
The wild-type pollen mother cell chromosomes undergo a series of dynamic changes to form four cells with the number of chromosomes being reduced by half (see figure 2, A is a thin line period, B is an even line period, C is a thick line period, D is a terminal transition period, E is a middle period I, F is a dyad period, G is a later period II, and H is a tetrad period). The meiotic progression of the heterozygous mutant is shown in FIG. 3(A is the thin line phase, B is the even line phase, C is the pachytene phase, D is the late pachytene phase of the heterozygous mutant abnormality, E and F are the metaphase phase of the heterozygous mutant abnormality). The results show that the pollen mother cells of the heterozygous mutant are obviously abnormal after the pachytene stage of meiosis, the subsequent meiosis process can not be normally carried out, and finally, the fertile pollen can not be produced. It follows that male sterility in hybrid mutants is due to abnormal division of the pollen mother cells.
Map-based cloning of Mei025 gene related to male sterility of maize
BC obtained in step one by the inventors of the present invention 1 F 1 Population, BC 2 F 1 Population, BC 3 F 1 Population and BC 4 F 1 The population is used as a genetic location population, and the sterile genes are anchored into a small genomic interval by a Map-based cloning (Map-based cloning or localization) method and comprise three candidate genes. On the basis, the three genes are cloned by using a conventional PCR methodThe sequence of each candidate gene. Sequencing and analysis confirm that the genome sequence of the heterozygous mutant and the maize inbred line B73 has a plurality of sequence differences, but only has a single-base variation on the Zm00001d015094 gene of maize, which codes for an alkaline/neutral invertase and is named invan6-invertase alkalineutral 6, compared with the genome sequence of the maize inbred line Mo 17. Sequencing of different inbred lines demonstrated that this single base variation is unique to maize mutant Mei025-Mei025, which caused the substitution of the encoded protein at position 276 with asparagine. Mei025 gene encodes a protein designated INVAN6-WT, while the Mei025 gene encodes a protein designated INVAN 6-Mei.
Through the analysis of a whole nucleotide sequence, the total length of the Mei025 gene is 7863bp (the nucleotide sequence is shown as a sequence 2 in a sequence table), the Mei025 gene contains four exons and three introns, the cDNA sequence of the Mei025 gene is 2656bp (the nucleotide sequence is shown as a sequence 3 in the sequence table), and the coding region is 1689bp (the nucleotide sequence is shown as a sequence 4 in the sequence table). The Mei025 gene encodes protein INVAN6-Mei, and the amino acid sequence of the protein INVAN6-Mei is shown as a sequence 1 in a sequence table. mei025 gene has a total length of 7863bp (nucleotide sequence shown as sequence 6 in the sequence table), mei025 gene has a cDNA sequence of 2656bp (nucleotide sequence shown as sequence 7 in the sequence table), and coding region of 1689bp (nucleotide sequence shown as sequence 8 in the sequence table). mei025 gene encodes protein INVAN6-WT, and the amino acid sequence of protein INVAN6-WT is shown as sequence 5 in the sequence table. The only difference between the protein INVAN6-Mei compared to the protein INVAN6-WT was the substitution of aspartic acid for asparagine at position 276.
Example 2 analysis of expression of mei025 Gene
1. Extracting total RNA of materials (roots, stems, leaves, tassels, female ears, filaments, mature florets, seeds 6 days after pollination, seeds 8 days after pollination or anthers with different diameters) of the mature period B73, and performing real-time quantitative PCR analysis by reverse transcription to cDNA (taking an Actin1 gene as an internal reference).
The primers for identifying mei025 gene were RT _ INVAN 6F: 5'-AAGGGCCATGCACCTTATTCTC-3' and RT _ INVAN 6R: 5'-TGCCCATTCTTCGGTCTATCATGG-3' are provided.
The primer for identifying the Actin1 gene is Actin 1F: 5'-TCACCCTGTGCTGCTGACCG-3' and Actin 1R: 5'-GAACCGTGTGGCTCACACCA-3'
The results are shown in FIG. 4A. The results show that mei025 gene is specifically expressed in tassel, and has the highest expression level in anther in early meiosis stage.
2. Mei025 gene expression position in anther is analyzed by mRNA in situ hybridization method, and probe is prepared by using mei025 gene first exon sequence as template.
The results are shown in fig. 4B. The results showed that mei025 gene signals appeared specifically in pollen mother cells from early to tetrad, with the strongest signals in meiotic early pollen mother cells. It shows that mei025 gene is specifically expressed in pollen mother cell and has important function on microspore development.
Example 3, mei025 Effect of the Gene on maize pollen fertility
The construction methods of the pBUE411 vector, the pCBC-MT1T2 vector and the Cas9 vector are described in the following documents: xing H L, Dong L, Wang Z P, et al.A CRISPR/Cas9 toolkit for multiplex genome editing in plants [ J ]. BMC Plant Biology, 2014, 14(1): 327.
The 5'-GTTCTGTGATCTTACTCTC-3' and 5'-CCGCAATAGATAAGTCTCA-3' sequences on the first exon of mei025 gene were selected as targets for gene editing, and the mei025 gene was subjected to gene editing.
First, construction of Gene editing vector
1. Taking a pCBC-MT1T2 vector as a template, and adopting a primer T36-F: 5'-AATAATGGTCTCAGGCGGTTCTGTGATCTTACTCTC-3', primer T36-F0: 5'-GGTTCTGTGATCTTACTCTCGTTTTAGAGCTAGAAATAGC-3', primer T37-R0: 5'-TGAGACTTATCTATTGCGGCGCTTCTTGGTGCC-3' and primer T37-R: 5'-ATTATTGGTCTCTAAACTGAGACTTATCTATTGCGG-3' four-primer PCR amplification is carried out to recover about 900bp PCR amplification product. In the PCR amplification system, the concentration of the primer T36-F0 and the primer T37-R0 is 1/20 of the primer T36-F and the primer T37-R.
2. After the step 1 is finished, the PCR amplification product is subjected to enzyme digestion by using restriction enzyme BsaI, and enzyme digestion fragments are recovered. The pBUE411 vector was digested with the restriction enzyme BsaI, and an about 16kb vector backbone was recovered.
3. And (3) after the step 2 is finished, connecting the enzyme digestion fragment with the vector framework to obtain the gene editing vector.
Second, obtaining and identifying transgenic corn
1. And transforming the gene editing vector into agrobacterium EHA105 to obtain the recombinant agrobacterium.
2. Carrying out amplification culture on the recombinant agrobacterium, infecting corn B73-329 immature embryos, screening glyphosate resistance, transplanting the seedlings to a greenhouse after seedling formation, and obtaining T 0 Transgenic maize was simulated.
3. Separately extracting T 0 Genomic DNA of transgenic maize was generated and used as template with OsU3-FD 3: GACAGGCGTCTTCTACTGGTGCTAC and TaU 3-RD: CTCACAAATTATCAGCACGCTAGTC to obtain PCR amplification product, and then judging as follows: if the PCR amplification product contains DNA fragment of about 831bp, the T corresponding to the PCR amplification product 0 Transgenic maize was identified as T 0 Generation of transgenic corn; otherwise not T 0 Transgenic maize is used.
Influence of mei025 gene on maize pollen fertility
1. Are respectively represented by T 0 Genome DNA of transgenic corn is used as a template, and a c9 seqF: 5'-AATTTTGAAACATGTAAGCATA-3' and c9 seqR: 5'-ACAAATAGTAATAGAAGGGTGT-3' to obtain a corresponding PCR amplification product of about 600 bp.
2. Sequencing the PCR amplification product obtained in the step 1 by using c9seqF and c9seqR as sequencing primers. And comparing the sequencing result with the nucleotide sequence shown as the sequence 2 in the sequence table, and determining the gene editing type according to the comparison result.
The results are shown in FIG. 5, panel A. The results show that the first exon of the mei025 gene has various types of base deletions, wherein one base (D1), two bases (D2) and seven bases (D7) all cause frame shift mutation, so that translation is terminated early, and the protein INVAN6-WT cannot be synthesized. If a certain T 0 When the base deletion occurs on one chromosome in the genome of the transgenic maize (the deletion species is D1, D2 or D7 of A in figure 5), the T is 0 The genotype of the transgenic corn generation is +/mei 025-ko. If a certain T 0 In the genome of transgenic maize, base deletion occurs on both chromosomes, the deletion type is D1, D2 or D7 of A in figure 5, and the deletion types on the two chromosomes can be the same or different, so that the T is 0 The genotype of the transgenic maize is mei025-ko/mei 025-ko.
3. Respectively observing corn B73-329 and T with genotype of +/mei025-ko in the pollen dispersing period 0 Transgenic maize and T with genotype mei025-ko/mei025-ko 0 Male fertility of transgenic maize. The results are shown in FIG. 5B. The results show that the gene is T which is compatible with corn B73-329 and has a genotype of +/mei025-ko 0 Compared with transgenic corn, the T with the genotype of mei025-ko/mei025-ko 0 The pollen fertility of the generation transgenic corn is obviously reduced. Therefore, the mei025 gene plays an important role in pollen fertility of corn.
Example 4 obtaining and identifying of Mei025 transgenic maize
The plant expression vector pCAMBIA3300M is a recombinant plasmid obtained by replacing the recognition sequence (small fragment) between the restriction enzymes SacI and EcoRI of the pCAMBIA3300 vector with the 3' -transcription termination region of the nopaline synthase (nos) gene.
Construction of recombinant plasmid pCAMBIA3300M/proINVAN6, INVAN6-Mei
A schematic diagram of the construction of the recombinant plasmid pCAMBIA3300M/proINVAN6: INVAN6-Mei is shown in A in FIG. 6.
1. And (3) performing PCR amplification by using the genome DNA of the maize inbred line B73 as a template and adopting a primer pair consisting of 5'-TTAAGAACCAAACGGCATC-3' and 5'-CTTTGCTAGTTTTTGAAAGAGA-3' to obtain a PCR amplification product 1.
Sequencing the PCR amplification product 1. The sequencing result shows that the nucleotide sequence of the PCR amplification product 1 is shown as a sequence 9 in the sequence table. The PCR amplification product 1 is the self-promoter proINVAN6 of mei025 gene.
2. And (2) connecting the PCR amplification product 1 obtained in the step (1) with a vector pEASY-Blunt to obtain an intermediate vector.
3. Taking the intermediate carrier obtained in the step 2 as a template, and adopting 5' -CCCAAGCTTTTAAGAACCAAACGGCATC-3 '(recognition site for the restriction enzyme HindIII is underlined) and 5' -ACGCGTCGACCTTTGCTAGTTTTTGAAAGAGA-3' (recognition sites for the restriction enzyme SalI are underlined) was subjected to PCR amplification to obtain a PCR amplification product 2.
4. Artificially synthesizing a DNA double-stranded molecule shown as a sequence 4 in a sequence table, taking the DNA double-stranded molecule as a template, and adopting 5' -ACGCGT CGACATGGTACAATGTACTCAACCTCC-3 '(underlined recognition site for the restriction enzyme SalI) and 5' -CGCGGATCCTCATGGGCACGAGTTGGAGC-3' (recognition site for restriction enzyme BamHI is underlined) was subjected to PCR amplification to obtain PCR amplification product 3.
5. The PCR amplification product 2 was digested with restriction enzymes HindIII and SalI, and the digested fragment 2 was recovered. The PCR amplification product 3 was digested with restriction enzymes SalI and BamHI, and the digested fragment 3 was recovered. The plant expression vector pCAMBIA3300M was digested with restriction enzymes HindIII and BamHI, and a vector backbone of about 9kb was recovered.
6. And connecting the enzyme-digested fragments 2 and 3 with a vector skeleton to obtain the recombinant plasmid pCAMBIA3300M/proINVAN6, INVAN 6-Mei.
7. Taking the recombinant plasmid pCAMBIA3300M/proINVAN6: INVAN6-Mei, and carrying out enzyme digestion identification by using restriction enzymes HindIII and BamHI.
The results of enzyme cleavage are shown in B in FIG. 6.
The recombinant plasmid pCAMBIA3300M/proINVAN6: INVAN6-Mei was sequenced. Sequencing results show that the recombinant plasmid pCAMBIA3300M/proINVAN6: INVAN6-Mei contains nucleotide sequences shown in sequence 9 and sequence 4 in the sequence table.
Obtaining and identifying Mei025 transgenic corn
1. Transforming the recombinant plasmid pCAMBIA3300M/proINVAN6: INVAN6-Mei into agrobacterium EHA105 competence, adopting a heat shock transformation method, growing a transformant on an LB solid culture medium containing kanamycin, selecting a single clone, inoculating the single clone into an LB liquid culture medium containing kanamycin, and performing shake culture to obtain a strain with the expression of INVAN6_ cF: 5'-AGCTCTCTTTCAAAAACTAGCAA-3' and NOSR: 5'-AGACCGGCAACAGGATTCAATC-3' is used as a primer to carry out PCR of bacterial liquid, positive clone is identified by the PCR of the bacterial liquid, and the positive clone can amplify a 1782bp fragment.
2. Selecting an agrobacterium transformed with recombinant plasmid pCAMBIA3300M/proINVAN6: INVAN6-Mei, carrying out amplification culture, infecting young embryos of corn B73-329, screening glyphosate resistance, transplanting the seedlings to a greenhouse after seedling formation, and obtaining T 0 Maize with the Mei025 gene was simulated.
3. Separately extracting T 0 Genomic DNA of Mei025 transgenic maize was mock-transformed and used as template with INVAN6_ cF: 5'-AGCTCTCTTTCAAAAACTAGCAA-3' and NOSR: 5'-AGACCGGCAACAGGATTCAATC-3', performing PCR amplification to obtain PCR amplification product, and then judging as follows: if the PCR amplification product contains a 1782bp DNA fragment, the T corresponding to the PCR amplification product 0 Maize with a simulated transfer Mei025 gene was identified as T 0 Transferring to Mei025 gene corn; otherwise not T 0 Transferring to Mei025 gene corn.
2 strains T identified therein 0 The maize transgenic for the Mei025 gene was designated JM55 and JM 63.
The male fertility of JM55, JM63 and corn B73-329 is observed in the powder scattering period. The results are shown in FIG. 6C (WT is maize B73-329). The results showed that JM55 and JM63 appeared to be male sterile and maize B73-329 were male fertile.
4. Using JM55 or JM63 as female parent and maize B73-329 as male parent to perform hybridization, and then identifying the filial generation according to the method of step 3 to obtain T 1 Transferring to Mei025 gene corn.
Powder scattering period observation T 1 Male fertility of maize transformed with Mei025 gene. The results show that T 1 The maize transformed with the Mei025 gene is male sterile.
5. Will T 1 The male ear of the transgenic Mei025 gene maize in the meiosis stage is fixed, and the meiosis process of the pollen mother cell is observed by DAPI staining.
The results show that T 1 Pollen mother cell meiosis abnormal table of Mei025 transgenic maizeType (bold line, abnormal meiosis example 1 and abnormal meiosis example 2 from left to right in FIG. 6D) is essentially identical to the abnormal phenotype of the heterozygous mutant.
The results show that the male sterile phenotype of the heterozygous mutant is caused by the Mei025 gene, the Mei025 gene can enable the plant to generate a male sterile character, and the gene is dominant.
Example 5 cloning of specific promoter for pollen mother cell
First, construction of recombinant plasmid pCAMBIA3300M-proINVAN6 eGFP:. INVAN6-WT
A schematic diagram of the construction of the recombinant plasmid pCAMBIA3300M-proINVAN6 eGFP:: INVAN6-WT is shown in A in FIG. 7.
1. Taking the genome DNA of the maize inbred line B73 as a template and adopting 5' -CCCAAGCTTTTAAGAACCAAACGGCATC-3 '(recognition sites for the restriction enzyme HindIII are underlined) and 5' -TCGACCATGGCTTTGCTAGTTTTTGAAAGAGA-3' (recognition sites for restriction enzyme NcoI are underlined) were subjected to PCR amplification to obtain a PCR amplification product A.
Sequencing the PCR amplification product A. The sequencing result shows that the PCR amplification product A contains the self promoter proINVAN6 of mei025 gene.
2. Artificially synthesized eGFP tag sequence (https:// www.snapgene.com/resources/plasmid-files/&plasmid ═ EGFP) as template, 5' -TCGA was usedCCATGGTGAGCAAGGGCGAGGAG-3 '(recognition site for restriction enzyme NcoI is underlined) and 5' -ACGCGTCGACCTTGTACAGCTCGTCCATGCCGA-3' (the recognition site of the restriction enzyme SalI is underlined) was subjected to PCR amplification to obtain a PCR amplification product B. The PCR amplification product B contains the eGFP gene. The eGFP gene encodes an eGFP protein, which is 26.9kD in size.
3. Artificially synthesizing a DNA double-stranded molecule shown as a sequence 8 in a sequence table, taking the DNA double-stranded molecule as a template, and adopting 5' -ACGCGTCGACGTACAATGTACTCAACCTCC-3 '(underlined recognition site for the restriction enzyme SalI) and 5' -CGCGGATCCTCATGGGCACGAGTTGGAGC-3' (underlined for limitation)Recognition site of restriction enzyme BamHI) to obtain PCR amplification product C. The PCR amplification product C encodes the initial Met-depleted protein INVAN6-WT, which is approximately 65kD in size.
5. The PCR amplification product A was digested with restriction enzymes HindIII and NcoI, and the digested fragment A was recovered. And (3) digesting the PCR amplification product B by using restriction enzymes NcoI and SalI, and recovering a digested fragment B. And (3) digesting the PCR amplification product C by using restriction enzymes SalI and BamHI, and recovering a digested fragment C. The plant expression vector pCAMBIA3300M was digested with restriction enzymes HindIII and BamHI, and a vector backbone of about 9kb was recovered.
6. Connecting the enzyme cutting fragment A, the enzyme cutting fragment B, the enzyme cutting fragment C and a carrier skeleton to obtain a recombinant plasmid pCAMBIA3300M-proINVAN6, wherein eGFP is invaN 6-WT.
Second, obtaining and identifying transgenic corn
1. The recombinant plasmid pCAMBIA3300M-proINVAN6 eGFP:: INVAN6-WT was transformed into Agrobacterium EHA105 to obtain recombinant Agrobacterium.
2. Carrying out amplification culture on the recombinant agrobacterium, infecting corn B73-329 immature embryos, screening glyphosate resistance, transplanting the seedlings to a greenhouse after seedling formation, and obtaining T 0 Transgenic maize was simulated.
3. Separately extracting T 0 Genomic DNA of transgenic maize was generated and used as template with INVAN6_ cF: 5'-AGCTCTCTTTCAAAAACTAGCAA-3' and NOSR: 5'-AGACCGGCAACAGGATTCAATC-3', performing PCR amplification to obtain PCR amplification product, and then judging as follows: if the PCR amplification product contains a 1782bp DNA fragment, the T corresponding to the PCR amplification product 0 Transgenic maize was identified as T 0 Generation of transgenic corn; otherwise not T 0 Transgenic maize is used.
Detection of fusion protein
1. Detection of fusion expressed protein by immunoblotting (Western Blotting)
Based on the size of the eGFP protein and the protein INVAN6-WT, the fusion protein eGFP:: INVAN6-WT was expected to be about 92kD in size.
Get T 0 The transgenic corn or fresh tassel of corn B73-329 is substituted, total protein is extracted, and then the fusion expression protein is detected by immunoblotting method, the antibody is rabbit antibody capable of specifically recognizing GFP, and the reference antibody is plant Actin rabbit antibody.
The results are shown in B of FIG. 7 (WT is maize B73-329, 0335-1 and 0335-2 are all T 0 Different lines of generation transgenic maize). The results show that the use of GFP antibodies can be performed at T 0 A band of about 90kD in size was specifically detected in the tassel total protein of the transgenic maize generation, consistent with the size of the fusion protein eGFP:INVAN 6-WT.
Thus, proINVAN6 was able to initiate expression of the fusion protein and encoded the fusion protein eGFP:INVAN 6-WT, which was identical in size to the expected size.
2. Fluorescent microscope observation of anthers in meiotic stage
Get T 0 Fresh anthers in the meiosis period of the transgenic corn are placed on a glass slide, 15 mu L of PBS buffer solution containing DAPI is added, a cover glass is covered, the mixture is tabletted and stained for 5min, then the mixture is observed under a fluorescence microscope and photographed and recorded, the red color is DAPI, the DNA is represented, and the green color is eGFP protein.
The results are shown in FIG. 7, in which C (0335-1 and 0335-2 are T) 0 Different lines of generation transgenic maize). The results indicate that eGFP signal appears specifically in pollen mother cells, and eGFP signal could not be detected in anther parietal cells (indicated by arrows). The results of in situ hybridization of mRNA in example 2 further indicated that the mei025 gene was a pollen mother cell-specific gene, and that the 2875bp upstream sequence was selected to specifically promote the expression of mei025 gene in pollen mother cells.
<110> university of agriculture in China
<120> protein INVAN6, coding gene thereof and application thereof in breeding male sterile line of corn
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 562
<212> PRT
<213> Zea mays L.
<400> 1
Met Val Gln Cys Thr Gln Pro Pro Pro Gln Leu Lys Leu Pro Glu Ser
1 5 10 15
Lys Ile Thr Glu Pro Thr Asp Asp Glu Asn Gln Asp Leu Pro Pro Lys
20 25 30
Pro Glu Lys Arg Thr Arg Met His His Ile Glu Arg His Arg Ser Cys
35 40 45
Val Val Thr Leu Ser Asp Ile Glu Leu Asn Gly Leu Gln Pro Arg His
50 55 60
Leu His Gln Pro Ile Glu Ile Ser Pro Gly Gly Ser Gln Cys Ser Leu
65 70 75 80
His Glu Glu Thr Pro Thr Asp Thr Asn Ala Ser His Arg His Ala Ile
85 90 95
Ala Asp Ala Ala Trp Glu Ala Leu Lys Arg Ser Ile Val Tyr Phe Arg
100 105 110
Gly Gln Pro Ile Gly Thr Val Ala Ala Ile Asp Lys Ser Gln Gly Ala
115 120 125
Ala Leu Asn Tyr Asp Gln Val Phe Met Arg Asp Phe Ile Pro Ser Ala
130 135 140
Leu Ala Phe Leu Met Lys Gly Glu His Leu Ile Val Lys Asn Phe Leu
145 150 155 160
Val Glu Thr Ala Arg Leu Gln Ser Arg Glu Lys Met Val Asp Leu Phe
165 170 175
Lys Leu Gly Gln Gly Val Met Pro Ala Ser Phe Lys Val His His Arg
180 185 190
Asn Pro Thr Gln Lys Thr Glu Ser Leu Leu Ala Asp Phe Gly Glu Thr
195 200 205
Ala Ile Gly Arg Val Ala Pro Val Asp Ser Gly Leu Trp Trp Ile Ile
210 215 220
Leu Leu Arg Ala Tyr Thr Lys Trp Thr Gly Asp Asn Ser Leu Ala Glu
225 230 235 240
Ser Thr Asn Cys Gln Arg Ala Met His Leu Ile Leu Arg Leu Cys Leu
245 250 255
Ser Glu Gly Cys Asp Thr Ser Pro Ala Leu Leu Cys Ala Asp Gly Cys
260 265 270
Ser Met Ile Asn Arg Arg Met Gly Ile Tyr Gly Tyr Pro Ile Glu Ile
275 280 285
Gln Ala Leu Phe Phe Met Ala Met Arg Cys Ala Leu Ser Leu Leu Lys
290 295 300
Gln Glu Ser Asp Ala Asp Phe Val Asn His Ile Thr Lys Arg Ile Gln
305 310 315 320
Ala Leu Ser Tyr His Leu His Ser Tyr Tyr Trp Leu Asp Phe Gln Arg
325 330 335
Leu Asn Asp Ile Tyr Arg Tyr Lys Thr Glu Glu Tyr Ser Gln Thr Ala
340 345 350
Leu Asn Lys Phe Asn Val Met Pro Glu Ser Ile Pro Asp Trp Ile Phe
355 360 365
Asp Phe Met Pro Ser Arg Gly Gly Tyr Phe Ile Gly Asn Val Ser Pro
370 375 380
Ala Arg Met Asp Phe Arg Trp Phe Cys Leu Gly Asn Phe Ile Ala Ile
385 390 395 400
Leu Ser Ser Leu Ala Thr Gly Glu Gln Ala Glu Ala Ile Leu Asp Leu
405 410 415
Val Glu Glu Arg Trp Gln Glu Leu Ile Gly Glu Met Pro Leu Lys Ile
420 425 430
Cys Tyr Pro Ala Met Glu Asn Gln Glu Trp Gln Ile Val Thr Gly Cys
435 440 445
Asp Pro Lys Asn Thr Arg Trp Ser Tyr His Asn Gly Gly Ser Trp Pro
450 455 460
Val Leu Leu Trp Leu Leu Val Ala Val Ser Val Lys Leu Gly Arg Pro
465 470 475 480
His Leu Ala Arg Arg Ala Val Glu Leu Met Glu Gln Arg Leu Ala Lys
485 490 495
Asp Asp Phe Pro Glu Tyr Tyr Asp Gly Lys Ala Gly Arg Tyr Val Gly
500 505 510
Lys Gln Ala Arg Lys Phe Gln Thr Trp Ser Val Ala Gly Tyr Leu Val
515 520 525
Ala Lys Met Leu Leu Asp Asp Pro Ser His Leu Arg Ile Val Ala Leu
530 535 540
Glu Gly Asp Ser His Ser Arg Ala Pro Phe Leu Lys Arg Ser Asn Ser
545 550 555 560
Cys Pro
<210> 2
<211> 7863
<212> DNA
<213> Zea mays L.
<400> 2
aaaagcactt cgagtactcc acaccacacc agtccagctg tccgcccccg ccacttcgag 60
ttcggttgga ggcttggagg cttggagcac aagagcaaag gcgaggggag gcagcgcaaa 120
accctcctcg tcgtcgcgcg ctccgcctgc accacccgcc gccgaaggta agccccccca 180
cccttcccac cgcctcttca ccctccccct ctttctctcg cgcgcgcccg cgtccgcgca 240
atggcctctg cgatgcttct atttccaagc gcgctaacga tgaaaaaccc aaagtctcca 300
tgccgtcccg ccggtcgccc ccgtggggaa gcggatcgct ggggaatgtg ggtttgctcg 360
ctcttctatc cggcgatcgg ggccgcgccc cgcgcggagg gtgtttcgcc tctggatttc 420
ggcttcgccg gatctgatcg gggttttggc ggggttttcc gttgggtggt ggccacgcgt 480
gcatggtgct tttgtgcgtc cgaagttact ttgcagccca aagccccaaa ccatgcgcgg 540
cgtggtccgg tgttcggttc cagtggaagc ggaaatgccc ttttgctcgt tgctttctca 600
agttctctag atcgactaga ctggcgacgc agtttttgta gggtcctgtt ttctgacgat 660
cgatgcatgt gtcatgtgtg tgcttctcta tgtgttctgc cgaatctgtt agctctgccg 720
actggacaac gacaggtggc tgccaccttg catcccattc actgaacagc atgttattta 780
ctagttcatg gatttgcagc cagacctttg cttactgtga ttgtttatac tcgtggtctg 840
atttctggtg tctctgatgg gaggatcgtt tattcttatg gcctgcatcg tagtactttc 900
tgtgatttcc ttactttcca gacttgtagc tgtacgtatt gttagtgggt cggaggaaac 960
atggttcagt gctctgggag ttcttactat ttttatgtca ctgaattttg atgcatcaat 1020
aaaaccttta agaatatgtc agcttgatcc tccatgtttt caagacagct gcaacatttt 1080
tttttggatt agtggtactt tgatttcgta caggttatgc tgcataagga tatttattta 1140
gttaaaagca aattccaagt atagataaat gggattaacg tgcagcagat ttattgaaac 1200
ttagtgttaa gtgttaacgt cgtacgtttg tgccattgca tgtgatagtt tatataccgt 1260
tgcttcctat tccgctaaat gaggcgggct ctttggctgc aactgcaatg cctaaaacct 1320
aatcatggct gtgcttctgc cttcgaaacc tgaatatatc taagtttacc actctcattc 1380
tcattctttt ttcttgtact tgtacatcct tattaaccta gtcctggttg tgcgtcacct 1440
acactacagc ctgacctcac atcatttatg agttttcact ggtgaaattt tgcttcatcc 1500
gatcttacca ggtttggagt ggagatttct gagggtttca attgcatggt gatgagggtt 1560
actttctaaa gtgctaggtc cactagattg gtgcaacagt tttgggcccg gaagttgtat 1620
agtcttcagt gaatggtcat tatttactga ataggaataa tttgtagtta gtagtctcca 1680
tttgccattg aaatctgaga gtatgctcaa gaattaagag tactgcagta gcatgttgta 1740
tcagcttcag caaccttaag gaaacaataa attgtattga cttaagtgtt cgatgtgaga 1800
aaagtattat acatatcata tttatagaat atacacatgt tgcagtacat agttcttttt 1860
tgcatgaact tcctttcttt caggcatagg tggccaggtg ctgccccatt gtagtttaat 1920
ttaattgtag ttcaggaaaa acggaaatca gtcaaggctt agttaaaata gatcttaaag 1980
tttttacttg tccctatttt cttttgccta aaccttatgt gtctgttgtg ctttctattt 2040
atttcaatag aaatgttcat gatgtggaaa atgttcattg cgatgccaag agctagcaat 2100
gcaaaatatg caactaacaa acagttcttt tatatgtttc ggggcatgag aacttaatgc 2160
agttttgtat aatgccctga ttttgaaatt ttgaaacatg taagcatatg cttattcttt 2220
ttatttgtcg ttctattgac cagagctctc tttcaaaaac tagcaaagat ggtacaatgt 2280
actcaacctc ctccccagtt aaagctccca gagagtaaga tcacagaacc gacagatgat 2340
gagaaccaag atttgccacc aaaacctgag aaaaggacta ggatgcacca cattgagagg 2400
cacagatctt gtgttgtgac cttatctgac atagaactta atggtctgca acctcgtcat 2460
ctgcaccaac ccattgagat cagcccagga ggatcacagt gttcgctcca tgaagaaaca 2520
cctacagata ctaatgcatc acacaggcat gcaattgcag atgctgcttg ggaagccctc 2580
aaaaggtcaa tagtttactt cagaggccaa ccaattggga ctgttgccgc aatagataag 2640
tctcaggggg cagcactgaa ctatgaccag gtgacctact gaccttttcc gtttccagtc 2700
gaagtgttgg cacttggcag tgctgccaac tttaaaaatt tcatgctatt tttatattat 2760
tcaatacacc cttctattac tatttgtttt gcgtctatcg ttatcgtaaa tggcagttct 2820
aatcctgatg gtgagtattc atgtgtacat tattgcattc ctgcaaaaat acatcttagt 2880
tatctcatgc atgaattata cttgtgcctg tgcatgcaaa aatacattat aattatacat 2940
tggtacaggt tttcatgagg gatttcattc ctagcgcatt ggcttttctt atgaaaggag 3000
agcacttgat tgtgaagaac tttctggtag aaactgcacg ccttcagtca agggagaaga 3060
tggttgacct tttcaagctt ggtcagggtg tgatgcctgc aagctttaag gtacatcatc 3120
gcaaccctac ccagaagaca gagagcttac tggctgattt tggtgaaact gccattggga 3180
gggttgctcc tgtagattct ggcttatggt ggattattct ccttcgtgct tacaccaaat 3240
ggacagggga caattctctg gctgaaagta ctaactgcca aagggccatg caccttattc 3300
tcaggttgtg tctctcagag gggtgtgata cttctccagc cttgctttgt gctgatggat 3360
gctccatgat aaaccgaaga atggtaggct gcccacctca ttccagctac ttgtgttttc 3420
ttattatgtt tgactttgta tctcttgcaa gtcccatctc attcataact gaaactgctt 3480
tagctcatat atatatggaa atatataaat acttcggata tttttctttc tgggttctat 3540
aggagaaacc atttatagga tgctgttgta ggcttgtagc tattaaaaat caggaccaaa 3600
gacttggaac ataagaggat tgtgaacatt aataatggtt caatgtatgg gttttggaaa 3660
catacgtgaa gtatgtcgtt gtgatttgtg gataacagca tagattgctt tgctgttagc 3720
gaacactttg tcaaacttct taatcttctc tatctctatg caagtgttag tttcttttag 3780
tttgatcgtg ttctttgtct tattgaagta ttgttaattc ccagtggttg tgcttcctgt 3840
agactacata ttcatctcgt ggaaaaccta gaaaatttac caaccatttt gacgcttttc 3900
gtcctgggaa cagcaagtta tctaaatgct tgtcttgaac gtttgtacat gtttatcatg 3960
caccttgttt atcgaactgt tgactgaaat ctgtgcaggg catatatggc tacccaattg 4020
aaatccaggc tctctttttt atggctatga gatgcgccct gagtctgttg aaacaagagt 4080
ccgatgctga cttcgtgaac cacatcacaa aacgaatcca agctctgagc taccacttgc 4140
acagttacta ctggttggac ttccagagac ttaatgacat ataccgctac aagaccgaag 4200
agtactcaca gacagctctg aacaagttca acgtgatgcc cgaatcgata cctgactgga 4260
tatttgactt catgcctagc cgtggtgggt acttcattgg caacgttagt cccgcgagga 4320
tggatttccg ctggttctgc ctaggcaact tcatcgcgat tctgtcgtcg ttggctaccg 4380
gagagcaggc tgaagcgata ctggatcttg tggaggagcg ctggcaagaa ctcatcggtg 4440
agatgccgct caagatctgt taccctgcga tggaaaatca ggaatggcag atagtcactg 4500
gatgcgaccc caagaacacc aggtggagct atcacaacgg aggctcgtgg ccaggtgagt 4560
tccatttgtt atctatcact gcaaaactgc attatgtaac acttgttgct agcgtggtca 4620
tactccagct agttgtcttg tttttatgtt cttgaacctc tctgtattta tttccgttgt 4680
aatgttaatg gaaatggggt cagcctcgat tccgaaaaga aaattggtaa tatgtgtgca 4740
tcctccactc tgcatcagca tccattttag ttcttatctg ttttgacccc ccggaccccg 4800
gtcggtgcaa atattatgtt ggtcatgcat gcagtgctgt tgtggctgct ggtggcggtg 4860
agcgtgaagc tggggcggcc gcacctggcg cggagagccg tggagctgat ggagcagcgg 4920
ctggccaagg acgacttccc cgagtactac gacggcaagg ccgggcggta cgtggggaag 4980
caggcgcgca agttccagac atggtccgtg gccggctacc tggtggccaa gatgctcctg 5040
gacgacccct cccacctgcg gatcgtggcg ctggagggcg acagccactc cagggccccc 5100
ttcctcaagc gctccaactc gtgcccatga gtccatgacc cccaggcccc agcacagcac 5160
aggccgcatg cattaccttt ccacgcacca gtttgcccac accgagacta cgagagtaaa 5220
aagtttcgtt tcgatgcagt gcattcttct tactacataa gtataatcaa gcagtagtag 5280
tgtgatgtgc taccaagagg aggatgacag ggacaggata ccgagtatgt atgtactgtc 5340
tccatttgcc agatcagatg ctggttaaca ttttggaatg tcaggggctc acggctagca 5400
atgcgtctgg tagctgagga aatgtaaaaa ctccatgtgc tgatatactg tttcttagac 5460
ctgatgtcat gcggtcctgg tgctgataaa aagctattga tattcaccat cttcagttga 5520
ggttcttctg ttggcttctg tagctgctgg agaagtagac gctggacagg accggcccgg 5580
tggctacttc tccagctgga ccccggcctg gccctgtccc tggccacacg ctatcggcta 5640
tcctctcccc tctatccttt tcttcacttc gctccgtccc ccacacactg tcactgccag 5700
cctccccttc gcttcgctta gctcgccgtc accatggcga cctccacctt ctctccgcgc 5760
cccgccaccc tcaagcccct gcgggcacgc gccaagcccg ccggcctcca gctccacctc 5820
ctccccttcc cgcgcctccg cgtcgcctgc gccaccgccg ccggggaggc gccgcccgtt 5880
gagcagcggg acgaggtgga gccggcctcc gccgcggcat ccaacgggac tgccgtcaag 5940
gtcgaggcgc ccgccgcgaa gcccgagtcc ccgcccgcgc ccgcgcccgc gcccgcgccg 6000
gtcccggcct tccgcgacgc caggtgggtc aacggcacct gggacctcac caagttcgac 6060
aagggcggcg gcgtcgactg ggacgccgtc atcgacgccg gtgagggctc tgattcctcc 6120
tcctccttcc tagtatctct ctcctatgtg caaccaggat tggattcaca tgctggagcg 6180
ggaattgctg cctgtctgcc atagtgccat cacaatacgt ctgtttggtt ggcttctccc 6240
cgtagcccgg ctgcatcagc catgtcggca gagatgcgag caaatcagag atgcgaacaa 6300
tttgctcgcg catgtgctcg cgcatgcaga gcctggccca ggtgctttaa gtatcgtgct 6360
agcatgactc tacatctata cgcaagtaac caaacacaca tctcgcatgc gtagagtctg 6420
gttgacaaca accaaacacc agcccattgc atctcgcgat gcaagcacca gcaaatacag 6480
gcaaccaaac acatgaaatg ctatcctgga ttggtggatg gctgcggcgt gcgccaccaa 6540
cctgattttt tctgtggttg tagagctttg aaaaagctgg tggttcaaga tgaatttcca 6600
gtttaggatt gggagaaatt aagatgttag ctggcctggt tgggactggg gagatgaata 6660
taagagggaa gatgatgcat gaacgggaag atgagtgaac tggctagaaa aaaaaacagt 6720
cctgcatata caggacacgc aacgcacgtg taaactcaga catttgttgc tttgctacga 6780
tgagtgacag acagacaggc aactgatacc aatagctcca tctttgtttg attccagagg 6840
ccaggagaag gaaatggctc gaagactacc cggaggcgac gagcacagac gatgccgtcg 6900
tcttcgacac ctccattatc ccgtggtggg catggatgaa gcggttccac cttcctgaag 6960
ccgagaagct aaacggttct ctcaccaagc gcctttcttc ttgtcattta taagctaaca 7020
gttgaatacg atgtgttctg ctccacttcg aaaccgctgt gtccagcgtc caggagaaac 7080
caactcttcc cgtctcgtct gatgcgtgca ggtcgcgccg ccatggttgg cttcttcatg 7140
gcctacttcg tggacagctt gacgggcgtg ggcctcgtcg accagatggg caacttcttc 7200
tgcaagacgc tgctgttcgt cgccgtcgcc ggcgtgctgc tggtcaggaa gaacgaggac 7260
gtggagtcgc tcaagaagct catcgacgag actacgtttt acgataggca gtggcaggct 7320
acctggcaag atgaccccac cgaggggcca aagaattagt tccgcgttgg gggtgccaac 7380
gcagaatgct cgcttcttgt ggtgtgtctt gcctatttct tcggcccctt tttgtttcac 7440
cgtttagtca ggcttggagg aactttttga tgatcgtcat aatctatcta tctacgtgat 7500
cttgtgcaaa aacaaaagat atggactcac tttctgtgct ggagataata atcacgttgc 7560
agtttcactg gtttatgctt tcctatcaac acgcgtcaag gtgctcgtcg aagaagactt 7620
tgagcaaatc gcaaataatt tgatgtcaga catggaattc attcacatat tgatcaaaga 7680
aatgccatgt caaggtactc gtcgaagaag attagtctga aaccaaacca acctgtgaga 7740
cacaaagcga aaaagcatgc ctgttgatgg ttaacttttc acgtactact acttgctttg 7800
atctggcatg gaattcaagt caggcatgac acgactgaat aaattacatc caatgacgag 7860
att 7863
<210> 3
<211> 2656
<212> DNA
<213> Zea mays L.
<400> 3
aaaagcactt cgagtactcc acaccacacc agtccagctg tccgcccccg ccacttcgag 60
ttcggttgga ggcgagggga ggcagcgcaa aaccctcctc gtcgtcgcgc gctccgcctg 120
caccacccgc cgccgaagag ctctctttca aaaactagca aagatggtac aatgtactca 180
acctcctccc cagttaaagc tcccagagag taagatcaca gaaccgacag atgatgagaa 240
ccaagatttg ccaccaaaac ctgagaaaag gactaggatg caccacattg agaggcacag 300
atcttgtgtt gtgaccttat ctgacataga acttaatggt ctgcaacctc gtcatctgca 360
ccaacccatt gagatcagcc caggaggatc acagtgttcg ctccatgaag aaacacctac 420
agatactaat gcatcacaca ggcatgcaat tgcagatgct gcttgggaag ccctcaaaag 480
gtcaatagtt tacttcagag gccaaccaat tgggactgtt gccgcaatag ataagtctca 540
gggggcagca ctgaactatg accaggtttt catgagggat ttcattccta gcgcattggc 600
ttttcttatg aaaggagagc acttgattgt gaagaacttt ctggtagaaa ctgcacgcct 660
tcagtcaagg gagaagatgg ttgacctttt caagcttggt cagggtgtga tgcctgcaag 720
ctttaaggta catcatcgca accctaccca gaagacagag agcttactgg ctgattttgg 780
tgaaactgcc attgggaggg ttgctcctgt agattctggc ttatggtgga ttattctcct 840
tcgtgcttac accaaatgga caggggacaa ttctctggct gaaagtacta actgccaaag 900
ggccatgcac cttattctca ggttgtgtct ctcagagggg tgtgatactt ctccagcctt 960
gctttgtgct gatggatgct ccatgataaa ccgaagaatg ggcatatatg gctacccaat 1020
tgaaatccag gctctctttt ttatggctat gagatgcgcc ctgagtctgt tgaaacaaga 1080
gtccgatgct gacttcgtga accacatcac aaaacgaatc caagctctga gctaccactt 1140
gcacagttac tactggttgg acttccagag acttaatgac atataccgct acaagaccga 1200
agagtactca cagacagctc tgaacaagtt caacgtgatg cccgaatcga tacctgactg 1260
gatatttgac ttcatgccta gccgtggtgg gtacttcatt ggcaacgtta gtcccgcgag 1320
gatggatttc cgctggttct gcctaggcaa cttcatcgcg attctgtcgt cgttggctac 1380
cggagagcag gctgaagcga tactggatct tgtggaggag cgctggcaag aactcatcgg 1440
tgagatgccg ctcaagatct gttaccctgc gatggaaaat caggaatggc agatagtcac 1500
tggatgcgac cccaagaaca ccaggtggag ctatcacaac ggaggctcgt ggccagtgct 1560
gttgtggctg ctggtggcgg tgagcgtgaa gctggggcgg ccgcacctgg cgcggagagc 1620
cgtggagctg atggagcagc ggctggccaa ggacgacttc cccgagtact acgacggcaa 1680
ggccgggcgg tgggtcaacg gcacctggga cctcaccaag ttcgacaagg gcggcggcgt 1740
cgactgggac gccgtcatcg acgccgaggc caggagaagg aaatggctcg aagactaccc 1800
ggaggcgacg agcacagacg atgccgtcgt cttcgacacc tccattatcc cgtggtgggc 1860
atggatgaag cggttccacc ttcctgaagc cgagaagcta aacggtcgcg ccgccatggt 1920
tggcttcttc atggcctact tcgtggacag cttgacgggc gtgggcctcg tcgaccagat 1980
gggcaacttc ttctgcaaga cgctgctgtt cgtcgccgtc gccggcgtgc tgctggtcag 2040
gaagaacgag gacgtggagt cgctcaagaa gctcatcgac gagactacgt tttacgatag 2100
gcagtggcag gctacctggc aagatgaccc caccgagggg ccaaagaatt agttccgcgt 2160
tgggggtgcc aacgcagaat gctcgcttct tgtggtgtgt cttgcctatt tcttcggccc 2220
ctttttgttt caccgtttag tcaggcttgg aggaactttt tgatgatcgt cataatctat 2280
ctatctacgt gatcttgtgc aaaaacaaaa gatatggact cactttctgt gctggagata 2340
ataatcacgt tgcagtttca ctggtttatg ctttcctatc aacacgcgtc aaggtgctcg 2400
tcgaagaaga ctttgagcaa atcgcaaata atttgatgtc agacatggaa ttcattcaca 2460
tattgatcaa agaaatgcca tgtcaaggta ctcgtcgaag aagattagtc tgaaaccaaa 2520
ccaacctgtg agacacaaag cgaaaaagca tgcctgttga tggttaactt ttcacgtact 2580
actacttgct ttgatctggc atggaattca agtcaggcat gacacgactg aataaattac 2640
atccaatgac gagatt 2656
<210> 4
<211> 1689
<212> DNA
<213> Zea mays L.
<400> 4
atggtacaat gtactcaacc tcctccccag ttaaagctcc cagagagtaa gatcacagaa 60
ccgacagatg atgagaacca agatttgcca ccaaaacctg agaaaaggac taggatgcac 120
cacattgaga ggcacagatc ttgtgttgtg accttatctg acatagaact taatggtctg 180
caacctcgtc atctgcacca acccattgag atcagcccag gaggatcaca gtgttcgctc 240
catgaagaaa cacctacaga tactaatgca tcacacaggc atgcaattgc agatgctgct 300
tgggaagccc tcaaaaggtc aatagtttac ttcagaggcc aaccaattgg gactgttgcc 360
gcaatagata agtctcaggg ggcagcactg aactatgacc aggttttcat gagggatttc 420
attcctagcg cattggcttt tcttatgaaa ggagagcact tgattgtgaa gaactttctg 480
gtagaaactg cacgccttca gtcaagggag aagatggttg accttttcaa gcttggtcag 540
ggtgtgatgc ctgcaagctt taaggtacat catcgcaacc ctacccagaa gacagagagc 600
ttactggctg attttggtga aactgccatt gggagggttg ctcctgtaga ttctggctta 660
tggtggatta ttctccttcg tgcttacacc aaatggacag gggacaattc tctggctgaa 720
agtactaact gccaaagggc catgcacctt attctcaggt tgtgtctctc agaggggtgt 780
gatacttctc cagccttgct ttgtgctgat ggatgctcca tgataaaccg aagaatgggc 840
atatatggct acccaattga aatccaggct ctctttttta tggctatgag atgcgccctg 900
agtctgttga aacaagagtc cgatgctgac ttcgtgaacc acatcacaaa acgaatccaa 960
gctctgagct accacttgca cagttactac tggttggact tccagagact taatgacata 1020
taccgctaca agaccgaaga gtactcacag acagctctga acaagttcaa cgtgatgccc 1080
gaatcgatac ctgactggat atttgacttc atgcctagcc gtggtgggta cttcattggc 1140
aacgttagtc ccgcgaggat ggatttccgc tggttctgcc taggcaactt catcgcgatt 1200
ctgtcgtcgt tggctaccgg agagcaggct gaagcgatac tggatcttgt ggaggagcgc 1260
tggcaagaac tcatcggtga gatgccgctc aagatctgtt accctgcgat ggaaaatcag 1320
gaatggcaga tagtcactgg atgcgacccc aagaacacca ggtggagcta tcacaacgga 1380
ggctcgtggc cagtgctgtt gtggctgctg gtggcggtga gcgtgaagct ggggcggccg 1440
cacctggcgc ggagagccgt ggagctgatg gagcagcggc tggccaagga cgacttcccc 1500
gagtactacg acggcaaggc cgggcggtac gtggggaagc aggcgcgcaa gttccagaca 1560
tggtccgtgg ccggctacct ggtggccaag atgctcctgg acgacccctc ccacctgcgg 1620
atcgtggcgc tggagggcga cagccactcc agggccccct tcctcaagcg ctccaactcg 1680
tgcccatga 1689
<210> 5
<211> 562
<212> PRT
<213> Zea mays L.
<400> 5
Met Val Gln Cys Thr Gln Pro Pro Pro Gln Leu Lys Leu Pro Glu Ser
1 5 10 15
Lys Ile Thr Glu Pro Thr Asp Asp Glu Asn Gln Asp Leu Pro Pro Lys
20 25 30
Pro Glu Lys Arg Thr Arg Met His His Ile Glu Arg His Arg Ser Cys
35 40 45
Val Val Thr Leu Ser Asp Ile Glu Leu Asn Gly Leu Gln Pro Arg His
50 55 60
Leu His Gln Pro Ile Glu Ile Ser Pro Gly Gly Ser Gln Cys Ser Leu
65 70 75 80
His Glu Glu Thr Pro Thr Asp Thr Asn Ala Ser His Arg His Ala Ile
85 90 95
Ala Asp Ala Ala Trp Glu Ala Leu Lys Arg Ser Ile Val Tyr Phe Arg
100 105 110
Gly Gln Pro Ile Gly Thr Val Ala Ala Ile Asp Lys Ser Gln Gly Ala
115 120 125
Ala Leu Asn Tyr Asp Gln Val Phe Met Arg Asp Phe Ile Pro Ser Ala
130 135 140
Leu Ala Phe Leu Met Lys Gly Glu His Leu Ile Val Lys Asn Phe Leu
145 150 155 160
Val Glu Thr Ala Arg Leu Gln Ser Arg Glu Lys Met Val Asp Leu Phe
165 170 175
Lys Leu Gly Gln Gly Val Met Pro Ala Ser Phe Lys Val His His Arg
180 185 190
Asn Pro Thr Gln Lys Thr Glu Ser Leu Leu Ala Asp Phe Gly Glu Thr
195 200 205
Ala Ile Gly Arg Val Ala Pro Val Asp Ser Gly Leu Trp Trp Ile Ile
210 215 220
Leu Leu Arg Ala Tyr Thr Lys Trp Thr Gly Asp Asn Ser Leu Ala Glu
225 230 235 240
Ser Thr Asn Cys Gln Arg Ala Met His Leu Ile Leu Arg Leu Cys Leu
245 250 255
Ser Glu Gly Cys Asp Thr Ser Pro Ala Leu Leu Cys Ala Asp Gly Cys
260 265 270
Ser Met Ile Asp Arg Arg Met Gly Ile Tyr Gly Tyr Pro Ile Glu Ile
275 280 285
Gln Ala Leu Phe Phe Met Ala Met Arg Cys Ala Leu Ser Leu Leu Lys
290 295 300
Gln Glu Ser Asp Ala Asp Phe Val Asn His Ile Thr Lys Arg Ile Gln
305 310 315 320
Ala Leu Ser Tyr His Leu His Ser Tyr Tyr Trp Leu Asp Phe Gln Arg
325 330 335
Leu Asn Asp Ile Tyr Arg Tyr Lys Thr Glu Glu Tyr Ser Gln Thr Ala
340 345 350
Leu Asn Lys Phe Asn Val Met Pro Glu Ser Ile Pro Asp Trp Ile Phe
355 360 365
Asp Phe Met Pro Ser Arg Gly Gly Tyr Phe Ile Gly Asn Val Ser Pro
370 375 380
Ala Arg Met Asp Phe Arg Trp Phe Cys Leu Gly Asn Phe Ile Ala Ile
385 390 395 400
Leu Ser Ser Leu Ala Thr Gly Glu Gln Ala Glu Ala Ile Leu Asp Leu
405 410 415
Val Glu Glu Arg Trp Gln Glu Leu Ile Gly Glu Met Pro Leu Lys Ile
420 425 430
Cys Tyr Pro Ala Met Glu Asn Gln Glu Trp Gln Ile Val Thr Gly Cys
435 440 445
Asp Pro Lys Asn Thr Arg Trp Ser Tyr His Asn Gly Gly Ser Trp Pro
450 455 460
Val Leu Leu Trp Leu Leu Val Ala Val Ser Val Lys Leu Gly Arg Pro
465 470 475 480
His Leu Ala Arg Arg Ala Val Glu Leu Met Glu Gln Arg Leu Ala Lys
485 490 495
Asp Asp Phe Pro Glu Tyr Tyr Asp Gly Lys Ala Gly Arg Tyr Val Gly
500 505 510
Lys Gln Ala Arg Lys Phe Gln Thr Trp Ser Val Ala Gly Tyr Leu Val
515 520 525
Ala Lys Met Leu Leu Asp Asp Pro Ser His Leu Arg Ile Val Ala Leu
530 535 540
Glu Gly Asp Ser His Ser Arg Ala Pro Phe Leu Lys Arg Ser Asn Ser
545 550 555 560
Cys Pro
<210> 6
<211> 7863
<212> DNA
<213> Zea mays L.
<400> 6
aaaagcactt cgagtactcc acaccacacc agtccagctg tccgcccccg ccacttcgag 60
ttcggttgga ggcttggagg cttggagcac aagagcaaag gcgaggggag gcagcgcaaa 120
accctcctcg tcgtcgcgcg ctccgcctgc accacccgcc gccgaaggta agccccccca 180
cccttcccac cgcctcttca ccctccccct ctttctctcg cgcgcgcccg cgtccgcgca 240
atggcctctg cgatgcttct atttccaagc gcgctaacga tgaaaaaccc aaagtctcca 300
tgccgtcccg ccggtcgccc ccgtggggaa gcggatcgct ggggaatgtg ggtttgctcg 360
ctcttctatc cggcgatcgg ggccgcgccc cgcgcggagg gtgtttcgcc tctggatttc 420
ggcttcgccg gatctgatcg gggttttggc ggggttttcc gttgggtggt ggccacgcgt 480
gcatggtgct tttgtgcgtc cgaagttact ttgcagccca aagccccaaa ccatgcgcgg 540
cgtggtccgg tgttcggttc cagtggaagc ggaaatgccc ttttgctcgt tgctttctca 600
agttctctag atcgactaga ctggcgacgc agtttttgta gggtcctgtt ttctgacgat 660
cgatgcatgt gtcatgtgtg tgcttctcta tgtgttctgc cgaatctgtt agctctgccg 720
actggacaac gacaggtggc tgccaccttg catcccattc actgaacagc atgttattta 780
ctagttcatg gatttgcagc cagacctttg cttactgtga ttgtttatac tcgtggtctg 840
atttctggtg tctctgatgg gaggatcgtt tattcttatg gcctgcatcg tagtactttc 900
tgtgatttcc ttactttcca gacttgtagc tgtacgtatt gttagtgggt cggaggaaac 960
atggttcagt gctctgggag ttcttactat ttttatgtca ctgaattttg atgcatcaat 1020
aaaaccttta agaatatgtc agcttgatcc tccatgtttt caagacagct gcaacatttt 1080
tttttggatt agtggtactt tgatttcgta caggttatgc tgcataagga tatttattta 1140
gttaaaagca aattccaagt atagataaat gggattaacg tgcagcagat ttattgaaac 1200
ttagtgttaa gtgttaacgt cgtacgtttg tgccattgca tgtgatagtt tatataccgt 1260
tgcttcctat tccgctaaat gaggcgggct ctttggctgc aactgcaatg cctaaaacct 1320
aatcatggct gtgcttctgc cttcgaaacc tgaatatatc taagtttacc actctcattc 1380
tcattctttt ttcttgtact tgtacatcct tattaaccta gtcctggttg tgcgtcacct 1440
acactacagc ctgacctcac atcatttatg agttttcact ggtgaaattt tgcttcatcc 1500
gatcttacca ggtttggagt ggagatttct gagggtttca attgcatggt gatgagggtt 1560
actttctaaa gtgctaggtc cactagattg gtgcaacagt tttgggcccg gaagttgtat 1620
agtcttcagt gaatggtcat tatttactga ataggaataa tttgtagtta gtagtctcca 1680
tttgccattg aaatctgaga gtatgctcaa gaattaagag tactgcagta gcatgttgta 1740
tcagcttcag caaccttaag gaaacaataa attgtattga cttaagtgtt cgatgtgaga 1800
aaagtattat acatatcata tttatagaat atacacatgt tgcagtacat agttcttttt 1860
tgcatgaact tcctttcttt caggcatagg tggccaggtg ctgccccatt gtagtttaat 1920
ttaattgtag ttcaggaaaa acggaaatca gtcaaggctt agttaaaata gatcttaaag 1980
tttttacttg tccctatttt cttttgccta aaccttatgt gtctgttgtg ctttctattt 2040
atttcaatag aaatgttcat gatgtggaaa atgttcattg cgatgccaag agctagcaat 2100
gcaaaatatg caactaacaa acagttcttt tatatgtttc ggggcatgag aacttaatgc 2160
agttttgtat aatgccctga ttttgaaatt ttgaaacatg taagcatatg cttattcttt 2220
ttatttgtcg ttctattgac cagagctctc tttcaaaaac tagcaaagat ggtacaatgt 2280
actcaacctc ctccccagtt aaagctccca gagagtaaga tcacagaacc gacagatgat 2340
gagaaccaag atttgccacc aaaacctgag aaaaggacta ggatgcacca cattgagagg 2400
cacagatctt gtgttgtgac cttatctgac atagaactta atggtctgca acctcgtcat 2460
ctgcaccaac ccattgagat cagcccagga ggatcacagt gttcgctcca tgaagaaaca 2520
cctacagata ctaatgcatc acacaggcat gcaattgcag atgctgcttg ggaagccctc 2580
aaaaggtcaa tagtttactt cagaggccaa ccaattggga ctgttgccgc aatagataag 2640
tctcaggggg cagcactgaa ctatgaccag gtgacctact gaccttttcc gtttccagtc 2700
gaagtgttgg cacttggcag tgctgccaac tttaaaaatt tcatgctatt tttatattat 2760
tcaatacacc cttctattac tatttgtttt gcgtctatcg ttatcgtaaa tggcagttct 2820
aatcctgatg gtgagtattc atgtgtacat tattgcattc ctgcaaaaat acatcttagt 2880
tatctcatgc atgaattata cttgtgcctg tgcatgcaaa aatacattat aattatacat 2940
tggtacaggt tttcatgagg gatttcattc ctagcgcatt ggcttttctt atgaaaggag 3000
agcacttgat tgtgaagaac tttctggtag aaactgcacg ccttcagtca agggagaaga 3060
tggttgacct tttcaagctt ggtcagggtg tgatgcctgc aagctttaag gtacatcatc 3120
gcaaccctac ccagaagaca gagagcttac tggctgattt tggtgaaact gccattggga 3180
gggttgctcc tgtagattct ggcttatggt ggattattct ccttcgtgct tacaccaaat 3240
ggacagggga caattctctg gctgaaagta ctaactgcca aagggccatg caccttattc 3300
tcaggttgtg tctctcagag gggtgtgata cttctccagc cttgctttgt gctgatggat 3360
gctccatgat agaccgaaga atggtaggct gcccacctca ttccagctac ttgtgttttc 3420
ttattatgtt tgactttgta tctcttgcaa gtcccatctc attcataact gaaactgctt 3480
tagctcatat atatatggaa atatataaat acttcggata tttttctttc tgggttctat 3540
aggagaaacc atttatagga tgctgttgta ggcttgtagc tattaaaaat caggaccaaa 3600
gacttggaac ataagaggat tgtgaacatt aataatggtt caatgtatgg gttttggaaa 3660
catacgtgaa gtatgtcgtt gtgatttgtg gataacagca tagattgctt tgctgttagc 3720
gaacactttg tcaaacttct taatcttctc tatctctatg caagtgttag tttcttttag 3780
tttgatcgtg ttctttgtct tattgaagta ttgttaattc ccagtggttg tgcttcctgt 3840
agactacata ttcatctcgt ggaaaaccta gaaaatttac caaccatttt gacgcttttc 3900
gtcctgggaa cagcaagtta tctaaatgct tgtcttgaac gtttgtacat gtttatcatg 3960
caccttgttt atcgaactgt tgactgaaat ctgtgcaggg catatatggc tacccaattg 4020
aaatccaggc tctctttttt atggctatga gatgcgccct gagtctgttg aaacaagagt 4080
ccgatgctga cttcgtgaac cacatcacaa aacgaatcca agctctgagc taccacttgc 4140
acagttacta ctggttggac ttccagagac ttaatgacat ataccgctac aagaccgaag 4200
agtactcaca gacagctctg aacaagttca acgtgatgcc cgaatcgata cctgactgga 4260
tatttgactt catgcctagc cgtggtgggt acttcattgg caacgttagt cccgcgagga 4320
tggatttccg ctggttctgc ctaggcaact tcatcgcgat tctgtcgtcg ttggctaccg 4380
gagagcaggc tgaagcgata ctggatcttg tggaggagcg ctggcaagaa ctcatcggtg 4440
agatgccgct caagatctgt taccctgcga tggaaaatca ggaatggcag atagtcactg 4500
gatgcgaccc caagaacacc aggtggagct atcacaacgg aggctcgtgg ccaggtgagt 4560
tccatttgtt atctatcact gcaaaactgc attatgtaac acttgttgct agcgtggtca 4620
tactccagct agttgtcttg tttttatgtt cttgaacctc tctgtattta tttccgttgt 4680
aatgttaatg gaaatggggt cagcctcgat tccgaaaaga aaattggtaa tatgtgtgca 4740
tcctccactc tgcatcagca tccattttag ttcttatctg ttttgacccc ccggaccccg 4800
gtcggtgcaa atattatgtt ggtcatgcat gcagtgctgt tgtggctgct ggtggcggtg 4860
agcgtgaagc tggggcggcc gcacctggcg cggagagccg tggagctgat ggagcagcgg 4920
ctggccaagg acgacttccc cgagtactac gacggcaagg ccgggcggta cgtggggaag 4980
caggcgcgca agttccagac atggtccgtg gccggctacc tggtggccaa gatgctcctg 5040
gacgacccct cccacctgcg gatcgtggcg ctggagggcg acagccactc cagggccccc 5100
ttcctcaagc gctccaactc gtgcccatga gtccatgacc cccaggcccc agcacagcac 5160
aggccgcatg cattaccttt ccacgcacca gtttgcccac accgagacta cgagagtaaa 5220
aagtttcgtt tcgatgcagt gcattcttct tactacataa gtataatcaa gcagtagtag 5280
tgtgatgtgc taccaagagg aggatgacag ggacaggata ccgagtatgt atgtactgtc 5340
tccatttgcc agatcagatg ctggttaaca ttttggaatg tcaggggctc acggctagca 5400
atgcgtctgg tagctgagga aatgtaaaaa ctccatgtgc tgatatactg tttcttagac 5460
ctgatgtcat gcggtcctgg tgctgataaa aagctattga tattcaccat cttcagttga 5520
ggttcttctg ttggcttctg tagctgctgg agaagtagac gctggacagg accggcccgg 5580
tggctacttc tccagctgga ccccggcctg gccctgtccc tggccacacg ctatcggcta 5640
tcctctcccc tctatccttt tcttcacttc gctccgtccc ccacacactg tcactgccag 5700
cctccccttc gcttcgctta gctcgccgtc accatggcga cctccacctt ctctccgcgc 5760
cccgccaccc tcaagcccct gcgggcacgc gccaagcccg ccggcctcca gctccacctc 5820
ctccccttcc cgcgcctccg cgtcgcctgc gccaccgccg ccggggaggc gccgcccgtt 5880
gagcagcggg acgaggtgga gccggcctcc gccgcggcat ccaacgggac tgccgtcaag 5940
gtcgaggcgc ccgccgcgaa gcccgagtcc ccgcccgcgc ccgcgcccgc gcccgcgccg 6000
gtcccggcct tccgcgacgc caggtgggtc aacggcacct gggacctcac caagttcgac 6060
aagggcggcg gcgtcgactg ggacgccgtc atcgacgccg gtgagggctc tgattcctcc 6120
tcctccttcc tagtatctct ctcctatgtg caaccaggat tggattcaca tgctggagcg 6180
ggaattgctg cctgtctgcc atagtgccat cacaatacgt ctgtttggtt ggcttctccc 6240
cgtagcccgg ctgcatcagc catgtcggca gagatgcgag caaatcagag atgcgaacaa 6300
tttgctcgcg catgtgctcg cgcatgcaga gcctggccca ggtgctttaa gtatcgtgct 6360
agcatgactc tacatctata cgcaagtaac caaacacaca tctcgcatgc gtagagtctg 6420
gttgacaaca accaaacacc agcccattgc atctcgcgat gcaagcacca gcaaatacag 6480
gcaaccaaac acatgaaatg ctatcctgga ttggtggatg gctgcggcgt gcgccaccaa 6540
cctgattttt tctgtggttg tagagctttg aaaaagctgg tggttcaaga tgaatttcca 6600
gtttaggatt gggagaaatt aagatgttag ctggcctggt tgggactggg gagatgaata 6660
taagagggaa gatgatgcat gaacgggaag atgagtgaac tggctagaaa aaaaaacagt 6720
cctgcatata caggacacgc aacgcacgtg taaactcaga catttgttgc tttgctacga 6780
tgagtgacag acagacaggc aactgatacc aatagctcca tctttgtttg attccagagg 6840
ccaggagaag gaaatggctc gaagactacc cggaggcgac gagcacagac gatgccgtcg 6900
tcttcgacac ctccattatc ccgtggtggg catggatgaa gcggttccac cttcctgaag 6960
ccgagaagct aaacggttct ctcaccaagc gcctttcttc ttgtcattta taagctaaca 7020
gttgaatacg atgtgttctg ctccacttcg aaaccgctgt gtccagcgtc caggagaaac 7080
caactcttcc cgtctcgtct gatgcgtgca ggtcgcgccg ccatggttgg cttcttcatg 7140
gcctacttcg tggacagctt gacgggcgtg ggcctcgtcg accagatggg caacttcttc 7200
tgcaagacgc tgctgttcgt cgccgtcgcc ggcgtgctgc tggtcaggaa gaacgaggac 7260
gtggagtcgc tcaagaagct catcgacgag actacgtttt acgataggca gtggcaggct 7320
acctggcaag atgaccccac cgaggggcca aagaattagt tccgcgttgg gggtgccaac 7380
gcagaatgct cgcttcttgt ggtgtgtctt gcctatttct tcggcccctt tttgtttcac 7440
cgtttagtca ggcttggagg aactttttga tgatcgtcat aatctatcta tctacgtgat 7500
cttgtgcaaa aacaaaagat atggactcac tttctgtgct ggagataata atcacgttgc 7560
agtttcactg gtttatgctt tcctatcaac acgcgtcaag gtgctcgtcg aagaagactt 7620
tgagcaaatc gcaaataatt tgatgtcaga catggaattc attcacatat tgatcaaaga 7680
aatgccatgt caaggtactc gtcgaagaag attagtctga aaccaaacca acctgtgaga 7740
cacaaagcga aaaagcatgc ctgttgatgg ttaacttttc acgtactact acttgctttg 7800
atctggcatg gaattcaagt caggcatgac acgactgaat aaattacatc caatgacgag 7860
att 7863
<210> 7
<211> 2656
<212> DNA
<213> Zea mays L.
<400> 7
aaaagcactt cgagtactcc acaccacacc agtccagctg tccgcccccg ccacttcgag 60
ttcggttgga ggcgagggga ggcagcgcaa aaccctcctc gtcgtcgcgc gctccgcctg 120
caccacccgc cgccgaagag ctctctttca aaaactagca aagatggtac aatgtactca 180
acctcctccc cagttaaagc tcccagagag taagatcaca gaaccgacag atgatgagaa 240
ccaagatttg ccaccaaaac ctgagaaaag gactaggatg caccacattg agaggcacag 300
atcttgtgtt gtgaccttat ctgacataga acttaatggt ctgcaacctc gtcatctgca 360
ccaacccatt gagatcagcc caggaggatc acagtgttcg ctccatgaag aaacacctac 420
agatactaat gcatcacaca ggcatgcaat tgcagatgct gcttgggaag ccctcaaaag 480
gtcaatagtt tacttcagag gccaaccaat tgggactgtt gccgcaatag ataagtctca 540
gggggcagca ctgaactatg accaggtttt catgagggat ttcattccta gcgcattggc 600
ttttcttatg aaaggagagc acttgattgt gaagaacttt ctggtagaaa ctgcacgcct 660
tcagtcaagg gagaagatgg ttgacctttt caagcttggt cagggtgtga tgcctgcaag 720
ctttaaggta catcatcgca accctaccca gaagacagag agcttactgg ctgattttgg 780
tgaaactgcc attgggaggg ttgctcctgt agattctggc ttatggtgga ttattctcct 840
tcgtgcttac accaaatgga caggggacaa ttctctggct gaaagtacta actgccaaag 900
ggccatgcac cttattctca ggttgtgtct ctcagagggg tgtgatactt ctccagcctt 960
gctttgtgct gatggatgct ccatgataga ccgaagaatg ggcatatatg gctacccaat 1020
tgaaatccag gctctctttt ttatggctat gagatgcgcc ctgagtctgt tgaaacaaga 1080
gtccgatgct gacttcgtga accacatcac aaaacgaatc caagctctga gctaccactt 1140
gcacagttac tactggttgg acttccagag acttaatgac atataccgct acaagaccga 1200
agagtactca cagacagctc tgaacaagtt caacgtgatg cccgaatcga tacctgactg 1260
gatatttgac ttcatgccta gccgtggtgg gtacttcatt ggcaacgtta gtcccgcgag 1320
gatggatttc cgctggttct gcctaggcaa cttcatcgcg attctgtcgt cgttggctac 1380
cggagagcag gctgaagcga tactggatct tgtggaggag cgctggcaag aactcatcgg 1440
tgagatgccg ctcaagatct gttaccctgc gatggaaaat caggaatggc agatagtcac 1500
tggatgcgac cccaagaaca ccaggtggag ctatcacaac ggaggctcgt ggccagtgct 1560
gttgtggctg ctggtggcgg tgagcgtgaa gctggggcgg ccgcacctgg cgcggagagc 1620
cgtggagctg atggagcagc ggctggccaa ggacgacttc cccgagtact acgacggcaa 1680
ggccgggcgg tgggtcaacg gcacctggga cctcaccaag ttcgacaagg gcggcggcgt 1740
cgactgggac gccgtcatcg acgccgaggc caggagaagg aaatggctcg aagactaccc 1800
ggaggcgacg agcacagacg atgccgtcgt cttcgacacc tccattatcc cgtggtgggc 1860
atggatgaag cggttccacc ttcctgaagc cgagaagcta aacggtcgcg ccgccatggt 1920
tggcttcttc atggcctact tcgtggacag cttgacgggc gtgggcctcg tcgaccagat 1980
gggcaacttc ttctgcaaga cgctgctgtt cgtcgccgtc gccggcgtgc tgctggtcag 2040
gaagaacgag gacgtggagt cgctcaagaa gctcatcgac gagactacgt tttacgatag 2100
gcagtggcag gctacctggc aagatgaccc caccgagggg ccaaagaatt agttccgcgt 2160
tgggggtgcc aacgcagaat gctcgcttct tgtggtgtgt cttgcctatt tcttcggccc 2220
ctttttgttt caccgtttag tcaggcttgg aggaactttt tgatgatcgt cataatctat 2280
ctatctacgt gatcttgtgc aaaaacaaaa gatatggact cactttctgt gctggagata 2340
ataatcacgt tgcagtttca ctggtttatg ctttcctatc aacacgcgtc aaggtgctcg 2400
tcgaagaaga ctttgagcaa atcgcaaata atttgatgtc agacatggaa ttcattcaca 2460
tattgatcaa agaaatgcca tgtcaaggta ctcgtcgaag aagattagtc tgaaaccaaa 2520
ccaacctgtg agacacaaag cgaaaaagca tgcctgttga tggttaactt ttcacgtact 2580
actacttgct ttgatctggc atggaattca agtcaggcat gacacgactg aataaattac 2640
atccaatgac gagatt 2656
<210> 8
<211> 1689
<212> DNA
<213> Zea mays L.
<400> 8
atggtacaat gtactcaacc tcctccccag ttaaagctcc cagagagtaa gatcacagaa 60
ccgacagatg atgagaacca agatttgcca ccaaaacctg agaaaaggac taggatgcac 120
cacattgaga ggcacagatc ttgtgttgtg accttatctg acatagaact taatggtctg 180
caacctcgtc atctgcacca acccattgag atcagcccag gaggatcaca gtgttcgctc 240
catgaagaaa cacctacaga tactaatgca tcacacaggc atgcaattgc agatgctgct 300
tgggaagccc tcaaaaggtc aatagtttac ttcagaggcc aaccaattgg gactgttgcc 360
gcaatagata agtctcaggg ggcagcactg aactatgacc aggttttcat gagggatttc 420
attcctagcg cattggcttt tcttatgaaa ggagagcact tgattgtgaa gaactttctg 480
gtagaaactg cacgccttca gtcaagggag aagatggttg accttttcaa gcttggtcag 540
ggtgtgatgc ctgcaagctt taaggtacat catcgcaacc ctacccagaa gacagagagc 600
ttactggctg attttggtga aactgccatt gggagggttg ctcctgtaga ttctggctta 660
tggtggatta ttctccttcg tgcttacacc aaatggacag gggacaattc tctggctgaa 720
agtactaact gccaaagggc catgcacctt attctcaggt tgtgtctctc agaggggtgt 780
gatacttctc cagccttgct ttgtgctgat ggatgctcca tgatagaccg aagaatgggc 840
atatatggct acccaattga aatccaggct ctctttttta tggctatgag atgcgccctg 900
agtctgttga aacaagagtc cgatgctgac ttcgtgaacc acatcacaaa acgaatccaa 960
gctctgagct accacttgca cagttactac tggttggact tccagagact taatgacata 1020
taccgctaca agaccgaaga gtactcacag acagctctga acaagttcaa cgtgatgccc 1080
gaatcgatac ctgactggat atttgacttc atgcctagcc gtggtgggta cttcattggc 1140
aacgttagtc ccgcgaggat ggatttccgc tggttctgcc taggcaactt catcgcgatt 1200
ctgtcgtcgt tggctaccgg agagcaggct gaagcgatac tggatcttgt ggaggagcgc 1260
tggcaagaac tcatcggtga gatgccgctc aagatctgtt accctgcgat ggaaaatcag 1320
gaatggcaga tagtcactgg atgcgacccc aagaacacca ggtggagcta tcacaacgga 1380
ggctcgtggc cagtgctgtt gtggctgctg gtggcggtga gcgtgaagct ggggcggccg 1440
cacctggcgc ggagagccgt ggagctgatg gagcagcggc tggccaagga cgacttcccc 1500
gagtactacg acggcaaggc cgggcggtac gtggggaagc aggcgcgcaa gttccagaca 1560
tggtccgtgg ccggctacct ggtggccaag atgctcctgg acgacccctc ccacctgcgg 1620
atcgtggcgc tggagggcga cagccactcc agggccccct tcctcaagcg ctccaactcg 1680
tgcccatga 1689
<210> 9
<211> 2875
<212> DNA
<213> Zea mays L.
<400> 9
ttaagaacca aacggcatcc cgtctagtat tcgcgcatac acatcgtgtc ggtttacaat 60
gatcaacaat tatgctatag ggctactgaa taatataatt tcccttaaat tttttggtat 120
ttctagatat atagttttta ttatatactt agggtttgtt tagttagttg tctaagttgt 180
cacaatctgt ccaacttttt gtatctaagg ttaattcttc aatttaatca actaaactta 240
agcaaattgt gatacagtta gccaagaacc aaacatactc ttaaacatac tcttagatat 300
acactacata aaaatataat attttttact atatatatac acaagtaaaa atattttatg 360
atatgaaaca gaggagtaca taatattttt ctttatgaaa atagtacact atgacatatg 420
gcaagaaggt agaaaaaaca tagtactact ggcaggttag aggtaggaag aaaaggtatc 480
caaaagcctc tcactccacc gcggcccggt ccggcacggc ccacggtccc gaatcgagtt 540
cagggatgca cacaacagta caacacaaat ttgaaataaa aagaaaacga aaaacagcag 600
aaaaagcaaa agcacttcga gtactccaca ccacaccagt ccagctgtcc gcccccgcca 660
cttcgagttc ggttggaggc ttggaggctt ggagcacaag agcaaaggcg aggggaggca 720
gcgcaaaacc ctcctcgtcg tcgcgcgctc cgcctgcacc acccgccgcc gaaggtaagc 780
ccccccaccc ttcccaccgc ctcttcaccc tccccctctt tctctcgcgc gcgcccgcgt 840
ccgcgcaatg gcctctgcga tgcttctatt tccaagcgcg ctaacgatga aaaacccaaa 900
gtctccatgc cgtcccgccg gtcgcccccg tggggaagcg gatcgctggg gaatgtgggt 960
ttgctcgctc ttctatccgg cgatcggggc cgcgccccgc gcggagggtg tttcgcctct 1020
ggatttcggc ttcgccggat ctgatcgggg ttttggcggg gttttccgtt gggtggtggc 1080
cacgcgtgca tggtgctttt gtgcgtccga agttactttg cagcccaaag ccccaaacca 1140
tgcgcggcgt ggtccggtgt tcggttccag tggaagcgga aatgcccttt tgctcgttgc 1200
tttctcaagt tctctagatc gactagactg gcgacgcagt ttttgtaggg tcctgttttc 1260
tgacgatcga tgcatgtgtc atgtgtgtgc ttctctatgt gttctgccga atctgttagc 1320
tctgccgact ggacaacgac aggtggctgc caccttgcat cccattcact gaacagcatg 1380
ttatttacta gttcatggat ttgcagccag acctttgctt actgtgattg tttatactcg 1440
tggtctgatt tctggtgtct ctgatgggag gatcgtttat tcttatggcc tgcatcgtag 1500
tactttctgt gatttcctta ctttccagac ttgtagctgt acgtattgtt agtgggtcgg 1560
aggaaacatg gttcagtgct ctgggagttc ttactatttt tatgtcactg aattttgatg 1620
catcaataaa acctttaaga atatgtcagc ttgatcctcc atgttttcaa gacagctgca 1680
acattttttt ttggattagt ggtactttga tttcgtacag gttatgctgc ataaggatat 1740
ttatttagtt aaaagcaaat tccaagtata gataaatggg attaacgtgc agcagattta 1800
ttgaaactta gtgttaagtg ttaacgtcgt acgtttgtgc cattgcatgt gatagtttat 1860
ataccgttgc ttcctattcc gctaaatgag gcgggctctt tggctgcaac tgcaatgcct 1920
aaaacctaat catggctgtg cttctgcctt cgaaacctga atatatctaa gtttaccact 1980
ctcattctca ttcttttttc ttgtacttgt acatccttat taacctagtc ctggttgtgc 2040
gtcacctaca ctacagcctg acctcacatc atttatgagt tttcactggt gaaattttgc 2100
ttcatccgat cttaccaggt ttggagtgga gatttctgag ggtttcaatt gcatggtgat 2160
gagggttact ttctaaagtg ctaggtccac tagattggtg caacagtttt gggcccggaa 2220
gttgtatagt cttcagtgaa tggtcattat ttactgaata ggaataattt gtagttagta 2280
gtctccattt gccattgaaa tctgagagta tgctcaagaa ttaagagtac tgcagtagca 2340
tgttgtatca gcttcagcaa ccttaaggaa acaataaatt gtattgactt aagtgttcga 2400
tgtgagaaaa gtattataca tatcatattt atagaatata cacatgttgc agtacatagt 2460
tcttttttgc atgaacttcc tttctttcag gcataggtgg ccaggtgctg ccccattgta 2520
gtttaattta attgtagttc aggaaaaacg gaaatcagtc aaggcttagt taaaatagat 2580
cttaaagttt ttacttgtcc ctattttctt ttgcctaaac cttatgtgtc tgttgtgctt 2640
tctatttatt tcaatagaaa tgttcatgat gtggaaaatg ttcattgcga tgccaagagc 2700
tagcaatgca aaatatgcaa ctaacaaaca gttcttttat atgtttcggg gcatgagaac 2760
ttaatgcagt tttgtataat gccctgattt tgaaattttg aaacatgtaa gcatatgctt 2820
attcttttta tttgtcgttc tattgaccag agctctcttt caaaaactag caaag 2875

Claims (10)

1. The protein INVAN6-Mei is W1) or W2) as follows:
w1) is protein shown as a sequence 1 in a sequence table;
w2) is obtained by connecting labels at the N terminal or/and the C terminal of the protein shown in the sequence 1 in the sequence table.
2. A nucleic acid molecule encoding the protein INVAN6-Mei according to claim 1.
3. The nucleic acid molecule of claim 2, wherein: the nucleic acid molecule is any one of the following d5) -d 8):
d5) the coding region is a DNA molecule shown as a sequence 4 in a sequence table;
d6) the nucleotide sequence is a DNA molecule shown in a sequence 2 in a sequence table;
d7) the nucleotide sequence is a DNA molecule shown in a sequence 3 in a sequence table;
d8) the nucleotide sequence is a DNA molecule shown in a sequence 4 in a sequence table.
4. Use of the protein INVAN6-Mei according to claim 1 or the nucleic acid molecule according to claim 2 or 3 for breeding a maize male sterile line and/or a maize male sterile maintainer line.
5. Use of the protein INVAN6-Mei according to claim 1 or the nucleic acid molecule according to claim 2 or 3 for regulating male fertility in maize.
6. A breeding method of male sterile line of corn is to make male fertile corn express protein INVAN6-Mei to obtain transgenic corn; the transgenic corn is a corn male sterile line;
the protein INVAN6-Mei is e1) or e2) or e3) as follows:
e1) the amino acid sequence is protein shown as a sequence 1 in a sequence table;
e2) a fusion protein obtained by connecting labels to the N end or/and the C end of the protein shown in the sequence 1 in the sequence table;
the male-fertile corn expresses the protein INVAN6-WT and does not express the protein INVAN 6-Mei;
the amino acid sequence of the protein INVAN6-WT is shown as a sequence 5 in a sequence table.
7. A method for predicting male fertility of a maize to be tested, which is S1) or S2) or S3) or S4):
s1) detecting the 276 th amino acid residue type of the maize protein INVAN6 to be detected from the N terminal;
the protein INVAN6 consists of a segment I, a segment II and a segment III from the N end to the C end;
the segment I is polypeptide with an amino acid sequence shown in1 st to 275 th sites from the N terminal of a sequence 1 in a sequence table;
the segment II is 1 amino acid residue, namely 276 th amino acid from the N terminal of the sequence 1 in the sequence table;
the segment III is polypeptide with an amino acid sequence shown as 277 th to 562 th sites from the N terminal of a sequence 1 in a sequence table;
the male fertility of the maize to be tested is fertile, wherein the amino acid residue type at the 276 th position of the protein INVAN6 from the N terminal is only aspartic acid or asparagine;
the male fertility of the maize to be tested, in which the amino acid residue types at the 276 th position from the N terminal of the protein INVAN6 are aspartic acid and asparagine, is sterile;
s2) detecting the 276 th codon nucleotide sequence in the specific transcript of the total RNA of the corn to be detected; the specific transcript is RNA transcribed from a coding gene of the protein INVAN6, and the 1 st codon of the RNA is an initiation codon;
male fertility of the maize to be tested for "the nucleotide sequence of codon 276 of a particular transcript encodes only aspartic acid or asparagine" is fertile;
the male fertility of the maize to be tested for which the nucleotide sequence of codon 276 of the particular transcript encodes aspartic acid and asparagine is sterile;
s3) detecting the 826 th nucleotide species of the encoding gene of the protein INVAN6 from the 5' end in the total DNA of the corn to be detected;
the male fertility of the maize to be tested, in which the 826 th nucleotide type of the coding gene of the protein INVAN6 from the 5' end is G or A, is fertile;
the male fertility of the maize to be tested with the 826 th nucleotide types of G and A from the 5' end of the coding gene of the protein INVAN6 is sterile;
s4) detecting whether the total DNA of the corn to be detected has a DNA molecule A and a DNA molecule B; the DNA molecule A is at least one of a DNA molecule shown in a sequence 2 of a sequence table, a DNA molecule shown in a sequence 3 of the sequence table and a DNA molecule shown in a sequence 4 of the sequence table; the DNA molecule B is at least one of a DNA molecule shown in a sequence 6 of a sequence table, a DNA molecule shown in a sequence 7 of the sequence table and a DNA molecule shown in a sequence 8 of the sequence table;
the male fertility of the corn to be detected, which only has the DNA molecule B or the DNA molecule A in the total DNA of the corn to be detected, is fertile;
the male fertility of the corn to be detected with the DNA molecule B and the DNA molecule A in the total DNA of the corn to be detected is sterile.
8, B1) or B2) or B3):
B1) the use of the amino acid residue type 276 from the N-terminal of the protein INVAN6 according to claim 7 as a test object for predicting male fertility of maize to be tested;
B2) the application of the nucleotide sequence of 276 th codon in the specific transcript as a detection object in predicting male fertility of the maize to be detected; the specific transcript is RNA transcribed from a gene coding for the protein INVAN6 in claim 7, wherein the 1 st codon is an initiation codon;
B3) use of the 862 nd nucleotide of the gene coding for the protein INVAN6 in claim 7 from the 5' end as a test object for predicting male fertility of maize to be tested.
9, a1) or a2) or A3):
A1) the application of the specific DNA molecule as a specific promoter of the maize pollen mother cell;
A2) the application of specific DNA molecule as promoter;
A3) the application of the specific DNA molecule in starting the expression of a target gene;
the nucleotide sequence of the specific DNA molecule is shown as a sequence 9 in a sequence table.
10. A method for expressing a gene of interest, method a, method B or method C;
the method A is to take specific DNA molecules as a specific promoter of maize pollen mother cells to start the expression of target genes;
the method B is to take a specific DNA molecule as a promoter to start the expression of a target gene;
the method C comprises the following steps: inserting said specific DNA molecule upstream of any gene or enhancer of interest to thereby initiate expression of the gene of interest;
the nucleotide sequence of the specific DNA molecule is shown as a sequence 9 in a sequence table.
CN201910387858.0A 2019-05-10 2019-05-10 Protein INVAN6, coding gene thereof and application thereof in breeding male sterile line of corn Active CN111909250B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910387858.0A CN111909250B (en) 2019-05-10 2019-05-10 Protein INVAN6, coding gene thereof and application thereof in breeding male sterile line of corn

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910387858.0A CN111909250B (en) 2019-05-10 2019-05-10 Protein INVAN6, coding gene thereof and application thereof in breeding male sterile line of corn

Publications (2)

Publication Number Publication Date
CN111909250A CN111909250A (en) 2020-11-10
CN111909250B true CN111909250B (en) 2022-08-09

Family

ID=73242851

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910387858.0A Active CN111909250B (en) 2019-05-10 2019-05-10 Protein INVAN6, coding gene thereof and application thereof in breeding male sterile line of corn

Country Status (1)

Country Link
CN (1) CN111909250B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114853857B (en) * 2022-02-25 2024-01-26 中国农业大学 Method for regulating fertility and pollen heat resistance of corn pollen

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102216460A (en) * 2008-09-17 2011-10-12 希尔雷斯股份有限公司 Transgenic plants having increased biomass
CN106749574A (en) * 2016-12-15 2017-05-31 中国科学院遗传与发育生物学研究所 One plant male fertility-associated MS6021 and its encoding gene and application

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101704881B (en) * 2009-10-29 2012-03-14 中国农业科学院作物科学研究所 Plant male fertility-associated protein, coding gene and application thereof
MX2018009863A (en) * 2010-08-30 2022-06-14 Evogene Ltd Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance.
WO2014201156A1 (en) * 2013-06-11 2014-12-18 Florida State University Research Foundation, Inc. Materials and methods for controlling bundle sheath cell fate and function in plants
WO2016127075A2 (en) * 2015-02-06 2016-08-11 New York University Transgenic plants and a transient transformation system for genome-wide transcription factor target discovery
CN106047830B (en) * 2016-06-24 2019-09-27 中国农业大学 Gene M S33 relevant to corn male nuclear sterile and its application in crossbreeding

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102216460A (en) * 2008-09-17 2011-10-12 希尔雷斯股份有限公司 Transgenic plants having increased biomass
CN106749574A (en) * 2016-12-15 2017-05-31 中国科学院遗传与发育生物学研究所 One plant male fertility-associated MS6021 and its encoding gene and application

Also Published As

Publication number Publication date
CN111909250A (en) 2020-11-10

Similar Documents

Publication Publication Date Title
EP3186381B1 (en) Generation of haploid plants
CN106749574B (en) Plant male fertility-related protein MS6021 and coding gene and application thereof
CN105602952B (en) A kind of fertile gene and its application
CN108064297B (en) Wheat fertility-related gene TaMS7 and application method thereof
JP2002526080A (en) Cyclin D polynucleotides and polypeptides and uses thereof
CN107267527A (en) The keeping method of male fertile and its application
CN109207513B (en) Application of DCM1 protein and coding gene thereof in regulation and control of male fertility of plant
CN111333707B (en) Plant grain type related protein and coding gene and application thereof
CN108864266B (en) Protein SSH1 related to rice graininess and grain type as well as encoding gene and application thereof
CN112725374A (en) Method for creating plant haploid induction line and application thereof
CN112457386A (en) Protein EAD1 related to control of ear length and row grain number of corn as well as coding gene and application thereof
CN113490683A (en) Gray spot resistance-related protein ZmWAK-RLK and coding gene and application thereof
CN105695477B (en) Male sterile mutant oss125 and uses thereof
CN110386967B (en) Plant male fertility-related protein SiMS1, and coding gene and application thereof
EP2989889B1 (en) Generation of haploid plants
CN106589085B (en) Plant starch synthesis related protein OsFLO8, and coding gene and application thereof
CN111909250B (en) Protein INVAN6, coding gene thereof and application thereof in breeding male sterile line of corn
CN106749571B (en) Plant starch synthesis related protein OsNPPR and coding gene and application thereof
CN111893122B (en) Gene related to rice leaf color variation, premature senility and stress tolerance, protein coded by gene and application of protein
CN108570474A (en) Rice flower development gene EH1 and its application
CN112680459A (en) Male sterile gene ZmTGA10 and application thereof in creating male sterile line of corn
CN116529376A (en) Fertility-related gene and application thereof in cross breeding
CN109295071B (en) Rice flower organ development regulation gene PEH1, and encoded protein and application thereof
CN113943356B (en) Protein phd11, coding gene thereof and application thereof in breeding of male sterile line of corn
CN107446031B (en) Plant glutelin transport and storage related protein OsVHA-E1, and coding gene and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant