CN102010465A - Brassica campestris aging-related transcription factor and coding gene and application thereof - Google Patents

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly discloses a brassica campestris aging control-related neuro associative conditioning (NAC) family transcription factor and a coding gene and application thereof. The aging-related transcription factor provided by the invention is from 'Xia Dongqing' in brassica campestris varieties, is named BcNAC1, and has an amino acid sequence shown as SEQ ID NO.2. The coding gene of the brassica campestris aging-related transcription factor has a nucleotide sequence shown as SEQ ID NO. 1, or the coding gene is polynucleotide with the amino acid sequence shown as the SEQ ID NO.2. The gene can be used for studying a brassica campestris anti-aging molecular mechanism, improving the delaying of plant aging properties, delaying the aging of brassica campestris laminae, improving the nutritional quality loss of the picked laminae and the like.

Description

Chinese cabbage senescence-associated transcription factor and encoding gene thereof and application

Technical field

The invention belongs to the plant gene engineering technology field, be specifically related to a kind of senescence-associated transcription factor and encoding gene thereof and application, particularly relate to Chinese cabbage senescence-associated transcription factor and encoding gene thereof and application.

Background technology

Plant senescence is meant the process that an organ or whole plants vital functions fail gradually, is physiological a series of deterioration processes before natural death, is the result (Li Qing of long-term evolution and natural selection, Zhu Yuxian, Molecular Plant Breeding, the 1st volume, the 3rd phase, 2003).Research about plant senescence mainly is to concentrate in the research of leaf senile.In the leaf senile process, [Gepstein S, Genome Biology, 5 (3): 212,2004 all take place much to change in cellularstructure, Physiological and Biochemical Metabolism and gene expression regulation etc.; Chandlee JM, Physiologia Plantarum, 113:1-8,2001; Nam HG, Trends Plant Sci, 8 (6): 272-277,2003)].At physiology, biological chemistry and molecular biology aspect have many [Yoshida S. Current Opinion in Plant Biology, 6:79-84,2003 reported about leaf senile; Larry et al, Physiol Plant, 101:746-753,1997; Nam HG, Curr Opin Biotech, 8:200-207,1997; Smart CM, New Phytol, 126:419-448,1994; Nam HG, Annu Rev Plant Biol, 58:115-36,2007; Betania et al Trends Plant Sci, 5 (7): 278-282. 2000].

NAC is a peculiar class transcription factor in the higher plant, its name derives from 3 genes finding the nineties in last century: petunia NAM gene, Arabidopis thaliana ATAF1/2 and CUC2 gene [Aida M, et al, Plant Cell, 9 (6): 841 – 857,1997].

The topmost constructional feature of NAC transcription factor is the NAC structural domain that each member's N end contains high conservative, whole N end regions can be divided into 5 subdomains (A, B, C, D, E), wherein subdomain A, C, D high conservative, contain nuclear localization signal (nuclear localization signals in subdomain C, the D sequence, NLS), may appraise and decide relevant [the Kikuchi K of identification of certain cis element on position and the promotor with transcription factor, et al, Mol Gen Genet, 262 (6): 1047 – 1051,2000; Ooka H, et al, DNA Res, 10 (6): 239-247,2003].The E subdomain is in NAP, AtNAC3, ATAF and OsNAC3 subfamily camber conservative [Ooka H, et al, DNA Res, 10 (6): 239-247,2003].C end is that (transcrip tional activation regions TARs), has the diversity of height, and the common feature of this end is the frequency height that some amino acid such as Serine, Threonine, proline(Pro), L-glutamic acid repeat in the transcriptional activation function district.2003, Ooka etc. found 105 NAC transcription factors by full genome analysis in Arabidopis thaliana, then find 75 NAC members in paddy rice.By the aminoacid sequence of NAC structural domain relatively, they are divided into 2 big nations, 3 subtribes (OsNAC3, ATAF, NAM).According in recent years the report, NAC family be divided into again be 5 subtribes (OsNAC3, ATAF, NAM, AtNAC3, NAP).

The NAC transcription factor is at plant apical meristem and floral organ differentiation [Sablowski, et al, Cell, 92 (1): 93-103,1998], lateral root forms (Mitsuda N, et al, Plant Cell, 17 (11): 2993 – 3006,2005), secondary wall thickens [Xie Q, et al, Genes Dev, 14 (23): 3024-3036, biological (Hegedus D, et al, Plant Mol.Biol of specific growth course of plant and opposing such as 2000], 53:383-397,2003) with abiotic stress process (Nogueira FT, Plant Science, 169:93 – 106,2005) all play an important role in, the NAC transcription factor also plays important regulation [GUO YF, GAN S, Plant Journal at senescence process of plant, 46 (4): 601-612,2006].Studies show that the NAC transcription factor is built up in growth and development of plant, device palace, hormone regulation and defence are resisted aspects such as multiple biology and abiotic stress and brought into play important effect.Compared to the transcription factor of MYB class, bZIP class and WRKY class, the correlative study of NAC transcription factor is less.

AtNAP is a kind of transcription factor in the Arabidopis thaliana NAC family.Guo etc. [GUO YF, GAN S, Plant Journal, 46 (4): 601-612,2006] discover, AtNAPIn regulation and control Arabidopis thaliana aging course, play an important role; AtNAPOnly in old and feeble blade, express, and AtNAPExpression amount become positive correlation with the aging degree of blade, variation tendency and old and feeble marker gene SAG12Consistent; The arabidopsis mutant body AtnapNo matter be all to occur leaf senile hysteresis phenotype under the self-sow state or under dark induction state; Induce AtNAPWhen crossing expression, aging phenomenon in advance appears significantly in transfer-gen plant; Further discover paddy rice, string bean NAPAll can the complementary arabidopsis mutant body of allos AtnapStagnant green phenotype, illustrate that the NAP transcription factor plays an important role in the plant senescence in regulation and control.

Chinese cabbage ( Brassica campestrisL. ssp. Chinensis) originate in China, be the vegetables that we the southern people extremely like, for people provide every day healthy required nutritive substances such as vegetable protein, VITAMIN, food fibre, soluble sugar and trace element, be rare health food source.Because the edible part of Chinese cabbage mostly is fresh and tender blade, very easily chlorosis, aging after plucking from plant materials usually causes the loss of the edibility biomass of green vegetables in adopting back transportation, storage, shelf sales process.Meanwhile, nutritive substance in the blade such as vitamins C etc. also run off in the postharvest senescence process fast, even it is more rapid to run off than the green on apparent, the increase of toxic substance content such as simultaneous ammonium nitrite.As seen, the leaf nutrient quality is being adopted the quick bad change in back.Delay the nutrition leak behind the Chinese cabbage picking blade, have great importance for prolonging Chinese cabbage shelf-lives and fresh-keeping nutritious phase.For a long time, the cultivation of Chinese cabbage new variety all is to rely on traditional breeding way basically.Though many proterties have obtained considerable improvement, its limitation is also obvious day by day.Genetic engineering is demonstrating the superiority that hardly matches aspect the improvement Chinese cabbage proterties.

Summary of the invention

The purpose of this invention is to provide a kind of Chinese cabbage NAC family's old and feeble regulation and control associated transcription factor and encoding gene and application.

Chinese cabbage senescence-associated transcription factor provided by the present invention, be protein, or replacement, disappearance or the interpolation of one or several amino-acid residue of the amino acid residue sequence of SEQ ID NO.2 process have identical active by SEQ ID NO.2 deutero-protein with the amino acid residue sequence of SEQ ID NO.2 with SEQ ID NO.2 amino acid residue sequence.

The encoding gene of Chinese cabbage BcNAC1 transcription factor is one of following Nucleotide:

1) dna sequence dna shown in the SEQ ID NO.1;

2) polynucleotide of aminoacid sequence shown in the coding SEQ ID NO.2.

In the sequence table, SEQ ID NO.1 is by 813 based compositions; SEQ ID NO.2 is made up of 270 amino-acid residues.

The present invention also comprises and contains expression carrier of the present invention and clone.

The present invention also comprises the application of said gene in the old and feeble regulatory molecule Mechanism Study of Chinese cabbage, and the application in delaying the plant senescence character improvement, be included in Chinese cabbage and delay leaf senile, improve blade and adopt the application of back nutritional quality in running off.

Description of drawings

Fig. 1 is a BcNAC1 encoding sequence total length amplified production gel electrophoresis spectrum.

Fig. 2 is that the evolutionary tree of BcNAC1 and other plant senescence associated transcription factor is analyzed.

Fig. 3 is BcNAC1 and other plant senescence associated transcription factor sequence homology analysis.

Fig. 4 is dark processing wild-type Arabidopis thaliana in the time of 4 days, Atnap, complementary transfer-gen plant excised leaf phenotype.

Fig. 5 is a wild-type under 35 days the state of normal growth, Atnap, the phenotype of complementary transfer-gen plant.

Embodiment

The acquisition of embodiment 1, Chinese cabbage senescence-associated transcription factor encoding gene.

1.1 RNA extracts

Select for use Chinese cabbage kind " summer Chinese ilex " as material, get the about 0.1g of blade material of the storage yellow of exsomatizing.After liquid nitrogen fully grinds, transfer to the 1.5ml centrifuge tube, add 1ml

(invitrogen company), behind the mixing, room temperature was placed 15 minutes, added the 0.2ml chloroform: primary isoamyl alcohol (24:1), acutely shake after 15 seconds room temperature and placed 5 minutes, 13000rpm, 4 ℃ are centrifugal 15 minutes.Get supernatant liquor and add the equal-volume Virahol, careful mixing, room temperature was placed 15 minutes, 13000rpm, 4 ℃ are centrifugal 15 minutes.70% washing with alcohol precipitation, drying at room temperature 15 minutes.Be dissolved in an amount of in the ddH2O water that 0.1% DEPC handled, be stored in-80 ℃ standby.

1.2 cDNA first chain is synthetic and reverse transcription PCR

Adopt the cDNA first chain synthetic agent box of Shen, Shanghai energy lottery industry biotech company (SHBC), total RNA reverse transcription is become cDNA according to operational guidance.Reaction system and reaction conditions are respectively: total RNA of 2ug preparation, and 0.5ul RNase inhibitor adds deionized water that DEPC handled to 8.5ul, 65 ℃ of the Oligo of 2ul (dT) 18 primer., 5min, room temperature is placed 10min, the brief centrifugal 5s of 13000rpm.Add 4 μ l, 5 * First-Strand buffer more successively, 0.5 μ l RNase Inhibitor, 2 μ l 100mM DTT, 2 μ l dNTP, 1 μ l MMLV Reverse Transcriptase.Careful mixing; 37 ℃ of reverse transcriptions 1 hour, 90 ℃ 5 minutes; Cooled on ice; 13000rpm of short duration centrifugal 5 seconds, deposit in-20 ℃ stand-by

1.3 RT-PCR amplification BcNAC1The encoding sequence total length

According to BcNAC1Gene order has designed two primer BcNAC1F(5'ATGGACATGAATCCCAACAC 3') and BcNAC1R:(5'CTAAAACTGAAACATACTAGC 3') (SEQ ID NO.3) as the primer of PCR reaction.The PCR reaction system is 50ul, and reaction conditions is: 94 ℃ of pre-sex change 5min, and 94 ℃ of sex change 30s, 60 ℃ of renaturation 30s, 72 ℃ are extended 60s, circulate 38 times.72 ℃ are fully extended 10min.The PCR product of gained is separated the segment that obtains one section about 813bp through 1% agarose gel electrophoresis.After reclaiming and being cloned into TAKARA pMD-19-T carrier,, obtain by the order-checking of Shanghai Ying Jun company by TA BcNAC1The total length of encoding sequence.

Embodiment 2: Chinese cabbage senescence-associated transcription factor BcNAC1 functional analysis.

2.1 sequence comparing analysis

Homology with Genedoc software analysis BcNAC1 and other species.Analytical results shows that BcNAC1 not only has 5 conservative in NAC family subdomains, and E subdomain high conservative.The GenBank accession number of Arabidopis thaliana AtNAP, Kidney bean PvNAP, soybean GmNAP is respectively: NP_564966.1, AAK84884.1, AAY46121.1.

In order to analyze the phylogenetic relationship of BcNAC1, set up the phylogenetic tree of BcNAC1 with other species NAP with MEGA software with other species senescence-associated transcription factors NAP.The result shows that BcNAC1 is nearest with the sibship of Arabidopis thaliana AtNAP.Kidney bean (kidney bean) cuts shape clover (medicago), soybean (soybean), Arabidopis thaliana (arabidopsis), potato wild species (nightshade), willow (populus), wheat (wheat), paddy rice (rice), tomato (tomato), petunia (petunia), the NAP sequence accession number of potato (potato) is respectively: AAK84884, AC140030_19.1, AAY46121, NP_564966.1, AAU90314, gw1.X.1066.1, AAU08785, NP_912423, AAU43923, AAM34773, AAU12055.

2.2 BcNAC1Functional analysis.

2.2.1 complementary Arabidopis thaliana AtnapPlant expression vector construction

Utilize primer AtNAPPF and AtNAPPR to amplify Arabidopis thaliana AtNAPPromotor, check order errorless after, use EcoR1 and Sac1 double digestion, reclaim purifying purpose segment, and be connected to through same two enzyme enzymes and cut, on the pCHF3 carrier of purifying, called after P AtNAP-pCHF3.

Utilize primer BcNAC1FF and BcNAC1FR to amplify BcNAC1CDS, check order errorless after, use EcoRI and KpnI double digestion, reclaim purifying purpose segment, and be connected to through same two enzyme enzymes and cut the P of purifying AtNAPOn-pCHF3 the carrier, obtain complementary carrier, called after P AtNAP- BcNAC1-pCHF3.

AtNAPPF：5'?CGGAATTCCATCCTAATCCTCATA?3'

AtNAPPR：5'?CCATGAGCTCCAGACAATTTAGAAAAC?3' (SEQ?ID?NO.4)

BcNAC1FF：5'?CTGAATTCATGGACATGAATCCCAA?3'

BcNAC1FR：5'?GCGGTACCCTAAAACTGAAACATACTAGC?3' (SEQ?ID?NO.5)

2.2.2 Agrobacterium-mediated Transformation

2.2.2.1 LBA4404 Agrobacterium competent cell preparation

1) contains rifomycin 40ug/ml, ruling on the YEB solid medium of Streptomycin sulphate 100ug/ml, cultivating 48h-72h for 28 ℃;

2) choose single bacterium colony to containing rifomycin 40ug/ml, 28 ℃ are cultured to OD in the YEB liquid nutrient medium of Streptomycin sulphate 100ug/ml ₆₀₀0.5;

3) cooled on ice bacterium liquid, 5000rpm, 4 ℃ of 10 minutes collection thalline;

4) 1mM Hepes pH 7.0 washings are 3 times, again with the washing of 10% glycerine once;

5) the suspension thalline divides to install in the 1.5ml centrifuge tube every pipe 40ul in 3ml 10% glycerine.

2.2.2 Agrobacterium-mediated Transformation

1) 200ng plasmid DNA adds and carries out electricity by following condition behind the 40ul Agrobacterium competent cell mixing and transform:

U 1.8?KV

R 200?W

C 25?uF

2) 800ul SOC liquid nutrient medium is added in the electric shock back, cultivates 1h for 28 ℃;

3) 4000rpm collected thalline in 10 minutes, was suspended among the 200ul SOC, was coated in to contain 100 ug/ml spectinomycins, and Rifampin 40ug/ml on the Streptomycin sulphate 100ug/ml LB solid medium, is inverted for 28 ℃ and cultivates 48h-72h.

2.2.3 agriculture bacillus mediated Arabidopis thaliana transforms.

2.2.3.1 Arabidopis thaliana matrix is cultivated

Matrix components: vermiculite: black earth: perlite 9: 3:0.5

Nutrient solution prescription:

。

After matrix is soaked into nutritive medium, seed is sowed in the earthen bowl, covers, place under 4 ℃ of dark conditions, change (16h L/8h D) illumination after 2 days over to, cultivate under 23 ℃ of conditions with preservative film.Arabidopis thaliana grows into that bolting blooms can be for transforming.

2.2.3.2 Agrobacterium is prepared

1) inoculation carry the purpose expression vector Agrobacterium to containing in an amount of antibiotic YEB substratum, 28 ℃, 220rpm shakes bacterium and is cultured to OD ₆₀₀1.2;

2) 5000rpm, 4 ℃ of 10 minutes centrifugal collection thalline;

3) thalline is suspended in 5% the sucrose solution again, and transfers to OD ₆₀₀0.8;

4) add Silwet L-77 to final concentration be 0.03%.

2.2.3.3 Arabidopis thaliana transforms

Get the Arabidopis thaliana material, be inverted and soak over-ground part in ready Agrobacterium solution, rocked about 3 seconds, take out, be placed under the concealment condition, the 24h that preserves moisture changes normal condition over to and cultivates.

2.2.3.4 Arabidopis thaliana transformant screening

Collect the seed that transforms the back Arabidopis thaliana.Seed 0.1% HgCl ₂Surface sterilization 5 minutes, aseptic water washing 4 times is suspended in the agarose of 0.1 %, by 2000 seeds of every flat board (diameter 15cm) (about 40mg), is layered on kantlex 50mg/L, on the 1/2MS substratum then.Flat board was placed 4 ℃ of dark refrigerators 2 days, transfer to (16h L/8h D) illumination, cultivate under 23 ℃ of conditions.Can filter out transfer-gen plant in about about 10 days with kalamycin resistance.The plant of tool resistance is transferred to matrix cultivate, and results T ₁For seed.

2.2.4 BcNAC1Complementary Arabidopis thaliana AtnapThe transfer-gen plant phenotypic evaluation

The T of results ₁, place after 2 days in 4 ℃ of dark refrigerators through being layered on behind the surface sterilization on the MS substratum that contains the 50mg/L kantlex for the transfer-gen plant seed, transfer to (16h L/8h D) illumination, cultivate under 23 ℃ of conditions.The culture dish that is covered with the moistening filter paper of one deck is cut and placed to the 6th leaf of the Arabidopis thaliana in 3 weeks of normal growth, 23 ℃ of dark processing 4 days.The result shows, BcNAC1Can be complementary AtnapThe phenotype that the mutant leaf senile lags behind, dark processing is after 4 days, and each transfer-gen plant excised leaf all has yellow in various degree, and most of strain is that the blade yellowing is near the wild-type Arabidopis thaliana.

Simultaneously, under the normal growth state, observe complementary transgenic line, the phenotype of the stagnant green mutant of wild-type and Arabidopis thaliana.The result shows BcNAC1Can be complementary AtnapThe phenotype that the mutant leaf senile lags behind.

Claims (5)

1. Chinese cabbage senescence-associated transcription factor, it is characterized in that protein, or have with the amino acid residue sequence of SEQ ID NO:2 identical active by SEQ ID NO:2 deutero-protein through replacement, disappearance or the interpolation of one or several amino-acid residue the amino acid residue sequence of SEQ ID NO:2 for amino acid residue sequence shown in the SEQ ID NO:2.

2. the encoding gene of Chinese cabbage senescence-associated transcription factor BcNAC1 is characterized in that its dna sequence dna is the nucleotide sequence shown in the SEQ ID NO:1, perhaps is the polynucleotide sequence of aminoacid sequence shown in the coding SEQ ID NO:2.

3. contain expression vector just like the encoding gene of the described Chinese cabbage senescence-associated transcription factor of claim 2 BcNAC1.

4. contain clone just like the encoding gene of the described Chinese cabbage senescence-associated transcription factor of claim 2 BcNAC1.

5. as the application of encoding gene in delaying the plant senescence character improvement of Chinese cabbage senescence-associated transcription factor BcNAC1 as described in the claim 2.

Images