CN101928339B - Bambusa affinis 'viridiflavus' aging associated transcription factor, coding gene thereof and use thereof - Google Patents

Abstract

The invention belongs to the technical field of plant genetic engineering and discloses a bamboo aging regulation associated NAC family transcription factor, a coding gen thereof and use thereof. The aging associated transcription factor provided by the invention is derived from Bambusa affinis 'viridiflavus' and named BeNAC1. The amino acid sequence of the aging associated transcription factor is represented by SEQ ID No.2. The coding gene of the BeNAC1 is a polynucleotide having one of the following amino acid sequences: (1), an amino acid sequence SEQ ID No.1 in a sequence table; and (2) an amino acid sequence SEQ ID No.2 in the sequence table. The gene of the invention is crucial to the modification for delaying the aging of bamboo.

Description

A kind of Bambusa affinis ' viridiflavus ' aging associated transcription factor and encoding gene thereof and application

Technical field

The invention belongs to the plant gene engineering technology field, be specifically related to NAC family transcription factor, particularly Bambusa affinis ' viridiflavus ' aging associated transcription factor and encoding gene thereof and an application.

Background technology

Plant senescence is physiological a series of deterioration processes before natural death, is the result (Li Qing, Zhu Yuxian, Molecular Plant Breeding, the 1st volume, the 3rd phase, 2003 years) of long-term evolution and natural selection.It is subjected to gene control, is the integral part of growing.Aging is growth and development of plants, morphogenesis and to necessity in the environment responsing reaction, initiatively process, that a kind of organ or tissue that directly or indirectly affected by the inside and outside factor progressively moves towards deterioration and dead change procedure, it except the termination that represents organ or tissue's life cycle, also important in inhibiting on developmental biology.

Research about plant senescence mainly concentrates in the research of leaf senile.During Leaf Senescence, (Gepstein S, Genome Biology, 5 (3): 212,2004 all occur much to change in cellularstructure, Physiological and Biochemical Metabolism and gene expression regulation etc.; Chandlee JM, Physiologia Plantarum, 113:1-8,2001; Nam HG, Trends Plant Sci, 8 (6): 272-277,2003).At physiology, biological chemistry and molecular biology aspect have many (Yoshida S. Current Opinion in Plant Biology, 6:79-84,2003 reported about leaf senile; Larry et al, Physiol Plant, 101:746-753,1997; Nam HG, Curr Opin Biotech, 8:200-207,1997; Smart CM, New Phytol, 126:419-448,1994; Nam HG, Annu Rev Plant Biol, 58:115-36,2007; Betania et al Trends Plant Sci, 5 (7): 278-282. 2000).

Its transcription factor regulation and control destination gene expression is all passed through in grow and the degeneration-resistant response of higher plant.The NAC transcription factor is the special class novel transcription factor that has multiple biological function in the plant that is present in.Aida in 1997 etc. have at first reported the NAC structural domain, discovery comprises one section conservative aminoacid sequence at the N of petunia NAM gene, Arabidopis thaliana ATAF1/2 and CUC2 gene coded protein end, get three gene initial called after NAC(Aida M, et al, Plant Cell, 9 (6): 841 – 857,1997).

The topmost constructional feature of NAC transcription factor is the NAC structural domain that each member's N end contains high conservative, whole N end regions can be divided into 5 subdomains (A, B, C, D, E), wherein subdomain A, C, D high conservative, contain nuclear localization signal (nuclear localization signals in subdomain C, the D sequence, NLS), may appraise and decide with transcription factor relevant (the Kikuchi K of identification of certain cis element on position and the promotor, et al, Mol Gen Genet, 262 (6): 1047 – 1051,2000; Ooka H, et al, DNA Res, 10 (6): 239-247,2003).The E subdomain is in NAP, AtNAC3, ATAF and OsNAC3 subfamily camber conservative (Ooka H, et al, DNA Res, 10 (6): 239-247,2003).The C end is transcriptional activation function district (transcrip tional activation regions, TARs), diversity with height, the common feature of this end are that the frequency that repeats of some amino acid such as Serine, Threonine, proline(Pro), L-glutamic acid is high.2003, Ooka etc. found 105 NAC transcription factors by full genome analysis in Arabidopis thaliana, then find 75 NAC members in paddy rice.By comparing the aminoacid sequence of NAC structural domain, they are divided into 2 big nations, 3 subtribes (OsNAC3, ATAF, NAM).According to reporting in recent years that it was 5 subtribes (OsNAC3, ATAF, NAM, AtNAC3, NAP) that NAC family is divided into again.

The NAC transcription factor is at plant apical meristem and floral organ differentiation (Sablowski, et al, Cell, 92 (1): 93 – 103,1998), lateral root forms (Mitsuda N, et al, Plant Cell, 17 (11): 2993 – 3006,2005), secondary wall thickens (Xie Q, et al, Genes Dev, 14 (23): 3024 – 3036, biological (Hegedus D, et al, the Plant Mol. Biol of the specific growth course of plant and opposing such as 2000), 53:383-397,2003) with abiotic stress process (Nogueira FT, Plant Science, 169:93 – 106,2005) all play an important role in, the NAC transcription factor also plays important regulating and controlling effect (GUO YF, GAN S, Plant Journal at senescence process of plant, 46 (4): 601-612,2006).Studies show that, the NAC transcription factor the growing of plant, the device palace is built up, hormone regulation and defence are resisted the aspects such as multiple biology and abiotic stress and played an important role.Compared to the transcription factor of MYB class, bZIP class and WRKY class, the correlative study of NAC transcription factor is less.

Bamboo plant is the general name of Gramineae (Ggramineae) Bambusoideae (Bambusoideae) plant, is the important forest reserves, mainly is distributed in subtropical and tropical zones, in temperate zone and cool temperature zone a small amount of distribution is arranged also.The total bamboo kind more than 70 in the whole world belongs to more than 1200 plants, NATURAL DISTRIBUTION in the Asia, the ground such as Africa, South and North America, Oceania, the tropical and subtropical zone area in South East Asia be its center of distribution area,, the bamboo kind that wherein grows in the Asia has 38 genus more than 500 kinds approximately.China is the distribution center of Asia bamboo, is the abundantest, the widest country that distributes of bamboo kind, and total bamboo plant about 29 belongs to more than 300 and plants bamboo grove area 5,000,000 hm ², account for more than 4% of the national forest total area, 1.3 hundred million tons of output; The bamboo annual value of production can reach 59,800,000,000 yuan in 2006, no matter be that bamboo grove area, bamboo kind quantity, bamboo shoots and bamboo wood output all occupy first place in the world, was described as " bamboo kingdom ".

Bamboo is the human the fastest plant of growth known at present.The bamboo purposes is quite extensive, and according to nearest statistics, the conventional use of bamboo reaches 1500 multiclass, and this numeral is along with growing with each passing day to continually developing also of bamboo in countries in the world.Bamboo growth is fast, become a useful person early, output is high, purposes is wide, and nowadays in fields such as building, papermaking, finishing material, health care of food, afforestation and ecological protections, bamboo all shows huge advantage and potentiality with its exclusive characteristics.In addition, bamboo or the Major Foods of Chinese national treasure level animal panda.

Therefore the aging of studying bamboo plant not only helps to be familiar with its growth course, and helps to set up the old and feeble method of regulation and control, thereby delay aging is initial or the process that delays senility.

Summary of the invention

The purpose of this invention is to provide a kind of spun gold cizu NAC family's Senescence manipulation associated transcription factor and encoding gene and application.

Bamboo senescence-associated transcription factor provided by the present invention, derive from spun gold cizu ( Bambusa emeiensis' Viridiflavus '), name is called BeNAC1Be the protein with SEQ ID NO:2 amino acid residue sequence, or the amino acid residue sequence of SEQ ID NO:2 is had the protein of being derived by SEQ ID NO:2 with the identical activity of amino acid residue sequence of SEQ ID NO:2 through replacement, disappearance or the interpolation of one or several amino-acid residue.

The encoding gene of spun gold cizu BeNAC1 transcription factor is one of following Nucleotide:

1) dna sequence dna shown in the SEQ ID NO:1.

2) polynucleotide of aminoacid sequence shown in the coding SEQ ID NO:2.

In the sequence table, SEQ ID NO:1 is by 1684 based compositions, and the reading frame of this gene is to hold the 208th to 1275 bit bases from 5 '; SEQ ID NO:2 is comprised of 355 amino-acid residues.

The present invention also comprises the expression vector of the encoding gene of described Bambusa affinis ' viridiflavus ' aging associated transcription factor.

The present invention also comprises the clone of the encoding gene of described Bambusa affinis ' viridiflavus ' aging associated transcription factor.

The present invention also comprises the application of encoding gene in bamboo Senescence manipulation molecular mechanism of described Bambusa affinis ' viridiflavus ' aging associated transcription factor.

The present invention also comprises the application of encoding gene in delaying the plant senescence character improvement of described Bambusa affinis ' viridiflavus ' aging associated transcription factor.

Description of drawings

Fig. 1 is segment amplified production gel electrophoresis spectrum in the middle of the 302bp.

Fig. 2 is 1074bp 3 ' end amplified production gel electrophoresis spectrum.

Fig. 3 is 513bp 5 ' end amplified production gel electrophoresis spectrum.

Fig. 4 is the homology analysis of spun gold cizu BeNAC1 transcription factor and other species.

Fig. 5 is the expression pattern analysis of BeNAC1 transcription factor in spun gold cizu.

Fig. 6 normal growth is in the time of 23 days, and wild-type is crossed and expressed BeNAC1The phenotype of transgenic line.

Embodiment

Embodiment 1The acquisition of spun gold cizu BeNAC1 transcription factor encoding gene

1.1 RNA extracts

Get the about 0.1g of Bambusa affinis ' viridiflavus ' aging blade.After liquid nitrogen fully grinds, transfer to the 1.5ml centrifuge tube, add 1ml (invitrogen company), behind the mixing, room temperature was placed 15 minutes, added the 0.2ml chloroform: primary isoamyl alcohol (24:1), acutely shake after 15 seconds room temperature and placed 5 minutes, 13000rpm, 4 ℃ are centrifugal 15 minutes.Get supernatant liquor and add the equal-volume Virahol, careful mixing, room temperature was placed 15 minutes, 13000rpm, 4 ℃ are centrifugal 15 minutes.70% washing with alcohol precipitation, drying at room temperature 15 minutes.Be dissolved in an amount of in the ddH2O water that 0.1% DEPC processed, be stored in-80 ℃ for subsequent use.

1.2 cDNA the first chain is synthetic and reverse transcription PCR

Adopt the cDNA first chain synthetic agent box of Shen, Shanghai energy lottery industry biotech company (SHBC), according to operational guidance total RNA reverse transcription is become cDNA.Reaction system and reaction conditions are respectively: total RNA of 2ug preparation, and 0.5ul Rnase inhibitor adds deionized water that DEPC processed to 8.5ul, 65 ℃ of the Oligo of 2ul (dT) 18 primer., 5min, room temperature is placed 10min, the brief centrifugal 5s of 13000rpm.Add successively again 4 μ l, 5 * First-Strand buffer, 0.5 μ l RNase Inhibitor, 2 μ l 100mM DTT, 2 μ l dNTP, 1 μ l MMLV Reverse Transcriptase.Careful mixing; 37 ℃ of reverse transcriptions 1 hour, 90 ℃ 5 minutes; Cooled on ice; 13000rpm of short duration centrifugal 5 seconds, deposit in-20 ℃ stand-by

1.3 RT-PCR amplification BeNAC1Segment in the middle of the gene

According to the conserved sequence of the NAC family gene of in other plant, being cloned in the past, designed two homology degenerate primer BeNAC1CF(5'TTCAGCCCGCGGGACCGCAAGTA 3'(SEQ ID NO:3)) and BeNAC1CR:(5'TAGATCCGGCACAGCACCCAGTCATC 3'(SEQ ID NO:4)) as the primer of PCR reaction.The PCR reaction system is 50ul, and reaction conditions is: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 40s, 58 ℃ of renaturation 40s, 72 ℃ are extended 60s, circulate 38 times.72 ℃ are fully extended 10min.The PCR product of gained is separated the segment that obtains one section about 300bp through 1% agarose gel electrophoresis.After reclaiming and being cloned into TAKARA pMD19-T carrier by TA, by the order-checking of Shanghai Ying Jun company, obtain BeNAC1The intermediate sequence of gene.

1.4 BeNAC1The acquisition of complete sequence

1.4.1 BeNAC1The amplification of 3 ' end sequence

BeNAC1The SMART of Clontech company is used in 3 ' the end sequence amplification of gene ^TMRACE cDNA amplification test kit.Design two Auele Specific Primers according to the conserved sequence that has obtained and carried out the nest-type PRC reaction.

BeNAC13’RACE F： 5' CGGCAACACCTACCGACCCATGAAGT 3'（SEQ ID NO: 5）

BeNAC13’RACE NF：5' GTTGGATGACTGGGTGCTGTG 3' （ SEQ ID NO: 6）

Reaction conditions is respectively:

First round PCR reaction: 94 ℃ of denaturation 5min, 94 ℃ of sex change 40s, 60 ℃ of renaturation 40s, 72 ℃ are extended 90s, circulate 35 times.72 ℃ are fully extended 10min.

Second takes turns the PCR reaction: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 40s, 58 ℃ of renaturation 40s, 72 ℃ are extended 90s, circulate 38 times.72 ℃ are fully extended 10min.

Second takes turns PCR reaction finish after, 1% electrophoresis detection obtains the fragment of about 1000bp, rubber tapping is reclaimed and is cloned into cloning vector and checks order, acquisition 3 ' end sequence.

1.4.2 5 ' RACE method amplification BeNAC1The end sequence of gene

BeNAC1The SMART of Clontech company is used in 5 ' the end sequence amplification of gene ^TMRACE cDNA amplification test kit.Design two Auele Specific Primers according to the conserved sequence that has obtained and carried out the nest-type PRC reaction.

BeNAC15’RACE F： 5' TGCGGAACTTCATGGGTCGGTAGGTGT 3'（SEQ ID NO: 7）

BeNAC15’RACE NF：5' ATTGGTCTTGGTGCCCTTAG 3'（SEQ ID NO: 8）

Reaction conditions is respectively:

First round PCR reaction: 94 ℃ of denaturation 5min, 94 ℃ of sex change 40s, 60 ℃ of renaturation 40s, 72 ℃ are extended 90s, circulate 35 times.72 ℃ are fully extended 10min.

Second takes turns the PCR reaction: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 40s, 58 ℃ of renaturation 40s, 72 ℃ are extended 90s, circulate 38 times.72 ℃ are fully extended 10min.

Second takes turns PCR reaction finish after, 1% electrophoresis detection obtains the fragment of about 500bp, rubber tapping is reclaimed and is cloned into cloning vector and checks order, acquisition 5 ' end sequence.

According to what obtained BeNAC13 ' end sequence and 5 ' end sequence and intermediate sequence splicing have obtained BeNAC1Full length sequence.

Embodiment 2The BeNAC1 sequential analysis

2.1 sequence similarity analysis

Utilize NCBI blast program (http://www.ncbi.nlm.nih.gov/BLAST/) that BeNAC1 is carried out sequence similarity and the analysis showed that BeNAC1 is the most similar to the NAC transcription factor in the paddy rice, similarity reaches 76%, and consistence reaches 70%.

2.2 many species sequence comparing analysis

Use software Genedoc software to analyze respectively the homology of BeNAC1 and other species.Analytical results shows that BeNAC1 has great homology with the NAP-Like transcription factor of other species, has conservative NAC DNA binding domains (A, B, C, D, 5 subdomains of E), and this structural domain is equal high conservative in other species.As shown in Figure 4, adding among the figure that blackboard divides is conforming aminoacid sequence.The gene accession number of used gene is respectively: OsNAP (NP_912423), HvNAM (ABI94358), StNAC2 (ABK96797), GmNAC1 (AAY46121), CarNAC3 (ACO40486.1), NAP (CAA10955), ATAF1 or ANAC002 (NP_171677), AtNAM (AAD17314).

Embodiment 3 BeNAC1Expression pattern is analyzed

3.1 spun gold cizu ACTINThe acquisition of conservative segment

Obtain according to separation in the other plant ACTINConserved sequence has designed following pair of primers amplification spun gold cizu ACTINConservative segment:

BeActinF: 5’GAAGCACAATCCAAAAGAGGTAT 3’（ SEQ ID NO: 9）

BeActinR: 5’GAGCCTCCGATCCAGACACT3’ （SEQ ID NO: 10）

The PCR reaction conditions: 94 ℃ of denaturation 5min, 94 ℃ of sex change 40s, 52 ℃ of renaturation 30s, 72 ℃ are extended 60s, circulate 38 times.72 ℃ are fully extended 10min.

With the PCR product of gained through 1% agarose gel electrophoresis Separation and Recovery, order-checking, NCBI comparison.

3.2 BeNAC1Expression pattern is analyzed

1) takes under the right growth conditions light greenly, senesce and old and feeble spun gold cizu blade, according to the method extracting RNA among the present invention 1.1, and carry out the reverse transcription of the first chain cDNA by the method in 1.2.

2) get dark processing 0 day, 6 days, 12 days, 18 days, 24 days, 30 days spun gold cizu blade according to the method extracting RNA among the present invention 1.1, and carries out the reverse transcription of the first chain cDNA by the method in 1.2.

3) the Real-time real-time quantitative PCR uses the SYBR Green II PCR kit of Japanese Toyobo company.

Used primer is as follows:

BeNAC1RT-F： 5' CGCCTAAGGGCACCAAGACC 3'（SEQ ID NO: 11）

BeNAC1RT-R： 5' CGGCACAGCACCCAGTCATC 3'（SEQ ID NO: 12）

BeACTINRT-F: 5' TCACGCTATTCTTCGGTTGG 3' （SEQ ID NO: 13）

BeACTINRT-R: 5' TAATCAAGGGCAACATAGGCG 3' （SEQ ID NO: 14）

The PCR reaction conditions: 94 ℃ of denaturation 5min, 94 ℃ of sex change 30s, 62 ℃ of renaturation 25s, 72 ℃ are extended 20s, circulate 40 times.

Utilize Real-time PCR to detect in the spun gold cizu blade of different growth phases under the self-sow state and dark processing different time BeNAC1Expression amount, the result shows, under the self-sow state along with the increase of leaf senile degree, BeNAC1Expression amount constantly raise; Under the dark processing condition BeNAC1Expression amount also raise along with the growth of dark processing time, but ascendant trend is induced obviously not as naturally-aged.

Embodiment 4 BeNAC1Functional analysis

4.1 composing type is crossed expression BeNAC1Plant expression vector construction

Utilize the CDS of primer BeNAC1F and BeNAC1R amplification BeNAC1, and be cloned into pMD19-T vector (Takara), check order errorless after.Use Kpn1 and Xba1 double digestion, reclaim purifying purpose segment, and be connected to through same two enzyme enzymes and cut, on the pCHF3 plant expression vector of purifying, called after BeNAC1-pCHF3.

BeNAC1F： 5' GGGGTACCATAGAGATCTTGGAAAG 3'（SEQ ID NO: 15）

BeNAC1R： 5' GTGTTCTAGAGCCCCATTGTTCACA 3'（SEQ ID NO: 16）

4.2 Agrobacterium-mediated Transformation

4.2.1 GV3101 Agrobacterium competent cell preparation

1) contains rifomycin 40ug/ml, ruling on the YEB solid medium of gentamicin 30ug/ml, cultivating 48h-72h for 28 ℃.

2) choose single bacterium colony to containing rifomycin 40ug/ml, 28 ℃ are cultured to OD in the YEB liquid nutrient medium of gentamicin 30ug/ml ₆₀₀0.5,

3) cooled on ice bacterium liquid, 5000rpm, 4 ℃ of 10 minutes collection thalline

4) 1mM Hepes pH 7.0 washings are 3 times, again with the washing of 10% glycerine once

5) the suspension thalline divides to install in the 1.5ml centrifuge tube every pipe 40ul in 3ml 10% glycerine.

4.2.2 Agrobacterium-mediated Transformation

1) 200ng plasmid DNA adds and carries out electricity by following condition behind the 40ul Agrobacterium competent cell mixing and transform.

U 1.8 KV

R 200 W

C 25 uF

2) add 800ul SOC liquid nutrient medium after the electric shock, cultivate 1h for 28 ℃

3) 4000rpm collected thalline in 10 minutes, was suspended among the 200ul SOC, was coated in to contain 100 ug/ml spectinomycins, and rifomycin 40ug/ml on the gentamicin 30ug/ml YEB solid medium, is inverted for 28 ℃ and cultivates 48h-72h.

4.3 agriculture bacillus mediated transformation of Arabidopsis thaliana

4.3.1 Arabidopis thaliana matrix is cultivated:

Matrix components: vermiculite: black earth: perlite 9: 3: 0.5

Nutrient solution prescription:

After matrix is soaked into nutritive medium, seed is sowed in the earthen bowl, covers with preservative film, place under 4 ℃ of dark conditions, change (16h L/8h D) illumination after 2 days over to, cultivate under 23 ℃ of conditions.Arabidopis thaliana grows into that bolting blooms can be for transforming.

4.3.2 Agrobacterium is prepared

1) inoculation carry the purpose expression vector Agrobacterium to containing in an amount of antibiotic YEB substratum, 28 ℃, 220rpm shakes bacterium and is cultured to OD ₆₀₀1.2.

2) 5000rpm, 4 ℃ of 10 minutes centrifugal collection thalline

3) the thalline Eddy diffusion is in 5% sucrose solution, and transfers to OD ₆₀₀0.8

4) add Silwet L-77 to final concentration be 0.03%.

4.3.3 transformation of Arabidopsis thaliana (bud dip method)

Get Arabidopis thaliana wild-type material, be inverted and soak over-ground part in ready Agrobacterium solution, rocked about 3 seconds, take out, be placed under the concealment condition, moisturizing 24h changes normal condition over to and cultivates.

4.3.4 transformation of Arabidopsis thaliana screening

Collect the seed of Arabidopis thaliana after transforming.Seed 0.01% HgCl ₂Surface sterilization 8 minutes, aseptic water washing 4 times is suspended in the agarose of 0.1 %, then by 2000 seeds of every flat board (diameter 15cm) (about 40mg), is layered on the MS substratum of kantlex 50mg/L.Flat board was placed 4 ℃ of dark refrigerators 2 days, transfer to (16h L/8h D) illumination, cultivate under 23 ℃ of conditions.Can screen the transfer-gen plant of providing kalamycin resistance in about about 10 days.The plant of tool resistance is transferred to matrix cultivate, and results T1 is for seed.

4.4 cross expression BeNAC1The transfer-gen plant phenotypic evaluation

The T1 of results, places after 3 days in 4 ℃ of dark refrigerators through being layered on behind the surface sterilization on the MS substratum that contains the 50mg/L kantlex for the transfer-gen plant seed, transfers to (16h L/8h D) illumination, cultivates under 23 ℃ of conditions.Under the self-sow state, by observing transfer-gen plant, the senescence process of wild-type plant Col-0 is found, transfer-gen plant was at the 23rd day even obvious aging phenomenon (bolting in advance occurred more for a long time, the blade yellow), senescence process is obviously faster than wild-type plant (the 23rd day not yet occur aging phenomenon), as shown in Figure 6.

SEQ ID NO: 1

<160> 2

<210> 1

<211> 1684

<212> DNA

＜213〉spun gold cizu ( Bambusa emeiensis' Viridiflavus ')

<400> 1

aagcagtggt atcaacgcag agtacgcggg gtgcggggcg ttcctacgct caggagggtc 60

cttcatttcc tagctgcaag attcggctat tcatcgcttc ctcggcgtag catagagatc 120

ttggaaagtt agttagcagt agaagctagc tagagttttg tagaggttgc tcgatcgatc 180

gagcgcgtgc agctggtata cgtgccgatg atcatgcaga acccggcgat gctgcctccc 240

ggcttccggt tccacccgac cgacgaggag ctgatcctcc actacctccg caaccgcgcc 300

ggctcctcgc cgtgccccgt cgccatcatc gccgacgtcg acatctacaa gttcgaccca 360

tgggacctcc catccaaggc tgcgtacggg gataaagagt ggtacttctt cagcccgagg 420

gaccgcaagt atccgaacgg aatccggccg aaccgcgcgg cggggtctgg ctactggaag 480

gccaccggca ccgacaagcc catccacaac agcgccaccg gagagagtct cggcgtcaag 540

aaggccctcg tcttctacac gggccgcccg cctaagggca ccaagaccaa ttggatcatg 600

cacgagtacc gcctcacctc cgccgacgcg caggccggca acacctaccg acccatgaag 660

ttccgcaacg cctccatgag gttggatgac tgggtgctgt gccggatcta caagaagagc 720

agccacgtgt cgccgatggc ggtgccgccg ctgtccgacc acgagctgga cgagccgtgc 780

gccttcgaag agaaccagct gtacgggaag tcgagtgccg gcatgatcat gcaaggcggc 840

gccgacgcct tcccgctgca ggccgcggcg gccacgcaga ggatgccgag gatcccgtcc 900

atatccgagc tgctcaacga ctactcactg gcgcaactct tggacgacgg cgccccggcc 960

gagatggcac ggcccgatca acgcgccgcc ctcctcggcc atcccgtcgt gaaccaattt 1020

ctcgtgaaca gcagcggcaa catgtcgcag ctcgcgcaga tgggctcgtc ggcggcgggc 1080

gagggcgcca ccgggaagcg caagagatcg gaagacggtg gcagtactgg gctaccgagc 1140

cagccggcgg cggcagccca gaagccgaac tattcttgct tcggtgcaac gttccaccaa 1200

ataggcaacg gcttgcaggg gtcactaggc ctggaccatc agatgctgct ccattctaac 1260

atggggatga actgatagat atctgctgca gtgatctgaa ttatacatgg cgaattggtt 1320

atgtgaacaa tggggctcta ttacactaaa taggtccaaa taaataaaac tattggttaa 1380

gttgtaggga aaggaattgt acttgtactt gcgtcaagtg tcgatcgact agctagatcc 1440

attatagttg atttggtttg tggtgtgtac acattttttc tcctatgtag tactaatgtt 1500

cttcaagctt agtagtaaga tagggcttga tcagactttg agatcgacgt gctggaagtc 1560

gatctggaac aggagaatca tgttaaggcc caaccggctt tgtttacgta aaacagtgaa 1620

aaattagaga ttgtttaatg gagccattca ttatgctaaa aaaaaaaaaa aaaaaaaaaa 1680

aaaa 1684

SEQ ID NO: 2

<210> 2

<211> 355

<212> PRT

＜213〉spun gold cizu ( Bambusa emeiensis' Viridiflavus ')

<400> 2

M I M Q N P A M L P P G F R F H P T D E E L I L H Y L R N R 30

A G S S P C P V A I I A D V D I Y K F D P W D L P S K A A Y 60

G D K E W Y F F S P R D R K Y P N G I R P N R A A G S G Y W 90

K A T G T D K P I H N S A T G E S L G V K K A L V F Y T G R 120

P P K G T K T N W I M H E Y R L T S A D A Q A G N T Y R P M 150

K F R N A S M R L D D W V L C R I Y K K S S H V S P M A V P 180

P L S D H E L D E P C A F E E N Q L Y G K S S A G M I M Q G 210

G A D A F P L Q A A A A T Q R M P R I P S I S E L L N D Y S 240

L A Q L L D D G A P A E M A R P D Q R A A L L G H P V V N Q 270

F L V N S S G N M S Q L A Q M G S S A A G E G A T G K R K R 300

S E D G G S T G L P S Q P A A A A Q K P N Y S C F G A T F H 330

Q I G N G L Q G S L G L D H Q M L L H S N M G M N 355

SEQ ID NO: 3 TTCAGCCCGCGGGACCGCAAGTA

SEQ ID NO: 4 TAGATCCGGCACAGCACCCAGTCATC

SEQ ID NO: 5 CGGCAACACCTACCGACCCATGAAGT

SEQ ID NO: 6 GTTGGATGACTGGGTGCTGTG

SEQ ID NO: 7 TGCGGAACTTCATGGGTCGGTAGGTGT

SEQ ID NO: 8 ATTGGTCTTGGTGCCCTTAG

SEQ ID NO: 9 GAAGCACAATCCAAAAGAGGTAT

SEQ ID NO: 10 GAGCCTCCGATCCAGACACT

SEQ ID NO: 11 CGCCTAAGGGCACCAAGACC

SEQ ID NO: 12 CGGCACAGCACCCAGTCATC

SEQ ID NO: 13 TCACGCTATTCTTCGGTTGG

SEQ ID NO: 14 TAATCAAGGGCAACATAGGCG

SEQ ID NO: 15 GGGGTACCATAGAGATCTTGGAAAG

SEQ ID NO: 16 GTGTTCTAGAGCCCCATTGTTCACA

Claims (6)

1. a Bambusa affinis ' viridiflavus ' aging associated transcription factor it is characterized in that amino acid residue sequence is the protein of SEQ ID NO:2.

2. the encoding gene of Bambusa affinis ' viridiflavus ' aging associated transcription factor BeNAC1 is characterized in that nucleotides sequence classifies the dna sequence dna shown in the SEQ ID NO:1 as.

3. gene according to claim 2 is characterized in that: the encoder block of this gene is for from the 208th dna sequence dna to the 1275th bit base of 5 ' end.

4. the expression vector that contains the encoding gene of claim 2 or 3 described Bambusa affinis ' viridiflavus ' aging associated transcription factor BeNAC1.

5. the application of the encoding gene of claim 2 or 3 described Bambusa affinis ' viridiflavus ' aging associated transcription factor BeNAC1 in bamboo leaves Senescence manipulation molecular mechanism.

6. such as the application of encoding gene in improvement bamboo Senescence of Bambusa affinis ' viridiflavus ' aging associated transcription factor BeNAC1 as described in claim 2 or 3.

Images