CN101892243B - Complementary deoxyribonucleic acid (cDNA) sequence related to iron deficiency of plant and encoded protein and application thereof - Google Patents
Complementary deoxyribonucleic acid (cDNA) sequence related to iron deficiency of plant and encoded protein and application thereof Download PDFInfo
- Publication number
- CN101892243B CN101892243B CN2010101036500A CN201010103650A CN101892243B CN 101892243 B CN101892243 B CN 101892243B CN 2010101036500 A CN2010101036500 A CN 2010101036500A CN 201010103650 A CN201010103650 A CN 201010103650A CN 101892243 B CN101892243 B CN 101892243B
- Authority
- CN
- China
- Prior art keywords
- cdna
- plant
- iron
- sequence
- yeast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a complementary deoxyribonucleic acid (cDNA) sequence related to iron deficiency of a plant and an encoded protein and application thereof. A full-length cDNA of a ZmFDR gene is cloned from an iron-deficient induced corn root and the structural characteristic of the full-length cDNA and the functional complementation of the full-length cDNA in yeast are analyzed. The analysis of the structural characteristic indicates that the full length of the ZmFDR gene is 3.3 kb, the gene comprises two open reading frames which are 1,068 bp and 648 bp respectively and the latter isnamed as ZmFDR4 (SEQ ID NO:1). The encoded protein (SEQ ID NO:2) has four transmembrane domains and has a signal peptide which belongs to a secretory protein and has a similar structure domain to a Flip protein in an III type secretory system. Extensive homology comparison indicates that no homology sequence is found in a higher plant. A yeast functional complementation experiment proves that theexpression of the cDNA sequence in the yeast can transfer iron ions effectively.
Description
Technical field
The present invention relates to a kind of cDNA sequence and the proteins encoded thereof relevant with the mineral nutrition of plant; Relate in particular to a kind of cDNA sequence and the proteins encoded thereof relevant with the corn iron deficiency; The invention still further relates to the recombinant expression vector that contains this cDNA sequence and this cDNA sequence improving the purposes that the plant resistance to iron deficiency is coerced, belong to plant genetic engineering field.
Background technology
Iron is the trace element that people find the earliest, finds the history in existing more than 2,000 year so far.Has irreplaceable function in prokaryotic organism that iron is existing on earth and the Eukaryotic vital movement.The research of iron can trace back to former 1843 of a century and a half in the plant, and Gris finds that the grape leave chlorosis that is grown on the calcareous soil is relevant with iron deficiency.After botanist Sachs and Molisch research are confirmed as the essential trace element of plant-growth with it, iron also is the plant essential nutrient element of finding the earliest simultaneously.Plant needs 10
-7-10
-4The iron of mol/L just can reach best growth conditions, but in neutrality or lime soil, the concentration of soluble iron is lower than 10
-10Mol/L.Iron occupies the first place of plant essential trace element, and slight iron deficiency can cause the synthetic minimizing of chlorophyll, and photosynthetic rate reduces, and during too little iron, chlorophyll is synthetic to stop the young leaves flavescence.The plant iron deficiency not only influences growth and development of plant, causes enormous economic loss, and influences the absorption of animal and human's class edible iron, thereby causes the generation (Guerinot ML, et al.1994) of anemia.Plant iron deficiency chlorosis is a worldwide plant nutrition imbalance.On the calcareous soil of the arid of many countries, semiarid zone, extensively exist plant iron deficiency problem, the iron deficiency phenomenon also often takes place in plant on saline-alkali soil.According to statistics, the whole world has 40% soil iron deficiency approximately.Continent, North America, Mediterranean Sea are littoral, the FSU is southern, the some areas in South America too little iron all.China is south gets the Sichuan Basin, and north is to Nei Mongol Plateau, to the east of Soil Development in Huaibei Plain, the west to the loess plateau and Gansu, Qinghai, Xinjiang etc. the generation of iron deficiency phenomenon is all arranged.Though the soil iron deficiency only exists with the area at the soil of certain type,,, also be one of focus of Plant Nutrition research since the beginning of this century so plant iron deficiency chlorosis becomes whole world question of common concern because the total area is bigger.
The content of iron is generally 0.3% of dry weight in the plant materials, and iron is the component of cytopigment, is the prothetic group of many important enzymes.Iron comparison concentrated area is distributed in the chloroplast(id), and 60% iron is fixed on the thylakoid membrane of chloroplast(id) in the report blades such as Terry, and 20% stores in stroma, and remaining 20% outside chloroplast(id).When plant receives iron deficiency and coerces; Iron in the stroma is most of to be utilized again; The outer structural iron of iron on the thylakoid membrane and chloroplast(id) loses 51% and 62% respectively, this shows, in the chloroplast(id) regulation and control of iron and utilize again and the iron level of seed closely bound up.
Summary of the invention
One of the object of the invention provides a kind of overexpression can improve the cDNA that the plant resistance to iron deficiency is coerced ability;
Two of the object of the invention provides a kind of by the coded amino acid of this cDNA;
Three of the object of the invention is a kind of recombinant expression vectors that contain said cDNA;
Four of the object of the invention is that said cDNA is applied to improve the performance that the plant resistance to iron deficiency is coerced;
Above-mentioned purpose of the present invention realizes through following technical scheme:
The present invention separates, is cloned into the ZmFDR4 gene of high expression level from Zea mays root under the environment that iron deficiency is coerced, its nucleotides sequence is classified as: (a) shown in the SEQ ID NO:1; (b) under rigorous condition can with the nucleotide sequence of the complementary sequence hybridization of the nucleotide sequence shown in (a);
Preferably, the nucleotides sequence of described ZmFDR4 gene is classified as shown in the SEQ ID NO:1;
Wherein, described " rigorous condition " is meant that hybridization solution is 5~6 * SSC, and 42~75 ℃ of hybridization are spent the night; Room temperature to 37 ℃ is with 2 * SSC washing one to twice, and preferred, described " rigorous condition " is 6 * SSC for hybridization solution; 68 ℃ of hybridization are spent the night, and 37 ℃ with 2 * SSC washed twice.
The invention still further relates to the plant expression vector that can in plant, efficiently express said cDNA (SEQ ID NO:1).
CDNA sequence of the present invention is inserted between the suitable restriction enzyme site of plant expression vector, exercisablely is connected, obtain in plant, to express the plant expression vector of this cDNA sequence with expression regulation sequence.For example, this plant expression vector can be by 5 ' non-coding region, and cDNA sequence and 3 ' non-coding region shown in the SEQ ID NO:1 are formed, and wherein, described 5 ' non-coding region can comprise that promoter sequence, enhancer sequence are or/and the translation enhancement sequences; Described promoter sequence can be composing type, induction type, tissue or organ specificity elicitor.Described 3 ' non-coding region can comprise terminator sequence, mRNA cutting sequence etc.
Concrete, the invention discloses the plant shuttle expression carrier pBI121-ZmFDR4 and the yeast shuttle expression carrier pYES2.0-ZmFDR4 that contain genes involved in the iron deficiency inducing maize root.
The present invention has also expressed corn ZmFDR4 gene in eukaryotic cell, obtained the transformed host cell of transhipment iron, the yeast strain that especially transforms.
The present invention further comprises the coded product of corn ZmFDR4 gene, and the aminoacid sequence of this proteins encoded is shown in the SEQ ID NO:2.
The detailed description of overall technical architecture of the present invention:
The present invention has cloned the full-length cDNA of ZmFDR gene from a kind of iron deficiency inductive Zea mays root, and its structural performance and the function in yeast are analyzed.Structural performance analysis revealed ZmFDR gene cDNA total length is 3.3kb.It includes the ORFs that two sizes are respectively 1068bp and 648bp, latter's called after ZmFDR4 (SEQ ID NO:1) to analyze discovery through ORF Finder.ZmFDR4 encoded protein (SEQ ID NO:2) has 4 membrane spaning domains, and signal peptide is arranged, and belongs to secreted protein, it with III type excretory system in FliP albumen similar structural domain is arranged.But, in higher plant, do not find any homology sequence through homology comparison widely.Can transport iron effectively with the expression of yeast function complementation experiment this cDNA of proof in yeast.
Can cDNA sequence of the present invention be applied to improve the performance that the plant resistance to iron deficiency is coerced, for example, can the plant expression vector that contain cDNA sequence of the present invention be imported in the vegetable cell, cultivate screening and obtain resistance to iron deficiency and coerce the transfer-gen plant that performance has improved.
Description of drawings
Fig. 1 is the proteic hydrophobicity analysis of ZmFDR4.
Fig. 2 is the proteic PSI-Blast comparison result of ZmFDR4, has the proteic structural domain of FliP in the III type excretory system.
Fig. 3 is the allos of the Yeast transformant of the expressing ZmFDR4 result that has complementary functions.The top of figure has marked used Fe
2+With the concentration of treatment of sequestrant BPDS, be respectively 5,10,15 μ M.The bacterial plaque of every row is with a kind of transgenic type yeast strain among the figure, and institute's rotaring carrier marks in the left side of figure.Each little figure four bacterial plaques from left to right is respectively by 0.1OD
600, 0.01OD
600, 0.001OD
600, 0.0001OD
600The bacterium point plate of concentration.30 ℃ of dark cultivations two days.Albumen has similar structural domain (see figure 2).
Embodiment possibly be the membranin in a kind of Secretory Pathway.TMHMM prediction ZmFDR4 albumen has 4 membrane-spanning domain (see figure 1)s, and 4 contained amino acid numbers of transbilayer helix are 84.It with III type excretory system in FliP albumen similar structural domain (see figure 2) is arranged.
The functional analysis of Test Example 1 corn ZmFDR4 gene
One, the structure of Yeast expression carrier
A pair of primer below the design is introduced Hind III and EcoR I restriction enzyme site respectively at ZmFDR4 5 ' end and 3 ' end.
The c-myc upper reaches: 5 ' CGTAAGCTTATGGGGGGTTCTC 3 '
C-myc fdr4 downstream: 5 ' TCAGAATTCTCACTTGTAGGTGGAG 3 '
With plant expression vector pBI121-ZmFDR4 (pBI121 is available from Invitrogen) is that template is carried out PCR; Respectively with PCR product and yeast shuttle expression carrier pYES2.0 (available from Invitrogen) with Hin III and EcoR I double digestion, and enzyme is cut product reclaims, connects, and transformed into escherichia coli TOP10.Through identifying, obtain containing the Yeast expression carrier of ZmFDR4 gene.
Two, zymic transforms
The yeast shuttle expression carrier pYES2.0-ZmFDR4 that builds transforms DEY1453 and (is so kind as to give [Department of Nutritional Sciences by David professor Eide; University ofWisconsin-Madison, USA]) (MAT α/MAT2 ade2/+can1/can1 his3/his3 leu2/leu2trp1/trp1 ura3/ura3 fet3-2::HIS3/fet3-2::HIS3 fet4-1::LUE2/fet4-1::LUE2) (construction process of DEY1453 sees one).DEY1453 is the double-mutant of high affine and low affine iron transfer body.The contrast water replaces plasmid.
Three, the screening of transformant
Containing iron chelator; The complete limit substratum of 15 μ M BPDS (Bathophenanthroline disulfonicacid is available from Sigma company) (is YNB substratum (complete minimaldropout medium); During preparation; Every 100mL gets the basic nitrogenous source of yeast (yeast nitrogen base
Further describe the present invention below in conjunction with specific embodiment, advantage of the present invention and characteristics will be more clear along with description.But these embodiment only are exemplary, scope of the present invention are not constituted any restriction.It will be understood by those skilled in the art that and down can make amendment with form or replace without departing from the spirit and scope of the present invention, but these modifications and replacing all fall in protection scope of the present invention the details of technical scheme of the present invention.
The clone of embodiment one corn ZmFDR complete sequence
One, RNA extracts
The corn variety responsive to iron (Zea mays L cv tucks in single 12) used the 0.5%-1%NaOCl surface sterilization, sprouts 36h at 27 ℃ then.When the long 1cm of the root left and right sides, 25 ℃ down with there not being the plain liquid (Hoagland nutrient solution) of iron to cultivate (Fe cultivation) corn 11-24d.When the iron deficiency symptom occurs, the about 2cm of clip tip of a root every day be stored in-80 ℃ subsequent use, mix random sampling when building the storehouse.(concentration is 1x10 in normal iron content to contrast corn simultaneously
-4Mol/L) growth in the nutrient solution (+Fe cultivation).
Two, the structure in DNA library
Press ZAP Express
TMCDNA Synthesis Kit and ZAP Express
TMCdna Gigapack GoldII Clong Kit specification sheets carries out the structure in cDNA library.Article one, the synthetic usefulness of chain contains the linker-primer grappling in Xho I site:
5 ' GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTT 3 ' is synthetic second chain under the catalysis of RNase H and polymerase I; The protruding terminus of double-stranded cDNA is mended flat with the pfu archaeal dna polymerase or is filled, and EcoR I linker is linked on the flat end subsequently.
Three, differential screening
Iron normal (+) and sideropenia (-) cDNA probe are synthetic from (+) and (-) mRNA template through random primer RT-PCR.Through the original position plaque hybridization, repeated screening finally obtains the ZmFDR clone, carries out 5 ' order-checking through Bao Bio-Engineering Company.
Four, the sequential analysis of mFDR4
Sequencing result shows that ZmFDR is the cDNA of 3.3kb, analyzes through ORF Finder and finds that it includes the ORFs that two sizes are respectively 1068bp and 648bp, latter's called after ZmFDR4 (SEQ IDNO:1).ZmFDR4 215 amino acid (SEQ ID NO:2) of encoding.Its expression product does not find homology sequence in higher plant.Be positioned on the film according to the TargetP ZmFDR4 albumen most probable that predicts the outcome; YNB, no amino acid or ammonium sulfate) 0.67g, glucose (Glucose; Being made into 40%detrose storage liquid sterilizes separately; 4 ℃ of preservations) 2g saves mixtures such as nutraceutical amino acid (lacking uridylic) (preparing with the mother liquor form), agar (Bacto-agar) 2g.) carry out the screening of transformant on the flat board.
Four, allos complementary function checking
DEY1453 (fet3fet4) is the low affine system FET4 that yeast iron absorbs; And sudden change has taken place in the gene of high affine system FET3-FTR; Make mutant yeast in the limit (iron deficiency) substratum, can not grow; But after external source corresponding gene pYES-ZmFDR4 changes over to and expresses, can remedy their function, make yeast to grow.
Can find out by Fig. 3 to add under the iron bar spare that it is similar with the yeast growing way that changes pYES-ZmFDR4 over to change pYES over to, and under different concentration of iron, the difference of zymic growing way neither be clearly.Can see clearly that on the substratum of the sequestrant BPDS that is added with iron the yeast that changes pYES-ZmFDR4 over to looks good than the yeast that changes empty carrier over to, especially under the condition of 15 μ M concentration, even iron level seldom, but yeast has also recovered growth.Explain that ZmFDR4 can effectively transport iron, has recovered the zymic growth.
Sequence table
< 110>Capital Normal University
< 120>cDNA sequence and proteins encoded and the application relevant with the plant iron deficiency
<130>KLPI08078
<160>2
<170>PatentIn version 3.1
<210>1
<211>648
<212>DNA
<213>Zea mays
<400>1
atgaacgccg cgcctgacgt cggttcgctg ctggtcgccg cgctcgcgct ggcggtcctg 60
ccgttcgtgg cgatggtggt cacgtcctac accaagatcg tggtggtgct ggtcctcctg 120
cgcaacgcgc tcgggctgca gggcgtcccg cccaactcgg tcctgaacgg cgtcgccctg 180
atcgtgacgt gcttcgtgat ggcgccggtc ggcatggacg ccatgcaccg cgcgcacctg 240
ccgggcgaaa cggcggccgg ggcccaggtc atgccgctgc tcgacgccgg gcgcgagccc 300
ttccgggcct tcctgaaggc ccatgcgacg gagcgcgaga aggccttctt cctgcgctcg 360
gcgcgccaga tctggccgcc cgggcgcgcg gccgaactca aggaagacga cctgatcgtg 420
ctggcgccgg cgttcatcct gagcgaactc acggccgcct tcaagatcgg tttcctgctg 480
tacctgtcgt tcatcgtgat cgacctcgtc gtcgcgaacg tgctgatcgc gctcggcctg 540
tcgcaggtca gtccgacgaa cgtggcgatt ccgttcaagc tgctgctgtc cgtctcgctc 600
gacggctggt cgatgctggt ccacggcctg atctccacct acaagtga 648
<210>2
<211>215
<212>PRT
<213>Zea mays
<400>2
Met Asn Ala Ala Pro Asp Val Gly Ser Leu Leu Val Ala Ala Leu Ala
1 5 10 15
Leu Ala Val Leu Pro Phe Val Ala Met Val Val Thr Ser Tyr Thr Lys
20 25 30
Ile Val Val Val Leu Val Leu Leu Arg Asn Ala Leu Gly Leu Gln Gly
35 40 45
Val Pro Pro Asn Ser Val Leu Asn Gly Val Ala Leu Ile Val Thr Cys
50 55 60
Phe Val Met Ala Pro Val Gly Met Asp Ala Met His Arg Ala His Leu
65 70 75 80
Pro Gly Glu Thr Ala Ala Gly Ala Gln Val Met Pro Leu Leu Asp Ala
85 90 95
Gly Arg Glu Pro Phe Arg Ala Phe Leu Lys Ala His Ala Thr Glu Arg
100 105 110
Glu Lys Ala Phe Phe Leu Arg Ser Ala Arg Gln Ile Trp Pro Pro Gly
115 120 125
Arg Ala Ala Glu Leu Lys Glu Asp Asp Leu Ile Val Leu Ala Pro Ala
130 135 140
Phe Ile Leu Ser Glu Leu Thr Ala Ala Phe Lys Ile Gly Phe Leu Leu
145 150 155 160
Tyr Leu Ser Phe Ile Val Ile Asp Leu Val Val Ala Asn Val Leu Ile
165 170 175
Ala Leu Gly Leu Ser Gln Val Ser Pro Thr Asn Val Ala Ile Pro Phe
180 185 190
Lys Leu Leu Leu Ser Val Ser Leu Asp Gly Trp Ser Met Leu Val His
195 200 205
Gly Leu Ile Ser Thr Tyr Lys
210 215
Claims (7)
1. cDNA relevant with the plant iron deficiency who from corn (Zea mays) root, separates, clones, it is characterized in that: the nucleotides sequence of this cDNA sequence is classified as shown in the SEQ ID NO:1.
2. by the said cDNA encoded protein of claim 1, it is characterized in that: this proteic aminoacid sequence is shown in the SEQ ID NO:2:
3. the expression vector that contains the said cDNA of claim 1.
4. according to the described expression vector of claim 3, it is characterized in that: this expression vector is plant shuttle expression carrier pBI121-ZmFDR4 or yeast shuttle expression carrier pYES2.0-ZmFDR4; Wherein, described ZmFDR4 nucleotides sequence is classified as shown in the SEQ ID NO:1.
5. the host cell that comprises claim 3 or 4 said expression vectors.
6. the said cDNA of claim 1 coerces the application in the performance at raising plant resistance to iron deficiency.
7. according to the described application of claim 6, it is characterized in that described application comprises: make up the plant expression vector that contains claim 1 or 2 said cDNA; This plant expression vector is transformed in the vegetable cell, said cDNA is expressed in plant.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010101036500A CN101892243B (en) | 2010-01-29 | 2010-01-29 | Complementary deoxyribonucleic acid (cDNA) sequence related to iron deficiency of plant and encoded protein and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010101036500A CN101892243B (en) | 2010-01-29 | 2010-01-29 | Complementary deoxyribonucleic acid (cDNA) sequence related to iron deficiency of plant and encoded protein and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101892243A CN101892243A (en) | 2010-11-24 |
CN101892243B true CN101892243B (en) | 2012-06-13 |
Family
ID=43101588
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2010101036500A Expired - Fee Related CN101892243B (en) | 2010-01-29 | 2010-01-29 | Complementary deoxyribonucleic acid (cDNA) sequence related to iron deficiency of plant and encoded protein and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101892243B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106434698A (en) * | 2013-05-31 | 2017-02-22 | 河北农业大学 | Zea mays zinc-iron regulated transporter ZmZIP3 genes and application thereof |
CN110117596A (en) * | 2019-04-30 | 2019-08-13 | 山东农业大学 | A kind of corn seed grouting controlling gene ZmDef1 and application |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1360466A (en) * | 1999-07-05 | 2002-07-24 | 科学技术振兴事业团 | Construction of rice tolerant to iron deficiency |
CN101280006A (en) * | 2008-05-23 | 2008-10-08 | 中国农业大学 | Protein related to tolerance to Fe deficiency of plant, coding genes and application thereof |
-
2010
- 2010-01-29 CN CN2010101036500A patent/CN101892243B/en not_active Expired - Fee Related
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1360466A (en) * | 1999-07-05 | 2002-07-24 | 科学技术振兴事业团 | Construction of rice tolerant to iron deficiency |
CN101280006A (en) * | 2008-05-23 | 2008-10-08 | 中国农业大学 | Protein related to tolerance to Fe deficiency of plant, coding genes and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN101892243A (en) | 2010-11-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102757969A (en) | Phosphorus transportprotein gene GmPT5 related to phosphorus transport of soybean nodulation and application thereof | |
CN101775070B (en) | Plant stress tolerance correlative protein, encoding gene and application thereof | |
CN109666681A (en) | Plant drought, salt tolerant protein EeCIPK26 and its encoding gene and application | |
CN101892243B (en) | Complementary deoxyribonucleic acid (cDNA) sequence related to iron deficiency of plant and encoded protein and application thereof | |
CN111499759B (en) | Zinc finger protein-lactoferrin fusion protein with cell membrane penetrating property and preparation and application thereof | |
CN107937415A (en) | A kind of potato GATA transcription factors and its cloning process and application | |
CN107299103A (en) | Thick boisiana IpASR genes and its encoding proteins and application | |
CN104480120B (en) | Plant salt tolerance related gene PpSIG2 and its encoding proteins and application | |
CN108795894A (en) | Tobacco POD63 albumen, encoding gene and its application in the reaction of tobacco salt stress | |
CN104561036B (en) | Plant salt tolerance related gene PpSIG1 and its encoding proteins and application | |
CN104530204B (en) | A kind of rape cecropin B gene nPRP1 and its application | |
CN104744577B (en) | Beauveria bassiana antibacterial protein Bbafp and its expression vector, genetically modified plants containing its gene preparation method and application | |
CN106432449A (en) | Protein VPS23A related to drought tolerance of plants, encoding gene of protein VPS23A and application | |
CN1475496A (en) | Soybean ethylene response protein transcription factor and its coded gene and application | |
CN112409467B (en) | Application of plant stress tolerance related protein GmDof41 in regulation and control of plant stress tolerance | |
CN101260403A (en) | Plant strong salt-resistant gene AtNHXS1 and its coding protein and application | |
CN107602686A (en) | A kind of polypeptide resistant to gram-positive bacteria | |
CN110885849B (en) | Recombinant vector, host cell and application of Ustilaginoidea virens effector protein | |
CN102417899A (en) | Metallic cadmium resistance associated protein KdpD and coding gene and application thereof | |
CN106916213A (en) | A kind of albumin A sT and its encoding gene and the application in plant stress tolerance | |
CN103525825A (en) | Clone of plant manganese poison-resistant important gene ShMDH1 and application thereof | |
CN109796525A (en) | CSEP27 albumen and its encoding gene and application | |
CN111893134B (en) | Application of OXS2 gene and encoding protein thereof in improving salt stress resistance of plants | |
CN104844699B (en) | Soybean GmNEK1 albumen and its encoding gene and application | |
CN108192919A (en) | A kind of method for cultivating drought resisting transgene cotton |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120613 Termination date: 20160129 |
|
EXPY | Termination of patent right or utility model |