CN111893134B - Application of OXS2 gene and encoding protein thereof in improving salt stress resistance of plants - Google Patents

Abstract

The invention discloses an application of an OXS2 gene and a protein coded by the same in improving salt stress resistance of plants, wherein the invention discovers OXS2^AT3When the protein is expressed in large amount in arabidopsis, the salt resistance of arabidopsis can be specifically enhanced. Arabidopsis OXS2 was also found^AT3The salt stress resistance is improved by up-regulating the expression quantity of the salt stress response gene, so that the gene fragment has great potential to be applied to the cultivation of transgenic crops with salt resistance, and the yield of grain crops is improved. Compared with the prior art, the method only overexpresses the C-terminal short segment of the OXS2, and is easier to operate.

Description

Application of OXS2 gene and encoding protein thereof in improving salt stress resistance of plants

Technical Field

The invention belongs to the field of molecular biology, and particularly relates to an application of an OXS2 gene and a coding protein thereof in improving salt stress resistance of plants.

Background

Saline-alkali soil refers to the condition that the conductivity of saturated leaching liquor of root zone is more than 4dS m at the temperature of 25 DEG C^-1(equivalent to 40mM NaCl) and 15% sodium exchangeable. The causes of soil salinization are many, and the soil salinization can be mainly divided into two categories: one is due to environmental factors; another is due to human activity. Environmental factors include temperature, precipitation, and soil moisture content. The salinization of soil caused by environmental factors is mainly because the salinity of the soil bottom layer is brought to the soil surface along with the evaporation of water under the high-temperature condition, and the salinity is continuously accumulated to cause the salinization of the soil. The salinization of soil caused by human activities mainly comprises excessive use of chemical fertilizers, unreasonable agricultural irrigation and large accumulation of salt components caused by illegal discharge of factories.

Salt stress adversely affects the germination, vegetative growth and reproductive growth of plants. The sodium ions and chloride ions which are greatly increased in the soil under the salt stress compete with other nutrient elements such as zinc, calcium and potassium, and the absorption of the elements by plants is blocked, so that the plant nutrient stress is caused. High concentrations of salt can form osmotic stress, causing the plant to absorb water from the soil to be hindered, causing water shortage in the plant. In addition to these visible hazards, salt stress can adversely affect the physiological and biochemical processes of plants. Sodium ions and chloride ions can change the spatial structure of some proteins and influence the exertion of functions of the proteins. Some biochemical reactions requiring potassium ions to participate cannot be normally performed after being replaced by sodium ions.

According to the existing research, about 2 hundred million acres of saline-alkali soil have agricultural utilization potential in practice, so that the economic benefit and social benefit created by the saline-alkali soil can not be estimated if the saline-alkali soil can be used for planting food crops efficiently. Therefore, the salt resistance mechanism of the plant is deeply researched, and the research result is used for cultivating the salt-resistant crops, so that the significance is great.

Disclosure of Invention

The invention aims to disclose the application of the OXS2 gene in improving the salt stress resistance of plants;

Another objective of the invention is to disclose application of the OXS2 gene in preparing a preparation for up-regulating the expression quantity of a salt stress response gene.

The technical scheme adopted by the invention is as follows:

in a first aspect of the present invention, there is provided:

application of the OXS2 gene in improving salt stress resistance of plants.

Wherein the OXS2 gene is specifically an AT3 fragment of OXS2 gene (OXS 2)^AT3)。

The OXS2^AT3The nucleotide sequence of (a) is:

5’-ATGTTGTCTCCAATCAACACAAGCTTTTCTTCACCAAAGAGCGTTGACCACTCATTGTTTTCAGGTGGAGGAAGAATGTCTCCTCGGAATGTTGTTGAACCAATATCACCCATGAGTGCTCGGGTTTCCATGTTGGCTCAGTGCGTGAAGCAACAACAACAGCAACAGCAGCAGCAGCAGCAGCAACATCAGTTCCGTAGCCTTAGCTCCAGAGAGCTCAGAACAAACTCTAGCCCAATCGTTGGTTCACCGGTAAACAACAACACATGGTCATCAAAATGGGGATCTTCAAATGGTCAACCGGATTGGGGAATGAGCTCAGAAGCACTTGGTAAGTTGAGATCTTCGTCATCGTTTGATGGTGATGAGCCTGATGTGTCATGGGTCCAGTCACTGGTGAAGGAGACTCCAGCAGAAGCCAAAGAGAAAGCAGCAACATCTTCCTCAGGGGAACACGTGATGAAGCAGCCAAATCCGGTTGAACCGGTAATGGATCATGCTGGGCTAGAAGCTTGGATTGAGCAAATGCAGCTCGATCAGCTTGTGGCTCAGCAGAATTGA-3’(SEQ ID NO.1)。

further, the sequence of the encoded protein of the OXS2 gene comprises:

(1) an amino acid sequence shown as SEQ ID NO. 2; or

(2) The amino acid sequence shown in SEQ ID NO.2 is an amino acid sequence which is subjected to substitution, deletion and/or addition of one or more amino acids and/or modification and has the function of improving the salt resistance of plants.

The amino acid sequence shown in SEQ ID NO.2 is specifically:

MetLeuSerProIleAsnThrSerPheSerSerProLysSerValAspHisSerLeuPheSerGlyGlyGlyArgMetSerProArgAsnValValGluProIleSerProMetSerAlaArgValSerMetLeuAlaGlnCysValLysGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnHisGlnPheArgSerLeuSerSerArgGluLeuArgThrAsnSerSerProIleValGlySerProValAsnAsnAsnThrTrpSerSerLysTrpGlySerSerAsnGlyGlnProAspTrpGlyMetSerSerGluAlaLeuGlyLysLeuArgSerSerSerSerPheAspGlyAspGluProAspValSerTrpValGlnSerLeuValLysGluThrProAlaGluAlaLysGluLysAlaAlaThrSerSerSerGlyGluHisValMetLysGlnProAsnProValGluProValMetAspHisAlaGlyLeuGluAlaTrpIleGluGlnMetGlnLeuAspGlnLeuValAlaGlnGlnAsn(SEQ ID NO.2)。

further, the OXS2 gene up-regulated the expression of COR15A, COR47, RD29B, KIN1, ACS2 and ACS6 proteins in the plants.

Still further, the plant includes Arabidopsis thaliana.

The arabidopsis thaliana is a model organism for researching the physiological and biochemical mechanism of plants, and can provide clues and theoretical bases for the research of the salt-resistant mechanism of other food crops and economic crops through the research of the salt-resistant mechanism of the arabidopsis thaliana.

Of course, other food crops may reasonably include any one of corn, rice, and wheat, and commercial crops such as cotton, as will be appreciated by those skilled in the art.

Furthermore, the method for improving the salt resistance of the plant comprises the step of transferring the nucleotide sequence shown in SEQ ID NO.1 into a receptor plant to obtain a transgenic plant.

Furthermore, the method for improving the salt resistance of the plant further comprises the step of transferring the recombinant vector, the recombinant bacterium or the transgenic cell line containing the sequence shown in SEQ ID NO.1 into a receptor plant to obtain a transgenic plant.

In a second aspect of the present invention, there is provided

Use of the OXS2 gene in the preparation of a formulation for up-regulating the expression level of a salt stress responsive gene.

Further, the above salt stress response genes include COR15A, COR47, RD29B, KIN1, ACS2, and ACS 6.

The invention has the beneficial effects that:

OXS2 in the invention^AT3When the protein is expressed in large amount in arabidopsis, the salt resistance of arabidopsis can be specifically enhanced. Therefore, the gene fragment has great potential to be applied to culturing transgenic crops with salt resistance, thereby improving the yield of food crops. Compared with the traditional technology, the test has the advantage that the resistance of arabidopsis thaliana to salt stress can be improved by only over-expressing the C-terminal short fragment of the OXS2 instead of expressing the complete gene.

Drawings

FIG. 1 is an agarose gel electrophoresis of the PCR product of the present invention;

FIG. 2 shows OXS2^AT3The positional relationship of the fragment and the OXS2 gene;

FIG. 3 shows OXS2^AT3Map of the effect of diamide resistance after cloning into the yeast expression vector pART 1;

FIG. 4 shows wild type and transgenic lines under normal growth conditions (A) and treated with 150mM NaCl (B); col as background for overexpression of OXS2^AT3Growth state comparison of roots of transgenic Arabidopsis thaliana (C);

FIG. 5 is OXS2 under salt stress treatment conditions^AT3Expression levels of COR15A, COR47, RD29B, KIN1, ACS2 and ACS6 in GFP overexpressing strains.

Detailed Description

In order to make the objects, technical solutions and technical effects of the present invention more clear, the present invention will be described in further detail with reference to specific embodiments. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention.

The experimental materials and reagents used are, unless otherwise specified, all consumables and reagents which are conventionally available from commercial sources.

The molecular biology experimental techniques used in the following examples include PCR amplification, plasmid extraction, plasmid transformation,

The ligation of DNA fragments, digestion, gel electrophoresis, etc., unless otherwise specified, are generally carried out according to conventional procedures, specifically, see molecular cloning, A laboratory Manual (third edition) (Sambrook J, Russell DW, Janssen K, Argentine J. Huangpetang et al, 2002, Beijing: scientific Press), or according to conditions recommended by the manufacturer.

Experimental materials

The present invention uses wild type Arabidopsis thaliana (Arabidopsis thaliana, Columbia (Col-0) ecotype).

Preparation of transgenic Arabidopsis thaliana

The wild type arabidopsis seeds are washed 4 times with sterile water for 5 minutes each time, then put into a refrigerator at 4 ℃ for vernalization for 3 days, and are sowed in a plastic box mixed with nutrient soil and vermiculite (the volume ratio of the nutrient soil to the vermiculite is 1: 1) to be watered and cultured regularly until the seeds bloom, and then the seeds are used for gene transformation. Using electrotransfer method to carry out electrotransfer with OXS2^AT3The expression vector pCambia1300 of the gene was introduced into Agrobacterium tumefaciens GV 3101. Agrobacterium resistant to rifampicin and kanamycin was screened for colony PCR. Selecting positive colony, shaking, propagating, and staining Arabidopsis thaliana by using a floral dip method. Screening seeds of T0 (T1 generation seedlings) on 1/2MS culture medium containing 35 mu g/mL hygromycin (Hyg), extracting DNA from leaves of T1 generation and Col wild type plants, performing PCR identification by taking the wild type as negative control, selecting positive plants to obtain about ten T1 generation transgenic lines in total, and screening single site of the transgenic arabidopsis thaliana by segregation ratioInserting homozygote seeds for preservation, randomly selecting 2 strains from the homozygote seeds as materials for subsequent research, and then carrying out resistance detection. We performed RT-PCR verification on all independent strains as research materials, and found that transgenes all have higher expression.

Resistance detection in yeast

3-5 monoclonals with more consistent growth states and proper size are picked and put into a 3ml EMM liquid screening culture medium, and are fully dispersed and uniformly mixed. The culture was carried out at 250rpm, 30 ℃ and overnight. The stock solution from the overnight culture was diluted to an OD of 0.15, 250rpm, 30 ℃ and shaken on a shaker for 4-5 hours to give an OD of about 0.3. Diluting yeast solution of 0.3OD to 1/10, 1/100, 1/1000 times of different concentration gradient, respectively, and sequentially dripping 3 μ L of solution to contain diamide (diamine) and H with different concentrations₂O₂EMM solid screening medium for Cd. Culturing at 30 deg.C for 5-7 days.

OXS2^AT3Cloning of genes

Using arabidopsis thaliana Col-0 as material, extracting its RNA, making reverse transcription into cDNA, using its cDNA as template, designing primer clone OXS2^AT3. A High-Fidelity DNA Polymerase (High-Fidelity DNA Polymerase) PCR reaction system is utilized. 50 μ l of the PCR product was analyzed by electrophoresis on a 1% agarose gel as described in FIG. 1. Sequencing the target band to obtain OXS2^AT3The nucleotide sequence of the gene is shown as SEQ ID NO.1, and the protein sequence coded by the gene is shown as SEQ ID NO. 2.

TABLE 1 PCR primers

Primer name	Sequences (5 'to 3')
		OXS2AT3-F	ATGTTGTCTCCAATCAACACAAGC(SEQ ID NO.3)
OXS2AT3-R	TCAATTCTGCTGAGCCACAAGCTGATC(SEQ ID NO.4)

Arabidopsis OXS2^AT3Information

As shown in FIG. 2, OXS2^AT3The fragment is located 3' to the OXS2, with a nuclear export signal.

Arabidopsis OXS2^AT3Resistance detection in yeast

We will OXS2^AT3Cloned into yeast expression vector pART1, and transformed into yeast. As shown in FIG. 3, overexpression of OXS2 in Yeast^AT3The resistance of the yeast to the diamide can be enhanced. Since the chemical diamide is able to directly cause the oxidation reaction, OXS2^AT3It is possible to play a role in the oxidative stress response mechanism.

Arabidopsis OXS2^AT3Resistance detection in Arabidopsis

To further validate OXS2 in plants^AT3Function in plants, they were transformed into arabidopsis thaliana for resistance testing. About 10 cols-background OXS2 plants were obtained by inflorescence infection method^AT3Independent lines overexpressing transgenic Arabidopsis. Through segregation ratio, screening the single-site insertion homozygote seeds of the transgenic arabidopsis thaliana for storage, and randomly selecting 2 strains from the seeds as materials for subsequent research.

RT-PCR verification is carried out on all independent strains serving as research materials, and the transgenes are found to have higher expression. Subsequently, these transgenic Arabidopsis thaliana (OXS 2)^AT3) Salt stress was treated with its wild type control. As shown in FIG. 4, under normal growth conditions, wild type and transgenic lines grew in agreement. OXS2 was overexpressed in the context of Col when treated with 150mM NaCl ^AT3The root growth state of the transgenic Arabidopsis thaliana is obviously better than that of the wild type.

Arabidopsis OXS2^AT3Increasing resistance to salt stress by up-regulating expression level of salt stress responsive gene

The qRT-PCR results showed that under salt stress treatment conditions, OXS2^AT3The expression level of COR15A, COR47, RD29B, KIN1, ACS2 and ACS6 in the GFP over-expression strain was significantly higher than that of the strain expressing GFP (FIG. 5). This illustrates Arabidopsis OXS2^AT3It is possible to increase the resistance to salt stress by up-regulating the expression level of a salt stress responsive gene.

The results showed that large amounts of OXS2 were expressed in Arabidopsis^AT3The gene can specifically enhance the salt stress resistance of arabidopsis thaliana. Therefore, the gene fragment has great potential to be applied to culturing transgenic crops with stress resistance characters, thereby improving the yield of food crops.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> south China plant garden of Chinese academy of sciences

<120> OXS2 gene and application of protein coded by same in improving salt stress resistance of plants

<130>

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 561

<212> DNA

<213> OXS2

<400> 1

atgttgtctc caatcaacac aagcttttct tcaccaaaga gcgttgacca ctcattgttt 60

tcaggtggag gaagaatgtc tcctcggaat gttgttgaac caatatcacc catgagtgct 120

cgggtttcca tgttggctca gtgcgtgaag caacaacaac agcaacagca gcagcagcag 180

cagcaacatc agttccgtag ccttagctcc agagagctca gaacaaactc tagcccaatc 240

gttggttcac cggtaaacaa caacacatgg tcatcaaaat ggggatcttc aaatggtcaa 300

ccggattggg gaatgagctc agaagcactt ggtaagttga gatcttcgtc atcgtttgat 360

ggtgatgagc ctgatgtgtc atgggtccag tcactggtga aggagactcc agcagaagcc 420

aaagagaaag cagcaacatc ttcctcaggg gaacacgtga tgaagcagcc aaatccggtt 480

gaaccggtaa tggatcatgc tgggctagaa gcttggattg agcaaatgca gctcgatcag 540

cttgtggctc agcagaattg a 561

<210> 2

<211> 186

<212> PRT

<213> OXS2

<400> 2

Met Leu Ser Pro Ile Asn Thr Ser Phe Ser Ser Pro Lys Ser Val Asp

1 5 10 15

His Ser Leu Phe Ser Gly Gly Gly Arg Met Ser Pro Arg Asn Val Val

20 25 30

Glu Pro Ile Ser Pro Met Ser Ala Arg Val Ser Met Leu Ala Gln Cys

35 40 45

Val Lys Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln His Gln

50 55 60

Phe Arg Ser Leu Ser Ser Arg Glu Leu Arg Thr Asn Ser Ser Pro Ile

65 70 75 80

Val Gly Ser Pro Val Asn Asn Asn Thr Trp Ser Ser Lys Trp Gly Ser

85 90 95

Ser Asn Gly Gln Pro Asp Trp Gly Met Ser Ser Glu Ala Leu Gly Lys

100 105 110

Leu Arg Ser Ser Ser Ser Phe Asp Gly Asp Glu Pro Asp Val Ser Trp

115 120 125

Val Gln Ser Leu Val Lys Glu Thr Pro Ala Glu Ala Lys Glu Lys Ala

130 135 140

Ala Thr Ser Ser Ser Gly Glu His Val Met Lys Gln Pro Asn Pro Val

145 150 155 160

Glu Pro Val Met Asp His Ala Gly Leu Glu Ala Trp Ile Glu Gln Met

165 170 175

Gln Leu Asp Gln Leu Val Ala Gln Gln Asn

180 185

<210> 3

<211> 24

<212> DNA

<213> Artificial sequence

<400> 3

atgttgtctc caatcaacac aagc 24

<210> 4

<211> 27

<212> DNA

<213> Artificial sequence

<400> 4

tcaattctgc tgagccacaa gctgatc 27

Claims (3)

1. The application of the OXS2 gene in improving the salt stress resistance of plants;

   the protein sequence coded by the OXS2 gene is shown as SEQ ID NO. 2;

   the method for improving the salt resistance of the plant comprises the steps of transferring the nucleotide sequence shown in SEQ ID NO. 1 into a receptor plant to obtain a transgenic plant;

   the plant is Arabidopsis thaliana.
2. 2. The use as claimed in claim 1, wherein the OXS2 gene upregulates expression of COR15A, COR47, RD29B, KIN1, ACS2 and ACS6 proteins in said plant.
3. 3. The use of claim 1, wherein the method for improving the salt tolerance of a plant further comprises transferring a recombinant vector, a recombinant bacterium or a transgenic cell line comprising the sequence of SEQ ID No. 1 into a recipient plant to obtain a transgenic plant.

Images