CN107937415A - A kind of potato GATA transcription factors and its cloning process and application - Google Patents
A kind of potato GATA transcription factors and its cloning process and application Download PDFInfo
- Publication number
- CN107937415A CN107937415A CN201711441863.2A CN201711441863A CN107937415A CN 107937415 A CN107937415 A CN 107937415A CN 201711441863 A CN201711441863 A CN 201711441863A CN 107937415 A CN107937415 A CN 107937415A
- Authority
- CN
- China
- Prior art keywords
- potato
- gata transcription
- transcription factors
- positive
- gata
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Nutrition Science (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
It is an object of the invention to provide a kind of potato GATA transcription factors and its encoding proteins, including nucleotide sequence and amino acid sequence as shown in sequence table SEQ NO.1 and NO2, the potato GATA transcription factors are to be extracted by PCR method.Present invention also offers the primer of clone's potato GATA transcription factors, the cloning process with the nucleotide sequence as shown in sequence table SEQ NO.3~SEQ NO.6 with potato GATA transcription factors.The transgenic positive strain that the present invention filters out shows the merits such as potato wedge increase, chlorophyll content increase and content of starch increase, compared with the control significant difference.
Description
Technical field
The invention belongs to genetic engineering field, and in particular to a kind of potato GATA transcription factors and its cloning process are with answering
With.
Background technology
Potato (Solanum tuberosum L.) is Solanaceae (Solanaceac) Solanum (Solanum) perennial herb
Tuberous plant, is to plant and eat in the world the most crop of country, and after Global Agriculture relaying rice, wheat and corn
The fourth-largest crop.Potato occupies critical role as main grain dish dual-purpose type crop in agricultural production.With Ma Ling
Status of the potato in agricultural production and agricultural economy is more important, the breed improvement of potato, and output increased is current breeding work
The important goal of work.
Potato tubers development is a complicated biological process, and by endogenous and extraneous factor common regulation and control.
External factor includes illumination, temperature, nitrogen level etc.；Internal factor includes phytochrome, transcription factor, plant hormone etc..
Bachem etc. has found several genes by expanding the cDNA am-plified fragments length polymorphism analysis in each stage to potato tubers
Play a role in stem tuber expands.Genetic transcription situation carries out before and after Liu Jun induces Tuberous root using differential display technique
Preliminary analysis, finds have multiple transcription products to show difference before and after stem tuber induction.These are the results show that tuber character and development
It is related to the continuous expression of series of genes, these genes may play different regulating and controlling effects in the different phase that stem tuber induces,
The growth and development of equilibrium state, cell including adjusting endogenous hormones, accumulation of stem tuber inclusion etc..
GATA transcription factors are a kind of transcription factors being widely present in eukaryote, and GATA transcription factors have zinc finger
Structure, is one of member of zinc finger protein family, can identify and specifically bind DNA sequence dna.Regulation and control the flowering of plant time,
Play a significant role in the biological process such as vane extension growth, Floral development and photoperiod and light signal transduction, these lifes
Thing process and growth and development of plants are closely bound up.Effect of the GATA classes transcription factor in the secondary metabolism of plant, main body
The processes such as present Chlorophyll synthesis and carbon and nitrogen metabolism adjusting, these biological processes and crop yield are closely bound up, to GATA family
The research of race can provide certain theoretical foundation for crop yield.
The content of the invention
In view of this, it is an object of the invention to provide a kind of potato GATA transcription factors, including such as sequence table SEQ
Nucleotide sequence shown in NO.1.
Preferably, in potato GATA transcription factors of the present invention, the potato GATA transcription factors coding
Albumen has the amino acid sequence as shown in sequence table SEQ NO.2.
Preferably, in potato GATA transcription factors of the present invention, the potato GATA transcription factors are to pass through
PCR method extraction.
Another object of the present invention is to provide clone's primer of potato GATA transcription factors, the primer point of the PCR
Ju You not be such as the nucleotide sequence shown in sequence table SEQ NO.3~SEQ NO.6：
TMF:5’-AGCGAACTCTGCGTTCCGTTTGATGACTTGGCTGAGC-3’(SEQ NO.3)
TMR:5’-GCTCAGCCAAGTCATCAAACGGAACGCAGAGTTCGCT-3’(SEQ NO.4)
TF:5’-AGAGGTAATAAAAGATGCTT-3’(SEQ NO.5)
TR:5 '-TTAAAATGAATCTATAAATTA-3 ' (SEQ NO.6) a further object of the present invention is to provide Ma Ling
The cloning process of potato GATA transcription factors, comprises the following steps：
1) potato GATA transcription factor genes are cloned；
2) structure includes the expression vector of potato GATA transcription factor genes；
3) the expression vector conversion Agrobacterium is utilized；
4) the Agrobacterium infection potato slices of conversion are used, positive potato strain is screened after regeneration induction, will obtain
Positive strain be transferred to root media obtain transgenic potato positive strain.
Preferably, in the cloning process of potato GATA transcription factors of the present invention, the step 1) is：Extract horse
Bell potato total serum IgE, by mRNA reverse transcriptions is total cDNA using kit, respectively using have respectively as sequence table SEQ NO.3~
The primer of nucleotide sequence shown in SEQ NO.7 carries out PCR amplification, as template after the product after amplification is mixed in equal volume,
Expanded using SEQ NO.6, SEQ NO.7 as primer, amplified production is potato GATA transcription factor genes；
Preferably, in the cloning process of potato GATA transcription factors of the present invention, the step 2) is：By step
1) the potato GATA transcription factor genes obtained, are cloned into pMD-18T carriers, use Escherichia coli screening positive clone；
The primer both sides of the potato GATA transcription factor genes of amplification add Nde I/Xba I restriction enzyme sites respectively, with potato RNA
PCR amplification is carried out for template, and amplified production is cloned into pMD-18T carriers, Plasmid DNA is extracted after obtaining positive strain, profit
The Plasmid DNA of target gene total length is carried with Nde I/Xba I double digestions, while is expressed with Nde I/Xba I double digestions plant
Carrier, with 1 after respective digestion products are recycled:2 mass ratio mixes, and after ligase connection processing, converts Escherichia coli
DH5 α competence screening positive clones, obtain recombinant expression carrier；
Preferably, in the cloning process of potato GATA transcription factors of the present invention, the step 3) is：Utilize step
The recombinant plasmid transformed Agrobacterium of the rapid expression vector for 2) including structure, screens the positive Agrobacterium of conversion；
Preferably, in the cloning process of potato GATA transcription factors of the present invention, the step 4) is：By the positive
Cultivated in Agrobacterium liquid medium within, dip dyeing conversion potato explant, the potato explant is being screened containing Kan
After differential medium culture, root induction in root media is transferred to, completes the regeneration of potato plant, and identifies positive plant
To obtain the final product.
Therefore, the non-reproductive part of the Transgenic Potato Plants obtained present invention also offers the above method.
Proved by the following embodiment of the present invention, the positive strain filtered out and control strain are cultivated, tied
Fruit finds that the merit such as the increase of transgenic positive strain performance potato wedge, chlorophyll content increase and content of starch increase is and right
Significant difference is compared in photograph.
Brief description of the drawings
Fig. 1 is the albumen and other plant affiliation schematic diagram of potato GATA transcription factors coding；
Fig. 2 is potato GATA transcription factor transgenic samples PCR detection figures；
Comparison diagram after Fig. 3 is cultivated 20 days for the Y5-CK in one embodiment of the present of invention and Y5-6；
Fig. 4 is the transgenic line Potato microtuber figure in one embodiment of the present of invention.
Embodiment
The gene that the present invention clones is named as StGATA12, can by agrobcterium-mediated transformation or its
The transfer-gen plant or strain that in gene transferred plant, are obtained by screening and identification are belonged to the present invention's by his transgenic method
Protection domain.The present invention by potato body the overexpression gene can shift to an earlier date the ripe phase of potato tubers, improve horse
Bell potato yield, it belongs to the scope of protection of the invention in the application of increase content of starch and degeneration-resistant aspect.
Below in conjunction with the embodiment in the present invention, the technical solution in the present invention is clearly and completely described.It is aobvious
So, described embodiment is only part of the embodiment of the present invention, instead of all the embodiments.Based on the reality in the present invention
Apply example, those of ordinary skill in the art's all other embodiments obtained without making creative work, all belong to
In the scope of protection of the invention.
1 potato GATA transcription factor StGATA12 gene clonings of embodiment
Using Overlap round pcrs, potato has been cloned in the separation from potato cultivar ' Gansu Province potato 3 ' to the present invention
GATA transcription factor StGATA12,
TMF:5’-AGCGAACTCTGCGTTCCGTTTGATGACTTGGCTGAGC-3’
TMR:5’-GCTCAGCCAAGTCATCAAACGGAACGCAGAGTTCGCT-3’
TF:AGAGGTAATAAAAGATGCTT
TR:TTAAAATGAATCTATAAATTA
Amplification method is：Potato leaf total serum IgE first is extracted with kit, detailed process is referring to specification, then with anti-
MRNA reverse transcriptions are that total cDNA detailed processes are divided referring to specification, then as template by transcript reagent box (being purchased from Tiangeng company)
Be that primer carries out PCR amplification not with TF, TMR and TMF, TR, using after amplification product in equal volume mix after be used as template, with TF with
TR is expanded for primer, and amplified production is StGATA12 full length genes, and product is detected as single through 1% agarose gel electrophoresis
After band, target stripe is recycled with plastic recovery kit (being purchased from Tiangeng company), pMD-18T carriers is cloned into and (is purchased from Takara
Company), take 5uL connection products thermal shock to convert bacillus coli DH 5 alpha competence, be coated on newly configure contain ampicillin/different
The LB solids of the chloro- 3- indyls-B-D- galactosides (Amp/IPTG/X-gal) of propyl group-β-D- thiogalactosides/bromo- 4- of 5-
On tablet, 37 DEG C of overnight incubations select that hickie is some, in the LB liquid medium containing Amp50mg/L, in 37 DEG C of 180r/
Min shaken cultivations to muddiness, are detected with TF and TR primers overnight, and whether detection bacterium solution is positive, send three positive colonies
Examining order is completed to Shanghai Sheng Gong biotech companies.
Sequencing result shows that the gene order contains the open reading frame that a total length is 1407bp, and coding one is by 436
A amino acid residue is formed, molecular weight 53417.2Da, and theoretical isoelectric point is 7.09 albumen, contains C-X2-C-X18-C-X2-
C Zinc finger domains.The affiliation of the albumen and other plant is shown in attached drawing 1.
The expression vector establishments of 2 potato GATA transcription factor StGATA12 genes of embodiment
Nde I/Xba I restriction enzyme sites are added respectively in the primer both sides of the StGATA12 genes of amplification, with what is built
PMD-18T carriers carry out PCR amplification for template, and amplified production is cloned into pMD-18T carriers, and specific steps are shown in the present invention's
StGATA12 gene clonings part.Shift to an earlier date Plasmid DNA after obtaining positive strain, it is purposeful using Nde I/Xba I double digestion bands
The Plasmid DNA of full length gene, while with Nde I/XbaI double digestion plant expression vectors pcambia1302, respective digestion production
Thing recycles target stripe after 1% agarose gel electrophoresis with plastic recovery kit (be purchased from Tiangeng company), and by target gene
Fragment is with pcambia1302 carrier segments with 1:2 ratio mixing, add T4DNA ligases (being purchased from Promga companies) 1U, 1
× reaction buffer, sterile water supplement branch 10uL withdraw deposit, and 4 DEG C of connections overnight, take 5uL connection products to carry out thermal shock conversion large intestine bar
Bacterium DH5 α competence, is coated on containing screening positive clone on kanamycins (Km) 50mg/L resistance plates and digestion detection, knot
Fruit sees Fig. 2, wherein 1.Marker, and 2. positive controls, 3. negative controls, 4-16. transgenic resistance strains, meet as seen from Figure 2
Clip size is expected in digestion.
To the recombinant plasmid of acquisition using thermal shock conversion method conversion Agrobacterium GV3101, with containing rifampin (Rif)
100mg/L, blocks the positive spot of LB solid resistances plate screening conversion of that (Km) 50mg/L, several positive spots of picking are in containing sharp good fortune
Flat (Rif) 100mg/L, blocks in the LB fluid nutrient mediums of that (Km) 50mg/L 28 DEG C, 180r/min overnight incubations, take 1uL to do mould
Plate carries out the PCR detections of recombinant plasmid, and the bacterial strain preservation for confirming as the positive is used for follow-up genetic transformation.
The genetic transformation of 2 potato GATA transcription factor StGATA12 genes of embodiment
Picking single bacterium colony is inoculated in containing 50mgL-1In the 50ml LB fluid nutrient mediums of Kan, 28 DEG C of constant-temperature table,
After 180rpm shaken cultivations 24h, converted for disseminating.Sterile test tube potato is cut into the thin slice of 1-2mm or so, immerses Agrobacterium bacterium
15min is disseminated in liquid.After taking-up, aseptic filter paper blots bacterium solution and is transferred to co-cultivation base (the MS+0.45% fine jades for being covered with layer 2-3 filter paper
The sucrose of fat+3%) in, carry out the dark culturing of 48h.500mgL is used after light culture-1Cef sterile water wash Potato microtuber thin slices
3-4 times, sterile water wash 2-3 times, gently rocking in cleaning process makes its cleaning abundant, after with aseptic filter paper be sufficiently absorbed through explant
The moisture in body surface face, is transferred into culture medium (MS bases+3% sucrose+NAA0.2mg/ of+0.45% agar of the screening containing Kan
ML+400mg/L cef+50mg/Lkm, ph 5.8) in, it is placed in intensity of illumination 2000lux, photoperiod 8h/d, the bar that 24 DEG C of temperature
Culture is until resistance shoot regeneration under part.(MS basis+0.45% fine jade is transferred in root media when resistant buds break up to 2-4cm
Sucrose+the NAA0.2mg/mL+50mg/LKm+200mg/L of fat+3% cef, ph 5.8) root induction, so as to complete potato plant
The regeneration of strain.Extraction regeneration strain DNA, designs primer, carries out PCR amplification as template to regenerate strain DNA, identifies positive strain
System.
The positive strain filtered out and control strain Y5-CK are transferred in root media for control, are placed in intensity of illumination
2000lux, photoperiod 8h/d, and Stem covered by vermiculite culture medium (MS bases+8% sucrose+3mg/L 6-BA of+0.45% agar)
In, it turns out that, transgenic positive strain Y5-5, Y5-9, Y5-11 show potato wedge increase, chlorophyll as shown in Table 1 to Table 3
The merits such as content increases and content of starch increases, compared with the control, tri- strain differences of Y5-6, Y5-9, Y5-12 are notable.
Wherein, as shown in figure 3, Y5-CK and Y5-6 contrasts picture after cultivating 20 days (Y5-CK is control), it is known that positive plant is substantially grown
Gesture；Test tube potato tuber starch content is measured using Iodine colorimetry, is contained using colorimetric determination potato leaf chlorophyll
Amount, and measure Potato microtuber list potato weight.As shown in figure 4, single potato size of transgenic positive strain and weight are apparently higher than compareing
The potato wedge list potato weight of strain.
Potato wedge content of starch of the 1 transgenic positive strain of table with compareing strain
| Numbering | Content of starch mg/g |
| Y5-CK | 45.423 |
| Y5-5 | 67.188 |
| Y5-11 | 65.916 |
| Y5-6 | 57.451 |
| Y5-9 | 55.216 |
| Y5-12 | 47.261 |
2 transgenic positive strain of table is compared with compareing the chlorophyll content of strain
| Numbering | Chlorophyll content mg/g |
| Y5-5 | 0.217 |
| Y5-6 | 0.368 |
| Y5-7 | 0.360 |
| Y5-9 | 0.222 |
| Y5-11 | 0.285 |
| Y5-12 | 0.256 |
| Y5-CK | 0.204 |
3 transgenic positive strain of table is Potato microtuber with the potato wedge list potato weight (harvesting for 60 days) for compareing strain
The above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications also should
It is considered as protection scope of the present invention.
Sequence table
<110>Ningxia Academy of Agri-Forestry Sciences's agricultural biotechnologies research center
<120>A kind of potato GATA transcription factors and its cloning process and application
<130>A Sida
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1427
<212> DNA
<213> Solanum tuberosum
<400> 1
agaggtaata aaagatgctt taaaataata ataaaaatgg tgaggtgtaa ttacgagaaa 60
gaccttcatt acacttatga aaaggcctct gacccggacc ccttactttc agcttttgag 120
cacttgtctg tcctcttcac actcaatgcc ttcattctct cttccttttt ctcagcctcc 180
gattctcctt ataaagaatt agtctcaaac ctaccgttac tttgcgtttt acactccacc 240
attcttacac tacacaccaa caacttcttc ttcttttttc taacaatgga agcatcggat 300
ttattcctta gcggcttttt ctcacatgcc ggagacgaac aaattccgaa taacatcaac 360
aacaacatca ataataataa ctgtaacaat ttttctgtgg atgatctttt ggttatccct 420
aaggaagatg aagttatggc cgacgcattt ttcaacagta ttacaggaaa ttctgctgat 480
tcttccaccg ttaccgtcgt tgacagctgt aattcctctg tttctggtgg agatggacaa 540
tttaacggca acctcagcgg ccgcagcttc accgatgctc ccttccctaa cagcgaactc 600
tgcgttccgt ttgatgactt ggctgagcat gaatggctct caaattttgt ggaggaatca 660
ttctcaagtg acgccgttca aaacctgcag ttcatccctg tagcaaacat taattcctcc 720
accatctcca ccgacagttc ctcctccgca accacatttt ccacaggacc caactcgcca 780
cctgccttcc ccaccgacac ctctgttcct ggcaaagctc gcagcaagcg ctcacgcgcc 840
gctccctgtg actggtcctc acgcctccag ctgctcttat cccctgccac atcatcatca 900
gagagcaaca acatctcgcc tccatctgct aacaacacta ctttcgccac ggccaaagcc 960
accaaagcgc cgtcgaagaa gcgagagagt gtggaaacgc cgggacggaa atgcctgcac 1020
tgtgcttctg ataagacacc acagtggcgc acagggccat taggtccaaa aactctgtgc 1080
aatgcatgtg gagttaggta caagtcaggt aggcttgtgc cggagtatcg accggcgtct 1140
agcccgactt ttatctcagc gaggcactcg aattctcatc ggaaagttct ggagctccgg 1200
aggcaaaagg atctccagag acaccaagca catcaccagc atcaattgct tagtcaaccc 1260
acaattttcg gtgtatcaaa tggtggtgat gaattcctgc ttcatcatca ccaaaattgt 1320
ggtccaaatt tcaggcacct catctagtat cagtcaccta gtgtagggga taactacttt 1380
gcacttttct cgttttaaaa aagtttgaat taacaatccc attttcc 1427
<210> 2
<211> 448
<212> PRT
<213> Solanum tuberosum
<400> 2
Arg Gly Asn Lys Arg Cys Phe Lys Ile Ile Ile Lys Met Val Arg Cys
1 5 10 15
Asn Tyr Glu Lys Asp Leu His Tyr Thr Tyr Glu Lys Ala Ser Asp Pro
20 25 30
Asp Pro Leu Leu Ser Ala Phe Glu His Leu Ser Val Leu Phe Thr Leu
35 40 45
Asn Ala Phe Ile Leu Ser Ser Phe Phe Ser Ala Ser Asp Ser Pro Tyr
50 55 60
Lys Glu Leu Val Ser Asn Leu Pro Leu Leu Cys Val Leu His Ser Thr
65 70 75 80
Ile Leu Thr Leu His Thr Asn Asn Phe Phe Phe Phe Phe Leu Thr Met
85 90 95
Glu Ala Ser Asp Leu Phe Leu Ser Gly Phe Phe Ser His Ala Gly Asp
100 105 110
Glu Gln Ile Pro Asn Asn Ile Asn Asn Asn Ile Asn Asn Asn Asn Cys
115 120 125
Asn Asn Phe Ser Val Asp Asp Leu Leu Val Ile Pro Lys Glu Asp Glu
130 135 140
Val Met Ala Asp Ala Phe Phe Asn Ser Ile Thr Gly Asn Ser Ala Asp
145 150 155 160
Ser Ser Thr Val Thr Val Val Asp Ser Cys Asn Ser Ser Val Ser Gly
165 170 175
Gly Asp Gly Gln Phe Asn Gly Asn Leu Ser Gly Arg Ser Phe Thr Asp
180 185 190
Ala Pro Phe Pro Asn Ser Glu Leu Cys Val Pro Phe Asp Asp Leu Ala
195 200 205
Glu His Glu Trp Leu Ser Asn Phe Val Glu Glu Ser Phe Ser Ser Asp
210 215 220
Ala Val Gln Asn Leu Gln Phe Ile Pro Val Ala Asn Ile Asn Ser Ser
225 230 235 240
Thr Ile Ser Thr Asp Ser Ser Ser Ser Ala Thr Thr Phe Ser Thr Gly
245 250 255
Pro Asn Ser Pro Pro Ala Phe Pro Thr Asp Thr Ser Val Pro Gly Lys
260 265 270
Ala Arg Ser Lys Arg Ser Arg Ala Ala Pro Cys Asp Trp Ser Ser Arg
275 280 285
Leu Gln Leu Leu Leu Ser Pro Ala Thr Ser Ser Ser Glu Ser Asn Asn
290 295 300
Ile Ser Pro Pro Ser Ala Asn Asn Thr Thr Phe Ala Thr Ala Lys Ala
305 310 315 320
Thr Lys Ala Pro Ser Lys Lys Arg Glu Ser Val Glu Thr Pro Gly Arg
325 330 335
Lys Cys Leu His Cys Ala Ser Asp Lys Thr Pro Gln Trp Arg Thr Gly
340 345 350
Pro Leu Gly Pro Lys Thr Leu Cys Asn Ala Cys Gly Val Arg Tyr Lys
355 360 365
Ser Gly Arg Leu Val Pro Glu Tyr Arg Pro Ala Ser Ser Pro Thr Phe
370 375 380
Ile Ser Ala Arg His Ser Asn Ser His Arg Lys Val Leu Glu Leu Arg
385 390 395 400
Arg Gln Lys Asp Leu Gln Arg His Gln Ala His His Gln His Gln Leu
405 410 415
Leu Ser Gln Pro Thr Ile Phe Gly Val Ser Asn Gly Gly Asp Glu Phe
420 425 430
Leu Leu His His His Gln Asn Cys Gly Pro Asn Phe Arg His Leu Ile
435 440 445
<210> 3
<211> 37
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
agcgaactct gcgttccgtt tgatgacttg gctgagc 37
<210> 4
<211> 37
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
gctcagccaa gtcatcaaac ggaacgcaga gttcgct 37
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
agaggtaata aaagatgctt 20
<210> 6
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
ttaaaatgaa tctataaatt a 21
Claims (10)
1. a kind of potato GATA transcription factors, including the nucleotide sequence as shown in sequence table SEQ NO.1.
2. potato GATA transcription factors according to claim 1, it is characterised in that the potato GATA transcription factors
The albumen of coding has the amino acid sequence as shown in sequence table SEQ NO.2.
3. potato GATA transcription factors according to claim 1, it is characterised in that the potato GATA transcription factors
Extracted by PCR method.
4. potato GATA transcription factors according to claim 1, it is characterised in that the primer of the PCR has respectively
Nucleotide sequence as shown in sequence table SEQ NO.3~SEQ NO.6.
5. a kind of cloning process of potato GATA transcription factors, comprises the following steps：
1) potato GATA transcription factor genes are cloned；
2) structure includes the expression vector of potato GATA transcription factor genes；
3) the expression vector conversion Agrobacterium is utilized；
4) the Agrobacterium infection potato slices of conversion are used, positive potato strain are screened after regeneration induction, by the sun of acquisition
Property strain be transferred to root media obtain transgenic potato positive strain.
6. the cloning process of the potato GATA transcription factors described in claim 5, it is characterised in that the step 1) is：Carry
Potato total serum IgE is taken, the use of kit by mRNA reverse transcriptions is total cDNA, respectively using having such as sequence table SEQ NO.3 respectively
The primer of nucleotide sequence shown in~SEQ NO.6 carries out PCR amplification, as mould after the product after amplification is mixed in equal volume
Plate, is expanded using SEQ NO.6, SEQ NO.7 as primer, and amplified production is potato GATA transcription factor genes.
7. the cloning process of the potato GATA transcription factors described in claim 5, it is characterised in that the step 2) is：Will
The potato GATA transcription factor genes that step 1) obtains, are cloned into pMD-18T carriers, use positive gram of Escherichia coli screening
It is grand；Nde I/Xba I restriction enzyme sites are added respectively in the primer both sides of the potato GATA transcription factor genes of amplification, with Ma Ling
Potato RNA carries out PCR amplification for template, and amplified production is cloned into pMD-18T carriers, extract plasmid after obtaining positive strain
DNA, the Plasmid DNA of target gene total length is carried using Nde I/Xba I double digestions, while is planted with Nde I/Xba I double digestions
Thing expression vector, with 1 after respective digestion products are recycled:2 mass ratio mixes, and after ligase connection processing, conversion is big
Enterobacteria DH5 α competence screening positive clones, obtain recombinant expression carrier.
8. the cloning process of the potato GATA transcription factors described in claim 5, it is characterised in that the step 3) is：Profit
Include the recombinant plasmid transformed Agrobacterium of the expression vector of structure with step 2), screen the positive Agrobacterium of conversion.
9. the cloning process of the potato GATA transcription factors described in claim 5, it is characterised in that the step 4) is：Will
Cultivated in positive Agrobacterium liquid medium within, dip dyeing conversion potato explant, the potato explant is sieved containing Kan
After the differential medium culture of choosing, root induction in root media is transferred to, completes the regeneration of potato plant, and identifies the positive
Plant to obtain the final product.
10. the non-reproductive part of the Transgenic Potato Plants obtained according to claim 5~9 any one of them method.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711441863.2A CN107937415B (en) | 2017-12-27 | 2017-12-27 | Potato GATA transcription factor and cloning method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711441863.2A CN107937415B (en) | 2017-12-27 | 2017-12-27 | Potato GATA transcription factor and cloning method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107937415A true CN107937415A (en) | 2018-04-20 |
| CN107937415B CN107937415B (en) | 2020-04-07 |
Family
ID=61939312
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711441863.2A Active CN107937415B (en) | 2017-12-27 | 2017-12-27 | Potato GATA transcription factor and cloning method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107937415B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108660149A (en) * | 2018-05-22 | 2018-10-16 | 山东农业大学 | A kind of potato transgenic method |
| CN111607599A (en) * | 2020-07-03 | 2020-09-01 | 宁夏农林科学院农业生物技术研究中心（宁夏农业生物技术重点实验室） | Potato KNOX transcription factor StKNOX1 gene, coding protein and application thereof |
| CN114621334A (en) * | 2022-03-29 | 2022-06-14 | 安徽省农业科学院园艺研究所 | Application of potato StABI5 gene in drought resistance regulation and method for regulating drought resistance of potatoes based on gene |
| CN116103331A (en) * | 2023-03-10 | 2023-05-12 | 东北农业大学 | Application of SlGATA22 gene in improving cold resistance and disease resistance of tomato plants |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101688180A (en) * | 2007-04-17 | 2010-03-31 | 圭尔夫大学 | Regulate gene and the protein and the adjusting thereof of carbon and nitrogen |
-
2017
- 2017-12-27 CN CN201711441863.2A patent/CN107937415B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101688180A (en) * | 2007-04-17 | 2010-03-31 | 圭尔夫大学 | Regulate gene and the protein and the adjusting thereof of carbon and nitrogen |
Non-Patent Citations (2)
| Title |
|---|
| BOLGER,A.等: "GenBank:HG975442.1", 《NCBI》 * |
| MIHA ´LY KONDRA ´K等: "Transcriptome Analysis of Potato Leaves Expressing the Trehalose-6-Phosphate Synthase 1 Gene of Yeast", 《PLOS ONE》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108660149A (en) * | 2018-05-22 | 2018-10-16 | 山东农业大学 | A kind of potato transgenic method |
| CN111607599A (en) * | 2020-07-03 | 2020-09-01 | 宁夏农林科学院农业生物技术研究中心（宁夏农业生物技术重点实验室） | Potato KNOX transcription factor StKNOX1 gene, coding protein and application thereof |
| CN111607599B (en) * | 2020-07-03 | 2022-02-01 | 宁夏农林科学院农业生物技术研究中心（宁夏农业生物技术重点实验室） | Potato KNOX transcription factor StKNOX1 gene, coding protein and application thereof |
| CN114621334A (en) * | 2022-03-29 | 2022-06-14 | 安徽省农业科学院园艺研究所 | Application of potato StABI5 gene in drought resistance regulation and method for regulating drought resistance of potatoes based on gene |
| CN114621334B (en) * | 2022-03-29 | 2023-11-03 | 安徽省农业科学院园艺研究所 | Application of potato StABI5 gene in drought resistance adjustment and method for adjusting drought resistance of potatoes based on gene |
| CN116103331A (en) * | 2023-03-10 | 2023-05-12 | 东北农业大学 | Application of SlGATA22 gene in improving cold resistance and disease resistance of tomato plants |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107937415B (en) | 2020-04-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111607599B (en) | Potato KNOX transcription factor StKNOX1 gene, coding protein and application thereof | |
| CN107937415A (en) | A kind of potato GATA transcription factors and its cloning process and application | |
| CN110643618B (en) | Jatropha curcas MYB transcription factor JCMYB16 gene and application thereof in improving drought resistance of plants | |
| CN110819607A (en) | Application of CsLYK gene and coding protein thereof in improving citrus canker resistance | |
| CN112876551B (en) | Transcription factor SpbHLH89 for regulating and controlling drought tolerance of tomato and application thereof | |
| CN107164391A (en) | A kind of strawberry floral genes FvbHLH78 and its application | |
| CN105524152B (en) | Rice high-temperature resistant gene and application thereof in crop high-temperature resistant breeding | |
| CN107056911A (en) | A kind of strawberry transcription factor for promoting plant Blooming and its application | |
| CN107299103B (en) | Thick boisiana IpASR gene and its coding albumen and application | |
| CN114014917A (en) | FvbHLH36 protein and coding gene and application thereof | |
| CN112322630A (en) | MsSPL13 gene and application thereof | |
| Chen et al. | Enhance sucrose accumulation in strawberry fruits by eliminating the translational repression of FabZIPs1. 1 | |
| CN113121661B (en) | PtPRP1 gene of populus tomentosa and application thereof | |
| CN114591969B (en) | Drought-resistant gene CrWRKY57 and application thereof in drought-resistant improvement of plants | |
| CN107973844B (en) | Wheat heading period related protein Ta-Hd4A and application thereof | |
| CN114703199B (en) | Plant drought resistance related gene TaCML46 and application thereof | |
| CN110184279A (en) | New a promotion branch development gene SrDREB2A and its expression vector and application in stevia rebaudianum | |
| CN108690127B (en) | Stress-resistance-associated protein TaMYB85 and coding gene and application thereof | |
| CN102559699B (en) | CsCoL1 gene relative to cymbidium sinense photoperiod and application of CsCoL1 gene | |
| CN106554399A (en) | Soybean GmABC albumen and its encoding gene and application | |
| CN109234289B (en) | Method for creating stress-resistant transgenic alfalfa | |
| CN104892740B (en) | Plant stress tolerance correlative protein GmEF13 and its encoding gene and application | |
| CN105131097A (en) | CabuAG gene related to pistil and stamen development of catalpa bungei and protein and application thereof | |
| CN104561040B (en) | Genes For Plant Tolerance hot radical is because of HTT3 and its application | |
| CN101575366B (en) | Rice plant type gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |