CN107937415B

CN107937415B - Potato GATA transcription factor and cloning method and application thereof

Info

Publication number: CN107937415B
Application number: CN201711441863.2A
Authority: CN
Inventors: 甘晓燕; 宋玉霞; 巩檑; 张丽; 陈虞超; 石磊; 聂峰杰; 刘璇
Original assignee: Ningxia Academy Of Agriculture And Forestry Sciences Agricultural Biotechnology Research Center
Current assignee: Ningxia Academy Of Agriculture And Forestry Sciences Agricultural Biotechnology Research Center
Priority date: 2017-12-27
Filing date: 2017-12-27
Publication date: 2020-04-07
Anticipated expiration: 2037-12-27
Also published as: CN107937415A

Abstract

The invention aims to provide a potato GATA transcription factor and a coding protein thereof, which comprise a nucleotide sequence and an amino acid sequence shown as SEQ No.1 and NO2 of a sequence table, wherein the potato GATA transcription factor is extracted by a PCR method. The invention also provides a primer for cloning the potato GATA transcription factor, and a cloning method of the potato GATA transcription factor and a nucleotide sequence shown in the sequence tables of SEQ NO. 3-SEQ NO. 6. The transgenic positive strain screened by the invention shows excellent properties such as increased potato block, increased chlorophyll content and increased starch content, and has obvious difference compared with a control.

Description

Potato GATA transcription factor and cloning method and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a potato GATA transcription factor, and a cloning method and application thereof.

Background

Potato (Solanum tuberosum L.) is a perennial herbaceous tuber plant of the genus Solanum (Solanum) of the family solanaceae (solanaceae), is the largest crop in countries grown and consumed worldwide, and is the fourth largest crop after the world agriculture relay rice, wheat and corn. Potatoes play an important role in agricultural production as main grain and vegetable dual-purpose crops. With the increasing importance of potatoes in agricultural production and agricultural economy, the improvement of varieties and yield of potatoes is an important target of current breeding work.

Potato tuber development is a complex biological process and is regulated by both endogenous and external factors. External factors include light, temperature, nitrogen level, etc.; internal factors include photosensitizers, transcription factors, plant hormones, and the like. Bachem et al found that various genes play a role in tuber expansion by analyzing the length polymorphism of cDNA amplified fragments at various stages of potato tuber expansion. The balance of the genetic transcription of the transgenic tubers in the test tube is obtained by using the balance of genetic transcription of the transgenic tubers in the test tube. These results demonstrate that tuber formation and development involves the continuous expression of a series of genes that may exert diverse regulatory effects at different stages of tuber induction, including regulation of the homeostasis of endogenous hormones, cell growth and development, accumulation of tuber contents, and the like.

The GATA transcription factor is one kind of transcription factor existing widely in eukaryotic plant, has zinc finger structure, is one member of zinc finger protein family, and may be identified and combined specifically with DNA sequence. Plays an important role in regulating and controlling the flowering time of plants, the leaf stretching growth, the flower development, the photoperiod, light signal transduction and other biological processes, and the biological processes are closely related to the growth and development of the plants. The GATA transcription factor has the functions of plant secondary metabolism, including chlorophyll synthesis, carbon and nitrogen metabolism regulation, etc. and these biological processes are closely related to crop yield.

Disclosure of Invention

In view of the above, the present invention aims to provide a potato GATA transcription factor, which comprises a nucleotide sequence shown in SEQ NO.1 of the sequence table.

Preferably, in the potato GATA transcription factor, the protein coded by the potato GATA transcription factor has an amino acid sequence shown in a sequence table SEQ NO. 2.

Preferably, in the potato GATA transcription factor of the present invention, the potato GATA transcription factor is extracted by a PCR method.

The invention also aims to provide primers for cloning the potato GATA transcription factor, wherein the primers for PCR respectively have nucleotide sequences shown in SEQ No. 3-SEQ No.6 of the sequence table:

TMF:5’-AGCGAACTCTGCGTTCCGTTTGATGACTTGGCTGAGC-3’(SEQ NO.3)

TMR:5’-GCTCAGCCAAGTCATCAAACGGAACGCAGAGTTCGCT-3’(SEQ NO.4)

TF:5’-AGAGGTAATAAAAGATGCTT-3’(SEQ NO.5)

5'-TTAAAATGAATCTATAAATTA-3' (SEQ NO.6) it is a further object of the present invention to provide a method for cloning a potato GATA transcription factor, comprising the steps of:

1) cloning a potato GATA transcription factor gene;

2) constructing an expression vector comprising a potato GATA transcription factor gene;

3) transforming agrobacterium with the expression vector;

4) transfecting a potato slice by using the transformed agrobacterium, inducing and regenerating, screening a positive potato strain, and transferring the obtained positive strain into a rooting culture medium to obtain a transgenic potato positive strain.

Preferably, in the method for cloning a potato GATA transcription factor according to the present invention, step 1) is: extracting total RNA of the potatoes, carrying out reverse transcription on the mRNA into total cDNA by using a kit, respectively carrying out PCR amplification by using primers respectively having nucleotide sequences shown in SEQ NO. 3-SEQ NO.7 of a sequence table, uniformly mixing the amplified products in equal volume to be used as a template, and carrying out amplification by using SEQ NO.6 and SEQ NO.7 as primers, wherein the amplified products are potato GATA transcription factor genes;

preferably, in the cloning method of the potato GATA transcription factor, the step 2) is that the potato GATA transcription factor gene obtained in the step 1) is cloned to a pMD-18T vector, and positive clones are screened by using escherichia coli, Nde I/Xba I enzyme cutting sites are respectively added on two sides of a primer of the amplified potato GATA transcription factor gene, potato RNA is used as a template for PCR amplification, an amplification product is cloned to the pMD-18T vector, plasmid DNA is extracted after a positive strain is obtained, the Nde I/Xba I double enzyme is used for cutting the full-length plasmid DNA with a target gene, meanwhile, the Nde I/Xba I double enzyme is used for cutting a plant expression vector, the enzyme cutting products are recovered and then mixed according to the mass ratio of 1:2, and after ligase ligation, escherichia coli DH5 α competent screening positive clones are transformed, so that a recombinant expression vector is obtained;

preferably, in the method for cloning a potato GATA transcription factor according to the present invention, the step 3) is: transforming agrobacterium with the recombinant plasmid of the expression vector constructed in the step 2), and screening transformed positive agrobacterium;

preferably, in the method for cloning a potato GATA transcription factor according to the present invention, the step 4) is: culturing positive agrobacterium in a liquid culture medium, dip-dyeing and transforming a potato explant, culturing the potato explant in a differentiation culture medium containing Kan screening, transferring the potato explant into a rooting culture medium to induce rooting, completing the regeneration of a potato plant, and identifying the positive plant to obtain the potato plant.

Thus, the present invention also provides non-propagating parts of transgenic plants of potato obtained by the above method.

The subsequent examples of the invention prove that the screened positive strains and the control strains are cultured, and the results show that the transgenic positive strains show excellent properties of potato block enlargement, chlorophyll content increase, starch content increase and the like, and have obvious difference compared with the control.

Drawings

FIG. 1 is a schematic representation of the relatedness of a protein encoded by a potato GATA transcription factor to other plants;

FIG. 2 is a PCR assay of transgenic samples of potato GATA transcription factor;

FIG. 3 is a graph showing comparison between Y5-CK and Y5-6 cultured for 20 days in one example of the present invention;

FIG. 4 is a tube potato map of a transgenic line in one embodiment of the present invention.

Detailed Description

The cloned gene is named StGATA12, and may be transferred into plant via agrobacterium mediated genetic transformation or other transgenic process to obtain transgenic plant or strain. The invention can advance the maturing stage of potato tubers and improve the yield of potatoes by over-expressing the gene in the potatoes, and the application of the gene in the aspects of increasing the starch content and resisting stress belongs to the protection range of the invention.

The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. It is to be understood that the described embodiments are merely exemplary of the invention, and not restrictive of the full scope of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1 cloning of the Potato GATA transcription factor StGATA12 Gene

The invention utilizes the Overlap PCR technology to separate and clone the potato GATA transcription factor StGATA12 from the potato cultivar 'Longshu No. 3',

TMF:5’-AGCGAACTCTGCGTTCCGTTTGATGACTTGGCTGAGC-3’

TMR:5’-GCTCAGCCAAGTCATCAAACGGAACGCAGAGTTCGCT-3’

TF:AGAGGTAATAAAAGATGCTT

TR:TTAAAATGAATCTATAAATTA

the amplification method comprises the steps of firstly extracting total RNA of potato leaves by using a kit, wherein the specific process is shown in the specification, then carrying out reverse transcription on mRNA by using a reverse transcription kit (purchased from Tiangen corporation) to obtain the specific process of total cDNA by using TF, TMR, TMF and TR as primers respectively, carrying out PCR amplification on the obtained product by using the obtained product as a template after equal volumes are mixed uniformly, carrying out amplification by using TF and TR as primers, wherein the amplification product is the full length of StGATA12 gene, detecting the obtained product as a single strip by 1% agarose gel electrophoresis, recovering a target strip by using a gel recovery kit (purchased from Tiangen corporation), cloning the target strip to a pMD-18T vector (purchased from Takara corporation), taking a 5uL connecting product to carry out heat shock transformation on Escherichia coli 5 α, coating the obtained product on a newly-arranged solid DH containing ampicillin/isopropyl- β -D-thiogalactoside/5-bromo-4-chloro-3-indolyl-B-D-galactoside (Amp/X-gal), carrying out sequencing on a DH containing newly arranged ampicillin/isopropyl- β -D-thiogalactoside/5-4-bromo-3-D-galactoside (Amp), carrying out sequencing on a solid medium, carrying out sequencing on a LB plate, carrying out overnight culture on a plurality of white spot culture medium culture and a working medium under a working temperature ranging from an overnight culture technology, carrying.

Sequencing results show that the full length of the gene sequence is 1427bp, wherein the open reading frame encodes a protein which is composed of 436 amino acid residues, has the molecular weight of 53417.2Da and the theoretical isoelectric point of 7.09 and contains a C-X2-C-X18-C-X2-C zinc finger structural domain. The relationship between the protein and other plants is shown in figure 1.

Example 2 expression vector construction of Potato GATA transcription factor StGATA12 Gene

Nde I/Xba I enzyme cutting sites are respectively added on two sides of a primer of an amplified StGATA12 gene, PCR amplification is carried out by taking a constructed pMD-18T vector as a template, an amplification product is cloned to the pMD-18T vector, the specific steps are shown in a StGATA12 gene cloning part of the invention, plasmid DNA is advanced after a positive strain is obtained, the plasmid DNA with the full length of a target gene is subjected to double enzyme cutting by utilizing Nde I/Xba I, meanwhile, a plant expression vector pcambia1302 is subjected to double enzyme cutting by utilizing Nde I/Xba I, the respective enzyme cutting products are subjected to 1% agarose gel electrophoresis, a target strip is recovered by using a gel recovery kit (purchased from Tiangen corporation), the target gene fragment and the vector fragment of the pcambia1302 are mixed at a ratio of 1:2, T4DNA ligase (purchased from Promga corporation) 1U, 1 × reaction buffer solution is added, 10uL of sterile water is supplemented, the target strip is connected at 4 ℃, 5uL connecting products are subjected to heat transformation, Escherichia coli 5 α is subjected to heat transformation, the strain containing kanamycin resistance, the positive strain containing the kanamycin resistance is screened in a Kmga map, and the positive strain size is detected by using a control dish, and the detection picture of a control map of a test sample containing 50 mg-16.

The obtained recombinant plasmid is transformed into agrobacterium GV3101 by a heat shock transformation method, LB solid resistance plate containing rifampicin (Rif)100mg/L and kana (Km)50mg/L is used for screening transformation positive spots, a plurality of positive spots are picked up and cultured in LB liquid culture medium containing rifampicin (Rif)100mg/L and kana (Km)50mg/L at 28 ℃ for over night at 180r/min, 1uL is taken as a template for PCR detection of the recombinant plasmid, and strains confirmed to be positive are stored for subsequent genetic transformation.

Example 2 genetic transformation of the Potato GATA transcription factor StGATA12 Gene

Selecting single colony and inoculating to the colony containing 50 mg.L^-1Kan's 50ml LB liquid medium, constant temperature shaking table 28 ℃, 180rpm shaking culture 24h after, for dip-dye transformation. Cutting the sterile test-tube potato into slices of about 1-2mm, and soaking in Agrobacterium liquid for 15 min. After being taken out, the sterile filter paper blotting-dried bacterial liquid is transferred into a co-culture medium (MS + 0.45% agar + 3% sucrose) paved with 2-3 layers of filter paper for dark culture for 48 h. After dark culture, 500 mg.L of the culture broth was used^-1The Cef is used for washing the potato slices in the test tube for 3-4 times by sterile water, is washed for 2-3 times by the sterile water, is shaken gently in the washing process to be washed fully, then is used for fully absorbing the water on the surfaces of the explants by sterile filter paper, is transferred to a culture medium containing Kan screening (MS basis + 0.45% agar + 3% sucrose + NAA0.2mg/mL +400mg/L Cef +50mg/Lkm, ph 5.8), and is cultured under the conditions of illumination intensity of 2000lux, light cycle of 8h/d and temperature of 24 ℃ until the resistant buds are regenerated. When the resistant buds are differentiated to 2-4cm, the resistant buds are transferred into a rooting culture medium (MS basis + 0.45% agar + 3% cane sugar + NAA0.2mg/mL +50mg/Lkm +200mg/L cef, ph 5.8) to induce rooting, thereby completing the regeneration of potato plants. Extracting DNA of the regeneration strain, designing a primer, carrying out PCR amplification by taking the DNA of the regeneration strain as a template, and identifying the positive strain.

The screened positive strains and the control strain Y5-CK are transferred into a rooting culture medium as a control, and are placed in an illumination intensity of 2000lux, a light cycle of 8h/d and a test-tube potato induction culture medium (MS basis + 0.45% agar + 8% sucrose +3 mg/L6-BA), and the results show that the transgenic positive strains Y5-5, Y5-9 and Y5-11 shown in tables 1-3 show excellent properties such as potato block enlargement, chlorophyll content increase and starch content increase, and compared with the control, the three strains Y5-6, Y5-9 and Y5-12 have obvious differences. As shown in FIG. 3, the positive plants were found to grow significantly when the images of Y5-CK and Y5-6 were compared after 20 days of culture (Y5-CK is control); the starch content of the potato test tube tubers is determined by an iodine color development method, the chlorophyll content of the potato leaves is determined by a colorimetric method, and the weight of the test tube potatoes is measured. As shown in FIG. 4, the size and weight of the individual potatoes of the transgenic positive lines were significantly higher than the weight of the individual potatoes of the control lines.

TABLE 1 Potato starch content of transgenic Positive lines and control lines

TABLE 2 comparison of chlorophyll content of transgenic-positive lines with control lines

Numbering	Chlorophyll content mg/g
		Y5-5	0.217
Y5-6	0.368
		Y5-7	0.360
Y5-9	0.222
		Y5-11	0.285
Y5-12	0.256
		Y5-CK	0.204

TABLE 3 test-tube potatoes in the positive transgenic lines and the control lines, all having potato piece weights (harvested in 60 days)

Numbering	Average weight of single potato
		Y5-5	0.522
Y5-6	0.567
		Y5-7	0.496
Y5-9	0.898

Y5-11	0.642
		Y5-12	0.852
Y5-CK	0.369

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> research center of agricultural biotechnology of Ningxia academy of agriculture and forestry

<120> potato GATA transcription factor, and cloning method and application thereof

<140>201711441863.2

<141>2017-12-27

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>1427

<212>DNA

<213>Solanum tuberosum

<400>1

agaggtaata aaagatgctt taaaataata ataaaaatgg tgaggtgtaa ttacgagaaa 60

gaccttcatt acacttatga aaaggcctct gacccggacc ccttactttc agcttttgag 120

cacttgtctg tcctcttcac actcaatgcc ttcattctct cttccttttt ctcagcctcc 180

gattctcctt ataaagaatt agtctcaaac ctaccgttac tttgcgtttt acactccacc 240

attcttacac tacacaccaa caacttcttc ttcttttttc taacaatgga agcatcggat 300

ttattcctta gcggcttttt ctcacatgcc ggagacgaac aaattccgaa taacatcaac 360

aacaacatca ataataataa ctgtaacaat ttttctgtgg atgatctttt ggttatccct 420

aaggaagatg aagttatggc cgacgcattt ttcaacagta ttacaggaaa ttctgctgat 480

tcttccaccg ttaccgtcgt tgacagctgt aattcctctg tttctggtgg agatggacaa 540

tttaacggca acctcagcgg ccgcagcttc accgatgctc ccttccctaa cagcgaactc 600

tgcgttccgt ttgatgactt ggctgagcat gaatggctct caaattttgt ggaggaatca 660

ttctcaagtg acgccgttca aaacctgcag ttcatccctg tagcaaacat taattcctcc 720

accatctcca ccgacagttc ctcctccgca accacatttt ccacaggacc caactcgcca 780

cctgccttcc ccaccgacac ctctgttcct ggcaaagctc gcagcaagcg ctcacgcgcc 840

gctccctgtg actggtcctc acgcctccag ctgctcttat cccctgccac atcatcatca 900

gagagcaaca acatctcgcc tccatctgct aacaacacta ctttcgccac ggccaaagcc 960

accaaagcgc cgtcgaagaa gcgagagagt gtggaaacgc cgggacggaa atgcctgcac 1020

tgtgcttctg ataagacacc acagtggcgc acagggccat taggtccaaa aactctgtgc 1080

aatgcatgtg gagttaggta caagtcaggt aggcttgtgc cggagtatcg accggcgtct 1140

agcccgactt ttatctcagc gaggcactcg aattctcatc ggaaagttct ggagctccgg 1200

aggcaaaagg atctccagag acaccaagca catcaccagc atcaattgct tagtcaaccc 1260

acaattttcg gtgtatcaaa tggtggtgat gaattcctgc ttcatcatca ccaaaattgt 1320

ggtccaaatt tcaggcacct catctagtat cagtcaccta gtgtagggga taactacttt 1380

gcacttttct cgttttaaaa aagtttgaat taacaatccc attttcc 1427

<210>2

<211>436

<212>PRT

<213>Solanum tuberosum

<400>2

Met Val Arg Cys Asn Tyr Glu Lys Asp Leu His Tyr Thr Tyr Glu Lys

15 10 15

Ala Ser Asp Pro Asp Pro Leu Leu Ser Ala Phe Glu His Leu Ser Val

20 25 30

Leu Phe Thr Leu Asn Ala Phe Ile Leu Ser Ser Phe Phe Ser Ala Ser

35 40 45

Asp Ser Pro Tyr Lys Glu Leu Val Ser Asn Leu Pro Leu Leu Cys Val

50 55 60

Leu His Ser Thr Ile Leu Thr Leu His Thr Asn Asn Phe Phe Phe Phe

65 70 75 80

Phe Leu Thr Met Glu Ala Ser Asp Leu Phe Leu Ser Gly Phe Phe Ser

85 90 95

His Ala Gly Asp Glu Gln Ile Pro Asn Asn Ile Asn Asn Asn Ile Asn

100 105 110

Asn Asn Asn Cys Asn Asn Phe Ser Val Asp Asp Leu Leu Val Ile Pro

115 120 125

Lys Glu Asp Glu Val Met Ala Asp Ala Phe Phe Asn Ser Ile Thr Gly

130 135 140

Asn Ser Ala Asp Ser Ser Thr Val Thr Val Val Asp Ser Cys Asn Ser

145 150 155 160

Ser Val Ser Gly Gly Asp Gly Gln Phe Asn Gly Asn Leu Ser Gly Arg

165170 175

Ser Phe Thr Asp Ala Pro Phe Pro Asn Ser Glu Leu Cys Val Pro Phe

180 185 190

Asp Asp Leu Ala Glu His Glu Trp Leu Ser Asn Phe Val Glu Glu Ser

195 200 205

Phe Ser Ser Asp Ala Val Gln Asn Leu Gln Phe Ile Pro Val Ala Asn

210 215 220

Ile Asn Ser Ser Thr Ile Ser Thr Asp Ser Ser Ser Ser Ala Thr Thr

225 230 235 240

Phe Ser Thr Gly Pro Asn Ser Pro Pro Ala Phe Pro Thr Asp Thr Ser

245 250 255

Val Pro Gly Lys Ala Arg Ser Lys Arg Ser Arg Ala Ala Pro Cys Asp

260 265 270

Trp Ser Ser Arg Leu Gln Leu Leu Leu Ser Pro Ala Thr Ser Ser Ser

275 280 285

Glu Ser Asn Asn Ile Ser Pro Pro Ser Ala Asn Asn Thr Thr Phe Ala

290 295 300

Thr Ala Lys Ala Thr Lys Ala Pro Ser Lys Lys Arg Glu Ser Val Glu

305 310 315 320

Thr Pro Gly Arg Lys Cys Leu His Cys Ala Ser Asp Lys Thr Pro Gln

325330 335

Trp Arg Thr Gly Pro Leu Gly Pro Lys Thr Leu Cys Asn Ala Cys Gly

340 345 350

Val Arg Tyr Lys Ser Gly Arg Leu Val Pro Glu Tyr Arg Pro Ala Ser

355 360 365

Ser Pro Thr Phe Ile Ser Ala Arg His Ser Asn Ser His Arg Lys Val

370 375 380

Leu Glu Leu Arg Arg Gln Lys Asp Leu Gln Arg His Gln Ala His His

385 390 395 400

Gln His Gln Leu Leu Ser Gln Pro Thr Ile Phe Gly Val Ser Asn Gly

405 410 415

Gly Asp Glu Phe Leu Leu His His His Gln Asn Cys Gly Pro Asn Phe

420 425 430

Arg His Leu Ile

435

<210>3

<211>37

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

agcgaactct gcgttccgtt tgatgacttg gctgagc 37

<210>4

<211>37

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gctcagccaa gtcatcaaac ggaacgcaga gttcgct 37

<210>5

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

agaggtaata aaagatgctt 20

<210>6

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ttaaaatgaa tctataaatt a 21

Claims

1. A potato GATA transcription factor has nucleotide sequence shown in SEQ NO.1 of the sequence table; the amino acid sequence of the protein coded by the potato GATA transcription factor is shown in a sequence table SEQ NO. 2.

2. The potato GATA transcription factor according to claim 1, wherein the potato GATA transcription factor is extracted by a PCR method.

3. The potato GATA transcription factor of claim 2, wherein the primer sequences of the PCR are respectively shown in SEQ NO. 3-SEQ NO.6 of the sequence table.

4. A method for cloning a potato GATA transcription factor of claim 1, comprising the steps of:

1) cloning a potato GATA transcription factor gene;

3) transforming agrobacterium with the expression vector;

5. The method for cloning a potato GATA transcription factor according to claim 4, wherein the step 1) is: extracting total RNA of the potatoes, carrying out reverse transcription on the mRNA into total cDNA by using a kit, respectively carrying out PCR amplification by using primers with nucleotide sequences shown as SEQ NO. 3-SEQ NO.6 of a sequence table, uniformly mixing the amplified products in equal volume to be used as a template, carrying out amplification by using SEQ NO.5 and SEQ NO.6 as primers, and obtaining the amplified product which is a GATA transcription factor gene of the potatoes.

6. The method for cloning a potato GATA transcription factor, according to claim 4, is characterized in that the step 2) comprises cloning the potato GATA transcription factor gene obtained in the step 1) into a pMD-18T vector, screening positive clones by using Escherichia coli, adding NdeI/XbaI enzyme cutting sites on both sides of primers of the amplified potato GATA transcription factor gene, carrying out PCR amplification by using potato RNA as a template, cloning the amplified product into the pMD-18T vector, extracting plasmid DNA after obtaining a positive strain, carrying out double enzyme digestion on the plasmid DNA with the full length of a target gene by using NdeI/XbaI and simultaneously carrying out double enzyme digestion on a plant expression vector by using NdeI/XbaI, recovering the enzyme digestion products, mixing the enzyme digestion products in a mass ratio of 1:2, carrying out ligase ligation, transforming Escherichia coli DH5 α competent screening positive clones, and obtaining a recombinant expression vector.

7. The method for cloning a potato GATA transcription factor according to claim 4, wherein said step 3) is: transforming agrobacterium with the recombinant plasmid of the expression vector constructed in the step 2), and screening transformed positive agrobacterium.

8. The method for cloning a potato GATA transcription factor according to claim 4, wherein said step 4) is: culturing positive agrobacterium in a liquid culture medium, dip-dyeing and transforming a potato explant, culturing the potato explant in a differentiation culture medium containing Kan screening, transferring the potato explant into a rooting culture medium to induce rooting, completing the regeneration of a potato plant, and identifying the positive plant to obtain the potato plant.