CN117430684A

CN117430684A - Application of cassava potassium ion transport protein and related biological material thereof

Info

Publication number: CN117430684A
Application number: CN202311408213.3A
Authority: CN
Inventors: 江行玉; 罗明华; 褚晶; 王宇
Original assignee: Guangdong Ocean University
Current assignee: Guangdong Ocean University
Priority date: 2023-10-27
Filing date: 2023-10-27
Publication date: 2024-01-23

Abstract

The invention discloses application of cassava potassium ion transport protein and related biological materials, and belongs to the technical field of biology. The invention aims to provide a gene for promoting plant flowering and improving salt resistance and barrenness resistance of plants. Experiments prove that the name of the cassava potassium ion transport protein is MeHAK5, and the overexpression of the MeHAK5 not only improves the low-potassium resistance and salt stress resistance of transgenic arabidopsis, but also shortens the flowering time of the transgenic arabidopsis and rice, and the transgenic arabidopsis and rice are respectively 4 days earlier and 7 days earlier than those of plants without the transgene. Therefore, the results provide basis and genetic materials for cultivating the barren-resistant and high-salt-resistant crop varieties through genetic engineering and shortening the breeding period, and have great application value.

Description

Application of cassava potassium ion transport protein and related biological material thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of cassava potassium ion transport protein and related biological materials thereof.

Background

Potassium is an essential element for plant growth and development, and is also the most abundant inorganic cation in plants. When the potassium content in the soil is too low, the plants may develop serious growth defects. In addition, potassium ions are also involved in plant responses to biotic and abiotic stresses. When plants grow in saline soil, na is highly concentrated in the soil ⁺ Absorption of K with plants ⁺ Competing with each other, not only affects plant absorption of K ⁺ K in plants can also be caused by potassium ion channels rectifying outwards ⁺ Leakage, decrease K ⁺ /Na ⁺ And, in turn, cause metabolic disorders in plants. Thus, K is increased ⁺ Maintain intracellular K ⁺ Homeostasis is not only a fundamental requirement for plant growth and development, but also one of the important strategies for plants to resist salt stress.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a gene for promoting plant flowering and improving salt resistance and/or barrenness resistance of plants. The technical problems to be solved are not limited to the described technical subject matter, and other technical subject matter not mentioned herein will be clearly understood by those skilled in the art from the following description.

In order to solve the technical problems, the invention provides the following technical scheme:

use of a protein or a substance regulating the expression of a gene encoding said protein or a substance regulating the activity and/or content of a protein in any of the following:

d1 Shortening the flowering time of the plant;

d2 Preparing a product of a plant with reduced flowering time;

d3 Cultivating a plant having reduced flowering time;

d4 Preparing a product for growing plants with reduced flowering time;

d5 Plant breeding;

d4 Increasing the low potassium tolerance of the plant;

d5 Preparing a product for improving the low potassium resistance of plants;

d6 Cultivating a plant having improved resistance to low potassium;

d7 Preparing a product for cultivating plants with improved low potassium tolerance;

d8 Improving plants with high potassium tolerance;

d9 Increasing the plant's ability to resist salt stress;

d10 Preparing a product for improving the salt stress resistance of plants;

d11 Cultivating a plant having increased resistance to salt stress;

d12 Preparing a product for cultivating a plant with improved salt stress resistance;

d13 Improving plants with high salt stress resistance;

the protein is tapioca potassium ion protein.

The purposes of plant breeding as described hereinabove include growing plants that bloom in advance, and also include growing plants that have increased resistance to low potassium, and growing plants that have increased resistance to salt stress. The improved high-low-potassium-tolerance plant and the improved high-salt-stress-tolerance plant refer to the improvement of the low-potassium-tolerance and the salt-stress-tolerance of plants by using MeHAK5.

The substances mentioned above are any of the following:

b1 A nucleic acid molecule encoding the aforementioned protein;

b2 An expression cassette comprising the nucleic acid molecule of B1);

b3 A recombinant vector comprising the nucleic acid molecule of B1), or a recombinant vector comprising the expression cassette of B2);

b4 A recombinant microorganism comprising the nucleic acid molecule of B1), or a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3);

b5 A transgenic plant cell line comprising the nucleic acid molecule of B1), or a transgenic plant cell line comprising the expression cassette of B2);

b6 A transgenic plant tissue comprising the nucleic acid molecule of B1), or a transgenic plant tissue comprising the expression cassette of B2).

The cassava potassium ion protein is any one of the following,

a1 A protein having an amino acid sequence of SEQ ID No. 1;

a2 A protein which is obtained by substituting and/or deleting and/or adding an amino acid residue in the amino acid sequence shown in SEQ ID No.1, has more than 80% of identity with the protein shown in A1) and has the same function;

a3 Fusion proteins having the same function obtained by ligating a tag to the N-terminal and/or C-terminal of A1) or A2).

The nucleic acid molecule B1) is a cDNA molecule or a DNA molecule whose coding sequence is SEQ ID No. 2.

In order to facilitate purification or detection of the protein of A1), a tag protein may be attached to the amino-or carboxy-terminus of the protein consisting of the amino acid sequence shown in SEQ ID No.1 of the sequence Listing.

Such tag proteins include, but are not limited to: GST (glutathione-sulfhydryl transferase) tag protein, his6 tag protein (His-tag), MBP (maltose binding protein) tag protein, flag tag protein, SUMO tag protein, HA tag protein, myc tag protein, eGFP (enhanced green fluorescent protein), eFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

The mutation of the nucleotide sequence encoding the protein MeHAK5 of the present invention can be easily performed by a person skilled in the art using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 75% or more identity to the nucleotide sequence of the protein MeHAK5 isolated by the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the protein MeHAK5 and have the function of the protein MeHAK5.

The 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

Herein, identity refers to identity of an amino acid sequence or a nucleotide sequence. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, by using blastp as a program, the Expect value is set to 10, all filters are set to OFF, BLOSUM62 is used as Matrix, gap existence cost, per residue gap cost and Lambda ratio are set to 11,1 and 0.85 (default values), respectively, and search is performed to calculate the identity of amino acid sequences, and then the value (%) of identity can be obtained.

Herein, the 80% identity or more may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

The invention also provides a method for making plants bloom in advance, which comprises the steps of up-regulating or enhancing or increasing the expression quantity of the coding gene of the protein in the target plant or the content of the protein so as to make the target plant bloom in advance.

Further, the above-mentioned up-regulation or enhancement of the expression amount of the gene encoding the aforementioned protein in the target plant or the content of the aforementioned protein is to introduce the gene encoding the aforementioned protein into the target plant.

Specifically, the invention constructs the coding gene (SEQ ID No. 2) of the protein MeHAK5 into a nucleotide sequence between SalI and BamHI cleavage recognition sites of a pCAMBIA1300 vector, and the other sequences are kept unchanged to obtain a recombinant expression vector, and then the recombinant expression vector is used for transforming a receptor plant to obtain a transgenic plant, wherein the flowering time of the transgenic plant is earlier than that of the receptor plant.

The plant described herein is any one of the following:

g1 Monocotyledonous or dicotyledonous plants;

g2 Plants of the order gramineae or cruciferous;

g3 Gramineae or cruciferous plants;

g4 Rice or arabidopsis plants;

g5 Rice or arabidopsis thaliana.

Also provided herein are biomaterials, which are any one of the following:

b1 A nucleic acid molecule encoding the aforementioned protein;

b2 An expression cassette comprising the nucleic acid molecule of B1);

b5 A nucleic acid molecule that inhibits or reduces or down-regulates the expression of a gene encoding the protein or a nucleic acid molecule that inhibits or reduces or down-regulates the activity or content of the protein;

b6 A gene encoding the nucleic acid molecule of B5);

b7 An expression cassette comprising the gene of B6);

b8 A recombinant vector comprising the gene of B6), or a recombinant vector comprising the expression cassette of B7);

b9 A recombinant microorganism comprising the gene of B6), a recombinant microorganism comprising the expression cassette of B7), or a recombinant microorganism comprising the recombinant vector of B4).

In the above biological material, the expression cassette containing a nucleic acid molecule encoding MeHAK5 (MeHAK 5 gene expression cassette) refers to DNA capable of expressing MeHAK5 in a host cell, and the DNA may include not only a promoter for initiating transcription of MeHAK5 but also a terminator for terminating transcription of MeHAK5. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: a constitutive promoter; tissue, organ and development specific promoters and inducible promoters. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminator.

Recombinant vectors containing the MeHAK5 gene expression cassette can be constructed using existing expression vectors. The plant expression vector comprises a binary agrobacterium vector, a vector which can be used for plant microprojectile bombardment and the like. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1305, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb (CAMBIA Co.). The plant expression vector may also comprise the 3' -untranslated region of a foreign gene, i.e., comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal may direct the addition of polyadenylation to the 3 'end of the mRNA precursor and may function similarly to the 3' transcribed untranslated regions of Agrobacterium tumefaciens induction (Ti) plasmid genes (e.g., nopaline synthase gene Nos) and plant genes (e.g., soybean storage protein genes). When the gene of the present invention is used to construct a plant expression vector, enhancers, including translational or transcriptional enhancers, may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene. To facilitate identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, for example by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), antibiotic marker genes (such as nptII gene conferring resistance to kanamycin and related antibiotics, bar gene conferring resistance to the herbicide phosphinothricin, hph gene conferring resistance to antibiotic hygromycin, dhfr gene conferring resistance to methotrexate, EPSPS gene conferring resistance to glyphosate) or chemical marker genes, etc. (such as herbicide resistance genes), mannose-6-phosphate isomerase gene providing mannose metabolization ability, etc. From the safety of transgenic plants, transformed plants can be screened directly in stress without adding any selectable marker gene.

Among the above biological materials, such carriers are well known to those skilled in the art, including but not limited to: plasmids, phages (e.g., lambda phage or M13 filamentous phage, etc.), cosmids (i.e., cosmids), ti plasmids, or viral vectors. Specifically, p416-GPD or pCAMBIA1300 may be used.

In the above biological material, the nucleic acid molecule may be DNA such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

The nucleic acid molecule B1) above is a cDNA molecule or a DNA molecule whose coding sequence is SEQ ID No. 2.

The proteins described above are also within the scope of the present invention.

HAK is a high affinity potassium ion transporter protein distributed on plant cell membrane, and can absorb K in plants ⁺ Plays an important role in the process of (a). A gene encoding a high-affinity potassium ion (high-affinity K+) transporter is obtained from cassava through bioinformatics analysis, and is named as MeHAK5, experiments prove that the expression of the gene improves the potassium ion absorption capacity of a potassium ion absorption defective yeast strain CY162 (figure 1), and the corresponding expression of the MeHAK5 not only improves the low potassium resistance (figure 2) and salt stress resistance (figure 3) of transgenic arabidopsis, but also shortens the flowering time of the transgenic arabidopsis and rice (figures 5 and 6) which are 4 days earlier and 7 days earlier than that of transgenic plants. Therefore, the results provide basis and genetic materials for cultivating the barren-resistant and high-salt-resistant crop varieties through genetic engineering and shortening the breeding period, and have great application value.

Drawings

FIG. 1 shows the sensitivity of MeHAK5 gene-complementing CY162 yeast strains to low potassium stress.

FIG. 2 is a graph showing that MeHAK5 overexpression promotes growth of transgenic Arabidopsis under low-potassium conditions. WT, wild type arabidopsis; HAK5, arabidopsis transformed with MeHAK5 gene.

FIG. 3 is a graph showing that MeHAK5 overexpression promotes the growth of transgenic Arabidopsis under salt stress conditions. WT, wild type arabidopsis; HAK5, arabidopsis transformed with MeHAK5 gene.

FIG. 4 is a graph showing that MeHAK5 promotes flowering in transgenic Arabidopsis.

FIG. 5 shows the promotion of flowering in transgenic rice by MeHAK5.

FIG. 6 shows that the MeHAK5 expression transgene promotes early flowering of field planted rice.

FIG. 7 shows the mature phenotype of MeHAK5 transgenic rice and wild type rice WT planted in Ling-water fields.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

pMD-18T vector, p416 vector, potassium-deficient yeast strain CY162, pCAMBIA1300 vector: described in non-patent literature "MeCIPK10 regulates the transition ofthe K ⁺ transport activity of MeAKT2 betwen low-and high-affinity molds in casssava. Journal ofPlant Physiology,2023,280:153861", available to the public from university of ocean, guangdong, was used only for repeated experiments related to the invention and was not used for other purposes.

Example 1 cloning of MeHAK5

The materials used include: primeSTAR Max DNAPolymerase (TaKaRa); recombinant cloning kit (Vazyme); DH5a competence (Biomed); ampicillin (Sangon); kanamycin (Kanamycin); t4 DNA ligase (NEB)

Extracting total RNA of cassava (No. 8 of south China), reversely transcribing the total RNA into cDNA, taking the cDNA as a template, taking MeHAK5-F as an upstream primer and MeHAK5-R as a downstream primer, amplifying the MeHAK5 gene by PCR (polymerase chain reaction), and connecting a gene fragment and a pMD-18T vector by using TA cloning, wherein the obtained recombinant plasmid is named as p18-MeHAK5. Finally, the plasmid p18-MeHAK5 is transformed into escherichia coli for amplification and preservation.

MeHAK5-F：5′-GAAGAAGATGGCAGAGGAAGTG-3′

MeHAK5-R：5′-GCAGCATCATATCTCATATGTC-3′

The amino acid sequence of MeHAK5 is shown as SEQ ID No.1, and the nucleotide sequence is shown as SEQ ID No. 2. SEQ ID No.1 (808 aa):

MAEEVGETRGGEGKEKTETMAVENKLKERKISWAKLRRVDSLNLEAGRVSKTQHNNQVNWKKTLSLTFQSIGVVYGDIGTSPLYVYESTFPDKIGSKEDILGVLSLIIYTLVLLPMLKYVFIVLRANDNGDGGTFALYSLLSRYVKVSLIPNDQPEDTQLSNYKLEIPSNQLKRSEKIKEKMENSKNIKILLFLVTILGTSMVIGDGVLTPCISVLSAVSGIGSLGQDAVVGISIAILIVLFCAQRLGTDKVGFSFAPIILLWFSFIGGIGLYNLFKYDVSVLRAFNPKYMFDYFKRNGKQGWISLGGVVLAVTGTEAMFADLGHFNVQAIQISFSGIVFPALLCAYAGQAAYLTKFPDDVSKTFYKSIPDPLYWPTFVVAVAAAIIASQAMISGAFAIISQSLSLGCFPRVKVIHTSAKYEGQVYIPEVNYILMIACIMVCLGFKTTEKIGNAYGIAVVAVMVITTCMVTIIMLVVWRTKMIWIAFFFFGFICIEAVYLSSVLYKFKDGGFLPLAFSFFLMIIMGIWHYIHKERYMYELKNKVSREFIRELAANPNINRVPGIGLLYSELVQGVPPIFPHFIANIPSIHSVLVFVSIKSLPMSKVALEERFLFRQVEPREYRMFRCVVRYGYNDAVEEPQEFERQLVEGLKEFIRHEHFISEGGDAETVGEPENPQSSTLLAKDGKARASAVYIEESLQQPNPSRVSSGSIHSNSGIKSTKSSNGIISAPLQGSAAEEMQIVQNAMEKGVVYLLGEAEVVAEPKSSLFKKFVVNHAYNFLRRNSREGGKVLAIPRARLLRVGMTYEI

SEQ ID No.2(2427bp)：

ATGGCAGAGGAAGTGGGGGAGACGAGAGGAGGAGAAGGAAAAGAAAAAACAGAAACCATGGCAGTGGAAAATAAGCTGAAAGAGCGAAAGATATCATGGGCAAAGCTTCGTCGCGTGGACTCCCTCAATTTGGAGGCAGGCCGAGTGTCTAAAACCCAACACAATAACCAGGTTAATTGGAAGAAGACGTTGAGTTTGACATTTCAGAGCATAGGAGTTGTGTACGGGGACATCGGAACTTCACCGCTTTATGTATATGAAAGCACTTTTCCAGACAAAATCGGTTCAAAAGAGGACATTCTTGGGGTGTTATCGCTTATCATTTATACCCTAGTACTATTACCCATGCTCAAGTACGTGTTCATTGTGTTGAGGGCCAACGATAATGGCGACGGCGGAACCTTCGCTCTCTATTCGTTGCTAAGCCGATATGTAAAAGTGAGCTTGATCCCCAACGACCAACCTGAGGATACTCAGCTTTCCAACTACAAGCTTGAAATACCTTCCAACCAGTTGAAGCGGTCTGAAAAAATTAAAGAGAAGATGGAGAATTCTAAAAACATCAAAATCTTACTTTTTCTTGTCACCATCCTCGGAACTTCCATGGTCATCGGCGACGGAGTCCTCACCCCATGCATTTCAGTGCTTTCAGCTGTGAGCGGGATCGGCTCCCTCGGCCAAGATGCTGTTGTTGGCATTTCAATTGCAATCTTGATTGTCCTCTTCTGTGCTCAACGACTGGGCACCGACAAAGTGGGCTTCTCATTCGCCCCTATTATTCTCCTGTGGTTTTCATTCATCGGCGGCATAGGTCTTTACAATTTGTTCAAATATGATGTGAGTGTGTTACGTGCTTTCAATCCAAAATATATGTTTGATTACTTCAAAAGAAATGGGAAGCAGGGATGGATTTCACTTGGTGGAGTTGTTTTAGCCGTTACAGGCACTGAAGCCATGTTTGCTGATCTTGGTCACTTTAATGTCCAAGCAATTCAAATCAGTTTTTCTGGCATCGTGTTTCCTGCTTTACTATGTGCATATGCAGGGCAAGCGGCATATCTCACCAAATTCCCAGATGACGTCTCTAAAACTTTCTACAAATCTATACCAGATCCGTTGTATTGGCCAACATTTGTTGTCGCTGTAGCCGCCGCAATTATTGCCAGCCAAGCCATGATATCAGGAGCATTTGCAATCATCTCGCAATCTCTGAGTCTTGGTTGCTTTCCCAGGGTCAAGGTTATTCACACTTCTGCTAAGTATGAGGGTCAGGTTTACATACCAGAGGTCAACTACATACTCATGATTGCGTGCATTATGGTCTGTTTGGGATTCAAGACTACTGAAAAGATCGGCAATGCATATGGAATTGCCGTGGTTGCTGTTATGGTAATCACAACTTGTATGGTTACGATTATAATGCTGGTTGTATGGAGGACAAAGATGATATGGATTGCTTTCTTTTTTTTTGGATTTATTTGCATAGAGGCCGTTTATCTATCATCTGTTCTGTACAAATTCAAAGATGGCGGTTTCCTTCCACTGGCATTTTCATTTTTCCTGATGATAATTATGGGGATATGGCACTATATACACAAAGAAAGGTACATGTATGAGCTTAAAAACAAGGTGTCCAGAGAATTCATTAGAGAATTGGCTGCAAACCCAAATATAAATAGAGTACCAGGAATAGGGCTTCTATACTCTGAGCTTGTACAAGGCGTTCCTCCAATATTTCCTCACTTTATTGCCAACATACCATCCATTCACTCAGTTTTAGTATTTGTTTCAATCAAGTCTCTGCCGATGAGCAAAGTAGCATTGGAGGAGAGATTCCTATTCCGACAAGTTGAGCCAAGAGAGTACCGGATGTTCCGGTGTGTAGTGAGGTACGGATATAATGATGCAGTTGAGGAGCCCCAAGAGTTTGAGCGCCAGTTGGTTGAAGGCCTGAAAGAATTCATCCGCCATGAACACTTCATTAGCGAAGGAGGAGACGCTGAAACAGTGGGAGAGCCAGAAAACCCCCAGAGTTCCACTCTGTTAGCGAAAGATGGAAAAGCAAGAGCATCAGCAGTTTACATTGAGGAGTCACTGCAGCAGCCTAATCCATCTCGGGTTTCATCAGGTTCCATCCACTCAAATAGTGGGATTAAGTCCACGAAATCCTCTAATGGAATTATATCCGCCCCACTCCAAGGGAGCGCTGCTGAAGAAATGCAGATTGTGCAGAATGCAATGGAGAAAGGTGTGGTTTATCTGTTGGGAGAAGCAGAAGTGGTGGCAGAACCAAAATCATCCTTGTTCAAGAAATTCGTTGTCAACCATGCTTATAATTTCCTGAGGAGAAACAGCAGAGAGGGGGGAAAAGTCTTGGCAATCCCAAGAGCCAGGCTCCTCAGGGTCGGAATGACATATGAGATATGA example 2, K of MeHAK5 ⁺ Transport capacity

1. Construction of Yeast expression vectors

The PCR reaction was first performed using the plasmid p18-MeHAK5 constructed in example 1 as a template, and the upstream primer p416-F and the downstream primer p 416-R. PCR reaction procedure: the first step is carried out at 98 ℃ for 3 minutes; the second step is carried out for 34 cycles, wherein the cycles are 98 ℃ for 10 seconds, 58 ℃ for 15 seconds and 72 ℃ for 2.5 minutes; the third step is carried out at 72℃for 10 minutes. The PCR product was purified, then the p416-GPD vector and the fragment of interest were digested with Sal I and BamHI, the fragment of interest was recovered and ligated using T4 ligase, the ligation product was transformed into DH5a competent cells using the heat shock method, and transgenic E.coli DH5a harboring the recombinant plasmid p416-MeHAK5 was screened with ampicillin antibiotics. Clones of the transformation products were submitted to bioengineering sequencing company for DNA sequencing analysis to determine the correct transformants. Plasmid p416-MeHAK5 was extracted from transgenic E.coli DH5a containing recombinant plasmid p416-MeHAK5.

2. Sensitivity of MeHAK5 Gene-complementing CY162 Yeast Strain to Low Potassium stress

CY162 (trk1Δ, trk2Δ) is a mutant strain of yeast deficient in potassium ion absorption, when K ⁺ Cannot grow at a concentration of less than 5mM, and is therefore useful for K ⁺ Good tools for functional heterogeneous verification are absorbed. The LiAc/PEG method was used to transform potassium-deficient yeast strain CY162. The specific method comprises the following steps:

the recombinant plasmid p416-MeHAK5 (FIG. 1, two replicates) was transformed into CY162 yeast mutant strain as experimental group, and yeast CY162 transformed with empty vector p416-GPD as control (FIG. 1). In AP solid medium (10 mM arginine, 8mM phosphoric acid, 2% glucose, 2mM MgSO) containing different potassium ion concentrations ₄ ，0.2mM CaCl ₂ Trace minerals andvitamins,2% agar), different K's were observed ⁺ Growth of transgenic yeasts at concentration conditions.

The results are shown in FIG. 1 when K ⁺ All transgenic yeasts grew well and without difference at a concentration of 5mM or more, but when K ⁺ When the concentration is reduced to 1mM, the difference of different transgenes is obvious, the control yeast can not grow, but the MeHAK 5-transformed yeast still grows well, even if K ⁺ The concentration was reduced to 0.1mM, and the transgenic yeast expressing MeHAK5 grew better although growing less. The experimental results show that: meHAK5 is a high affinity potassium ion transporter that helps transgenic yeast to take up potassium ions and promote transgenic yeast growth under low potassium conditions.

3. Construction of plant expression vector p1300-MeHAK5

Using the p18-MeHAK5 constructed in example 1 as a template, a PCR reaction was first performed using the upstream primer p1300-F and the downstream primer p 1300-R. PCR reaction procedure: the first step is carried out at 95 ℃ for 3 minutes; the second step is carried out for 34 cycles, wherein the cycles are 10 seconds at 95 ℃, 15 seconds at 58 ℃ and 2.5 minutes at 72 ℃; the third step is carried out at 72℃for 10 minutes. The PCR product was purified, then the pCAMBIA1300 vector and the target fragment were digested with Sal I and BamHI, the target fragment was recovered and ligated with T4 ligase, and then the ligation product was transformed into DH5a competent cells by heat shock, and transgenic E.coli DH5a harboring the recombinant plasmid p1300-MeHAK5 was selected using kanamycin. Clones of the transformation products were submitted to bioengineering sequencing company for DNA sequencing analysis to determine the correct transformants. The recombinant plant expression vector in the correct transformant was designated as p1300-MeHAK5, and p1300-MeH AK5 was a recombinant expression vector in which the nucleotide sequence between Sal I and BamHI cleavage recognition sites of pCAMBIA1300 vector was replaced with a DNA molecule having the nucleotide sequence of SEQ ID No.2 while the other sequences were kept unchanged, and the recombinant expression vector expressed the protein MeHAK5 having the amino acid sequence of SEQ ID No. 1. Expression of the MeHAK5 gene was initiated by the CaMV35S promoter.

TABLE 1 primers used for two PCR

Upstream primer p416-F	CGGGATCCGAAGAAGATGGCAGAGGAAGTG
		Downstream primer p416-R	TCCCCCGGGGCAGCATCATATCTCATATGTC
Upstream primer p1300-F	AGCGTCGACGAAGAAGATGGCAGAGGAAGTG
		Downstream primer p1300-R	CGGGATCCGCAGCATCATATCTCATATGTC

Example 3 MeHAK5 overexpression promotes growth of transgenic Arabidopsis under Low Potassium and salt stress conditions

1. Genetic transformation and screening of arabidopsis thaliana and rice

Arabidopsis thaliana (Columbia wild type, WT): the general public is available from Guangdong university, journal of Experimental Botany,2020,71:1801-1814, described in non-patent document "The protein kinase complex CBL-CIPK 8-SOS1 functions inArabidopsis to regulate salt tolerance," which is used only for repeated experiments related to the present invention and is not used for other purposes.

Rice (TaiPei 309, TP 309): the general public is available from the university of ocean, guangdong, and the biomaterial is used only for repeated experiments related to the present invention and is not used for other purposes, as described in non-patent document "Initiation ofAndrogenesis in Rice Oryza sativa Lvar Taipei 309.Proceedings ofIndianNational ScienceAcademy,2015,53 (3B)".

Transferring the p1300-MeHAK5 plant expression vector constructed in example 2 into Arabidopsis thaliana (wild type, WT) through agrobacterium tumefaciens mediation, carrying out molecular identification on the harvested transgenic plant by using an upstream primer p1300-F and a downstream primer p1300-R, screening to obtain a homozygous strain, and obtaining an Arabidopsis thaliana transgenic plant T after screening and identification ₃ And (3) replacing homozygote. The p1300-MeHAK5 plant expression vector constructed in example 2 was sent to Wuhan corporation, who was responsible for transformation of rice, to obtain transgenic seedlings of T0 generation. And (3) carrying out molecular identification on the harvested transgenic plants by using an upstream primer p1300-F and a downstream primer p1300-R, screening to obtain homozygous lines, and obtaining the rice transgenic plant T3 generation homozygotes after screening and identification. The specific method comprises the following steps:

1. detection and screening of transgenic Arabidopsis thaliana

1) Subpackaging the harvested T0 generation transgenic Arabidopsis seeds into 2mL centrifuge tubes, adding 75% alcohol, washing for 30sec, sucking the supernatant, and using sterile ddH ₂ O was washed 3 times.

2) 10% timesWashing with sodium chlorate for 10min, inverting the solution several times during the washing, sucking the supernatant, and adding sterile ddH ₂ O was washed 5 times.

3) The sterilized seeds were placed at 4℃for vernalization in the absence of light for 3 days and then spread evenly on 1/2MS solid medium containing 50. Mu.g/L hygromycin. 1/2MS solid medium formula: m519:2.215g/L, sucrose: 15g/L, agar: 7g/L, hygromycin: 50. Mu.g/L. M519 is available from PhytoTech LABS under the designation M519-50L.

4) The flat plate paved with seeds is horizontally placed in an illumination plant incubator, after the flat plate is cultivated for two weeks at the temperature of 23 ℃ in 16h illumination/8 h darkness, seedlings with long roots and true leaves are selected and transplanted into soil for continuous growth.

The T3 generation homozygote of the arabidopsis transgenic plant is obtained by the method until screening.

2. Detection and screening of transgenic rice

The obtained T0 generation transgenic rice seedlings are planted in a greenhouse of Hainan university for about 15 days, tender leaves are taken, genomic DNA is extracted for PCR detection, and the genomic DNA extraction method is as follows:

1) About 0.1g of tender fresh leaves are taken and put into a 1.5mL centrifuge tube, and liquid nitrogen is ground into powder.

2) 700. Mu.L of preheated 2% CTAB extraction buffer is added, and the mixture is placed in a water bath kettle at 65 ℃ and kept for about 30min, and the mixture is mixed up and down in a reverse manner every 10 min.

3) After the mixture was cooled to room temperature, 700uL (chloroform: isoamyl alcohol=24: 1) Mixing the solution, lightly inverting the centrifuge tube for several times to enable the mixture in the tube to be emulsion, centrifuging at 10000rpm for 10min at normal temperature, and transferring the supernatant into another clean centrifuge tube.

4) Adding 2.5 times volume of precooled absolute ethyl alcohol into the supernatant, mixing uniformly, placing in a refrigerator at 4 ℃ for 30min, centrifuging at 12000rpm for 10min, and discarding the supernatant.

5) The precipitate was washed by adding 750uL of 75% ethanol, centrifuging at 10000rpm for 5min, discarding the supernatant, and washing the precipitate 2 times.

6) Inverted or placed in a ventilating kitchen for drying.

7) Adding 100uLTE buffer solution to dissolve DNA, and refrigerating at-4deg.C for use.

Taking the DNA as a template, and carrying out PCR reaction by taking p1300-F as an upstream primer and p1300-R as a downstream primer. PCR reaction procedure: the first step is carried out at 95 ℃ for 3 minutes; the second step is carried out for 34 cycles, wherein the cycles are 95 ℃ for 15 seconds, 58 ℃ for 15 seconds and 72 ℃ for 1 minute; the third step is carried out at 72℃for 10 minutes. Detecting by using 1% agarose gel, selecting corresponding plants with consistent strip sizes, continuously culturing, and screening according to the method until the T3 generation homozygote of the transgenic rice plant is obtained.

The homozygous transgenic plant identified above was designated as Arabidopsis transgenic plant T ₃ Generation homozygote MeHAK5OE-11 and MeHAK5OE-15, transgenic rice plant T ₃ Generation homozygotes MeHAK5OE-1 and MeHAK5OE-2.

2. MeHAK5 overexpression promotes growth of transgenic Arabidopsis under low potassium and salt stress conditions

1. Experimental method

1/2MS solid medium: purchased from PhytoTech LABS under the accession number M153-50L.

Low potassium medium containing 10 μm potassium chloride (KCl): ammonium Nitrate (NH) ₄ NO ₃ ) 2.5g/L of diammonium hydrogen phosphate [ (NH) ₄ ) ₂ HPO ₄ ]0.165g/L, M4070.61g/L, potassium chloride 10. Mu.M. M407 was purchased from PhytoTech LABS under the accession number M407-50L.

High salt medium containing 100mM sodium chloride (NaCl): m5192.215g/L, sodium chloride 100mM. M519 is available from PhytoTech LABS under the designation M519-50L.

Wild Type (WT) -10. Mu.K ⁺ Group: wild type Arabidopsis thaliana (WT) was sown on 1/2MS solid medium, grown in an illumination incubator at 23℃for 5 days, with 16h illumination/8 h darkness, and then transplanted with 5 wild type seedlings into a low potassium medium containing 10. Mu.M KCl (i.e., 10. Mu.K in FIG. 2) ⁺ ) The culture medium is not required to be replaced during the growth of the arabidopsis thaliana in the illumination incubator for two weeks, the condition of the illumination incubator is 23 ℃, the illumination is carried out for 16 hours/the darkness is 8 hours, and the growth condition and the phenotype of the arabidopsis thaliana are observed. The experiment was repeated three times.

Wild Type (WT) -1/2MS group: substitution of Wild Type (WT) -10. Mu.K with 1/2MS solid Medium ⁺ The remaining operations were identical to wild-type (WT) -10. Mu.K in low potassium medium containing 10. Mu.M KCl in the group ⁺ A group.

Transgenic Arabidopsis plants (MeHAK 5OE-11 and MeHAK5 OE-15) -10. Mu.K ⁺ Group: transgenic plant T of Arabidopsis thaliana ₃ Substitution of the Wild Type (WT) -10. Mu.K with the homozygous generation of MeHAK5OE-11 (strain 4) and MeHAK5OE-15 (strain 4) ⁺ Arabidopsis wild type in the group, the remaining conditions were identical to Wild Type (WT) -10. Mu.K ⁺ A group.

Arabidopsis transgenic plants (MeHAK 5OE-11 and MeHAK5 OE-15) -1/2MS group: substitution of Arabidopsis transgenic plants (MeHAK 5OE-11 and MeHAK5 OE-15) -10. Mu.K with 1/2MS solid Medium ⁺ The remaining operations were identical to wild type WT-10. Mu.K in low potassium medium containing 10. Mu.M KCl in the group ⁺ A group.

Wild Type (WT) -100mM NaCl group: wild type Arabidopsis thaliana (WT) was on-demand on a 1/2MS solid medium, grown in an illumination incubator at 23℃for 5 days under 16h illumination/8 h darkness, then transplanted to a high salt medium containing 100mM NaCl (i.e., 100mM NaCl in FIG. 3) for 5 wild type seedlings, grown in an illumination incubator without medium replacement for two weeks under conditions of 23℃and 16h illumination/8 h darkness, and the phenotype of Arabidopsis thaliana was observed. The experiment was repeated three times.

Wild Type (WT) -1/2MS group: the 1/2MS solid culture medium is used for replacing the high-salt culture medium containing 100mM NaCl in the Wild Type (WT) -100mM NaCl group, and the rest operation is the same as that of the wild type-10 mu K ⁺ A group.

Arabidopsis transgenic plants (MeHAK 5OE-11 and MeHAK5 OE-15) -100mM NaCl group: transgenic plant T of Arabidopsis thaliana ₃ The generation homozygotes MeHAK5OE-11 (strain 5) and MeHAK5OE-15 (strain 5) replace the Wild Type (WT) -100mM NaCl group of Arabidopsis thaliana wild type, the rest conditions are the same as the Wild Type (WT) -10. Mu.K ⁺ A group.

Arabidopsis transgenic plants (MeHAK 5OE-11 and MeHAK5 OE-15) -1/2MS group: the 1/2MS solid culture medium is used for replacing the high-salt culture medium containing 100mM NaCl in the arabidopsis transgenic plants (MeHAK 5OE-11 and MeHAK5 OE-15) -100mM NaCl group, and the rest operation is the same as that of the wild type-100 mM NaCl group.

2. Experimental results: the results are shown in FIGS. 2 and 3, where there is no apparent difference in phenotype between the control 1/2MS solid medium, but there is a apparent difference in phenotype between the low potassium and high salt medium (FIGS. 2 and 3), the transgenic Arabidopsis thaliana grew better than the wild type, and the root system was developed, indicating that MeHAK5 promoted the growth of transgenic Arabidopsis thaliana under low potassium or salt stress conditions.

EXAMPLE 4 overexpression of MeHAK5 to promote early flowering in transgenic Arabidopsis and Rice

1. MeHAK5 promotes flowering of transgenic Arabidopsis thaliana

The wild type Arabidopsis (WT) obtained in example 3 and the T3 generation homozygotes of transgenic Arabidopsis (MeHAK 5OE-1, meHAK5 OE-2) expressing MeHAK5 were each sown in pots with nutrient soil (purchased from PINDSTRUP, normal soil ion content), 3 replicates of each group, grown in a greenhouse at 22℃for 16h light/8 h dark, and the rest of the operations were the same. The ear-picking flowering time of arabidopsis was observed and recorded by photographing (fig. 4), and the results showed that transgenic arabidopsis began ear-picking flowering after 28 days of growth after sowing, and wild type arabidopsis began ear-picking flowering after 32 days of growth after sowing, 4 days earlier than wild type plants.

2. MeHAK5 promotes transgenic rice to bloom

The wild type rice (Taipei 309, TP 309) obtained in example 3 and the transgenic rice (MeHAK 5OE-1 and MeHAK5 OE-2) expressing MeHAK5 were each sown in a pot containing nutrient soil (purchased from PINDSTRUP, normal soil ion content) with 3 replicates, 4 seedlings each, sown at 7 months and 23 days in 2022, were naturally grown on the experimental bases of the university of Hai kou and the rest of the operations were the same. The heading and flowering time of the rice was observed and recorded by photographing (FIG. 5), wherein MeHAK5OE-1, meHAK5OE-2 and WT were sequentially shown from left to right, and the results indicate that the heading and flowering started after 72 days of growth after sowing of transgenic rice, the heading and flowering started after 78 days of growth after sowing of wild type rice, and the transgenic rice was flowering 7 days earlier than the wild type plant.

3. MeHAK5 expression transgene promoting early flowering of paddy rice planted in field

The wild rice obtained in example 3 and the T3-generation homozygotes of transgenic rice expressing MeHAK5 (MeHAK 5OE-1 and MeHAK5 OE-1) were sown at the south China sea breeder seed base (normal soil release) at 11 months and 16 days 2022Seed content), 3 cell repeats are planted in each rice to be tested, and each cell is 20m ² Randomly arranged and naturally grown in the field. The results are shown in FIG. 6 (the rice planted in the field is moved into the flowerpot for comparison and photographing), the WT, the MeHAK5OE-1 and the MeHAK5OE-2 are sequentially arranged from left to right in the figure, and the flowering time of the MeHAK5 transgenic Arabidopsis and the rice is obviously longer than that of the wild type. Mature phenotype of WT and MeHAK5 transgenic rice planted in Ling-water fields As shown in FIG. 7, the mature time of wild rice planted in the same period was significantly longer than that of transgenic rice expressing MeHAK5 (MeHAK 5OE-1 and MeHAK5 OE-1).

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains.

Claims

1. Use of a protein or a substance regulating the expression of a gene encoding said protein or a substance regulating the activity and/or content of a protein in any of the following:

d1 Shortening the flowering time of the plant;

d2 Preparing a product of a plant with reduced flowering time;

d3 Cultivating a plant having reduced flowering time;

d4 Preparing a product for growing plants with reduced flowering time;

d5 Plant breeding;

d4 Increasing the low potassium tolerance of the plant;

d5 Preparing a product for improving the low potassium resistance of plants;

d6 Cultivating a plant having improved resistance to low potassium;

d8 Improving plants with high potassium tolerance;

d9 Increasing the salt stress resistance of the plant;

d10 Preparing a product for improving the salt stress resistance of plants;

d11 Cultivating a plant having increased resistance to salt stress;

d13 Improving plants with high salt stress resistance;

the protein is cassava potassium ion transport protein.

2. Use according to claim 1, wherein the substances are any of the following:

b1 A nucleic acid molecule encoding the protein of claim 1;

b2 An expression cassette comprising the nucleic acid molecule of B1);

3. The use according to claim 1 or 2, characterized in that the cassava potassium protein is any of,

a1 A protein having an amino acid sequence of SEQ ID No. 1;

4. The use according to claim 2, wherein B1) the nucleic acid molecule is a cDNA molecule or a DNA molecule whose coding sequence is SEQ ID No. 2.

5. A method for advancing flowering in a plant, comprising upregulating or enhancing or increasing expression of a gene encoding the protein of claim 1 or the protein content in a plant of interest to advance flowering in said plant of interest.

6. The method according to claim 5, wherein the up-regulation or enhancement or increase of the expression level of the gene encoding the protein according to claim 1 or the content of the protein in the plant of interest is the introduction of the gene encoding the protein according to claim 1 into the plant of interest.

7. The use according to any one of claims 1 to 4, and/or the method according to claim 5 or 6, the plant being any one of the following:

g1 Monocotyledonous or dicotyledonous plants;

g2 Plants of the order gramineae or cruciferous;

g3 Gramineae or cruciferous plants;

g4 Rice or arabidopsis plants;

g5 Rice or arabidopsis thaliana.

8. A biomaterial characterized in that the biomaterial is any one of the following:

b1 A nucleic acid molecule encoding the protein of claim 1;

b2 An expression cassette comprising the nucleic acid molecule of B1);

b6 A gene encoding the nucleic acid molecule of B5);

b7 An expression cassette comprising the gene of B6);

9. The biomaterial according to claim 8, characterized in that: b1 The nucleic acid molecule is a cDNA molecule or a DNA molecule with a coding sequence of SEQ ID No. 2.

10. The protein according to claim 1.