CN102559699B - CsCoL1 gene relative to cymbidium sinense photoperiod and application of CsCoL1 gene - Google Patents

Abstract

The invention discloses a CsCoL1 gene relative to cymbidium sinense photoperiod and the application of the CsCoL1 gene. The nucleotide sequence of the CsCoL1 gene is shown from 40th site base to 1020th site base in SEQ ID (sequence identity) NO.1; the nucleotide sequence of encoding protein of the CsCoL1 gene is shown in SEQ ID NO.2; a recombinant plant expression vector contains the CsCoL1 gene; in addition, the CsCoL1 gene is applied to shortening the juvenile period of plants and promoting the plants to bloom. The CsCoL1 gene is cloned from a CONSTANS-like gene-CsCoL1 gene in cymbidium sinense, can be proved to influence the growth and development program of the plants through experiments, and can promote the plants to bloom. Therefore, the CsCoL1 gene of cymbidium sinense provides an effective technical means to improve the growth program of the plants in gene engineering as well as adjust and control the blooming period of the plants, and achieves a broad application prospect and a great economic value.

Description

Chinese cymbidium photoperiod related gene CsCOL1 and application thereof

Technical field:

The invention belongs to molecular biology, gene engineering technology field, be specifically related to a kind ofly express in Chinese cymbidium, CONSTANS-like gene-CsCOL1 gene relevant with the photoperiod and proteins encoded thereof, the recombinant plant expression vector that contains this gene and CsCOL1 gene are in the application that promotes on the growth and development of plants.

Background technology:

The duration of day (being the photoperiod) is one of principal element that influences flowering time.Arabidopis thaliana is a kind of typical long day plant, and the long day can promote Arabidopis thaliana to bloom, and short day then can suppress to bloom.Present discovers that the main regulatory gene in the photoperiod approach has CONSTANS (CO), CRY2/FHA, GIGANTEA (GI), FT and FWA, their mutant is late blooming under long day (LD) condition, but flowering time is similar to wild-type under short day (SD) condition.

CO is the key gene in the plant photoperiod signal transduction path, and under the common regulation and control of Photoreceptors and physiological clock, gene expression amount was rhythmicity within one day changes.Putterill etc. find a mutant of blooming and postponing than wild-type early than nineteen ninety-five in Arabidopis thaliana, adopt the method for map based cloning to be separated to the CO gene then, this gene is expressed in root and leaf, and CO impels Arabidopis thaliana to bloom under the long day, but inoperative under the short day condition.Afterwards, Yano etc. were cloned into the CO homologous gene HD1 of Arabidopis thaliana in paddy rice, and HD1 sudden change back paddy rice reduces photoperiodic sensitivity.

CO albumen is a transcription factor, and it is not the final product of decision flowering of plant, but controls flowering time by the expression of regulation and control downstream gene FT and SOC1.Behind the overexpression CO gene, the expression amount of FT and SOC1 increases, and flowering time shifts to an earlier date, but the overexpression CO potency of gene is also not obvious in the FT mutant, illustrates that CO depends on FT to regulate and control the flowering of plant time.CO is positioned at the physiological clock output pathway, plays the tie effect between physiological clock and flowering time.

Chinese cymbidium (Cymbidium.sinense) is the Xiao Hua type ground non-hibernating eggs in the orchid family (Orchidaceae) Cymbidium (Cymbidium), its fragrance of a flower strong fragrance, color and luster is simple and elegant, the flower appearance is beautiful, the leaf attitude is elegant, enjoys great popularity, and is one of China's tradition inscription flower, having good marketable value, is the state orchid of industrialization maximum.China mainly concentrates on the Spring Festival and other important Holidays to the traditional consumption phase of flowers, and the florescence of Chinese cymbidium, the consumption of Chinese cymbidium also mainly concentrated on the Spring Festival from March in October to next year, At All Other Times, can not bloom owing to it, and market comsupton is also more limited.The industrialization that enlarges Chinese cymbidium is also wanted to bloom to save listing, and its commodity value just can be higher.Influence that Chinese cymbidium grows and the factor of blooming has fertilizer, matrix, temperature, illumination, hormone etc., produce the technical system that does not also have the Chinese cymbidium florescence control at present.

At present, the research of Chinese cymbidium florescence control aspect is fewer, and Pan Ruichi and Ye celebrate one's birthday and find that low temperature can promote the bud differentiation and the growth of Chinese cymbidium.Illumination also is the important factor that influences Chinese cymbidium bud differentiation, bennet growth and even bloom.In the fall, if the illumination deficiency, its bud differentiation meeting is postponed, and the bud quantity of differentiation reduces; The power of illumination also has tangible influence to the pattern of Chinese cymbidium, if insufficient light, then pattern dimness; When light was strong, then pattern was bright-coloured, but illumination crosses and also can make pattern thin out by force, and can make the florescence shorten (Zhu Genfa and Guo Zhenfei, 2004).Therefore, should be in good time in regulating at florescence of Chinese cymbidium give suitable illumination and could guarantee normal bud differentiation and bloom, even early flowering.But the molecule mechanism that the illumination effect Chinese cymbidium is bloomed does not still have report.

Summary of the invention:

First purpose of the present invention provides a kind of that express, relevant with photoperiod CONSTANS-like gene-CsCOL1 gene in Chinese cymbidium, its nucleotide sequence as the 40th of SEQ ID NO.1 to shown in 1020 bit bases, and proteins encoded, its aminoacid sequence is shown in SEQ ID NO.2 and contain the recombinant plant expression vector of CsCOL1 gene.

The present invention is a material with the bud of Chinese cymbidium " enterprise sword chalk " (Cymbidium.sinense ' Qi Jian Bai Mo '), extract its total RNA, again the mRNA reverse transcription is become cDNA first chain, with this cDNA first chain template, homologous gene conservative region design primer according to CONSTANS-like, utilize the method amplification splicing of RT-PCR and RACE to obtain full length cDNA sequence, this cDNA sequence length is 1186bp, its sequence is shown in SEQ ID NO.1, its open reading frame is to hold the 40th to the 1020th bit base from 5 ', be total to 981bp, with this open reading frame called after CsCOL1 gene, its 326 amino acid of encoding, its sequence is shown in SEQ ID NO.2, with this albumen called after CsCOL1 albumen.

The CsCOL1 encoded protein matter sequence of Chinese cymbidium is analyzed its homology with ClustalW2, the result as shown in Figure 1, Fig. 1 shows that CsCOL1 albumen has two conservative B-box-type zinc and refers to territory and a CCT territory, and the PhalCOL homology of it and butterfly orchid is the highest, is 84～85%; Be respectively 42% and 38% with the homology of paddy rice Hd1, Arabidopis thaliana AtCO.This shows that the CsCOL1 gene is a new photoperiod key gene CONSTANS-like.

The inventor is connected above-mentioned CsCOL1 gene with plant expression vector, by agriculture bacillus mediated, the recombinant plant expression vector that will contain the CsCOL1 gene is transformed in the tobacco, becomes to contain the transgene tobacco of CsCOL1 gene through tissue culture.Experiment finds that this transgene tobacco is compared with wild-type tobacco, and transgene tobacco is bloomed in advance than wild-type tobacco, and the average flowering time of 10 transformants is 49 days, and the average flowering time of wild-type is 63 days.Show that thus external source CsCOL1 gene is the structure gene with function, it has realized overexpression in the host tobacco, promoted the transgene tobacco reproductive growth, thereby has shortened flowering time, so this gene can influence the growth of plant.

Can show that from the The above results analysis CsCOL1 gene of the present invention is a new CONSTANS-like gene relevant with the photoperiod, this gene can promote the plant reproductive growth, shortens flowering time, thereby influences the growth of plant.

Therefore second purpose of the present invention provides the CsCOL1 gene shortening the virgin phase of plant, promotes the application in the flowering of plant.

Described plant optimization is tobacco or Chinese cymbidium.

CsCOL1 gene of the present invention is connected with plant expression vector, by agriculture bacillus mediated vegetable cell, tissue or the organ of entering, becomes genetically modified vegetable transformant by tissue culture, thereby realizes shortening plant child vegetative period phase, promotes flowering of plant.

Described plant expression vector can be any one and can be used for the carrier etc. that agrobacterium tumefaciens or Agrobacterium rhizogenes transform the binary vector of plant or can be used for the plant micropellet bombardment, as pBI serial carrier, pBin serial carrier, Gateway ^TWSerial carrier, pCAMBIA serial carrier or other plant expression vector etc. of deriving, above-mentioned carrier is the commodity of public offering.

CONSTANS-like gene-CsCOL1 gene that the present invention clones from Chinese cymbidium first, and prove that by experiment this gene can influence the growth and development of plants process, impels plant to bloom in advance.Therefore, Chinese cymbidium CsCOL1 gene provided by the invention is the growth course of genetically engineered improvement plant, regulates and control to provide a kind of effective technical means to the florescence of plant, is with a wide range of applications and economic worth greatly.

Description of drawings:

Fig. 1 is the aminoacid sequence and the homogenic aminoacid sequence comparison diagram of CONSTANS-like of Chinese cymbidium CsCOL1 genes encoding, Arabidopis thaliana AtCO (Acc.No.NP_197088) wherein, Arabidopis thaliana AtCOL1 (Acc.No.NP_197089.1), Arabidopis thaliana AtCOL2 (Acc.No.NP_186887.1), Arabidopis thaliana AtCOL3 (Acc.No.NP_973530.1), paddy rice Hd1 (Acc.No.ABB17664), barley HvCOL (Acc.No.AAM74069), butterfly orchid PhalCOL ((Acc.No.FJ469986), amino acid with consistence and similarity represents with black and gray shade that respectively the B-box territory of CONSTANS-like gene and CCT territory are indicated with horizontal line on sequence;

Fig. 2 detects the expression amount of CsCOL1 gene in Chinese cymbidium vegetative organ root, stem, leaf by Real-time PCR, 1 is root in the X-coordinate wherein; 2 is pseudobulb; 3 is leaf; Ordinate zou is represented the height of relative expression quantity;

Fig. 3 detects the CsCOL1 gene Chinese cymbidium bennet, bud and floral organ by Real-time PCR: the expression amount in anthocaulus, sepal, petal, lip, column cap, stem, the leaf 1 is a bennet in the X-coordinate wherein; 2 is anthocaulus; 3 is bud; 4 is sepal; 5 is petal; 6 is lip; 7 is column cap; Ordinate zou is represented the height of relative expression quantity;

Fig. 4 is the PCR evaluation figure that expression vector pBI121-35s-CsCOL1 transforms Agrobacterium, and wherein M is Marker 2000, and 1-11 is that the positive colony, 12 that screens is connection carrier pBI121-35s-CsCOL1 plasmid positive control; 13 is empty carrier plasmid pBI121 negative control;

Fig. 5 is that the PCR of transgenosis (CsCOL1) tobacco identifies figure, and wherein M is that Marker 2000,2-10 are CsCOL1 transgene tobacco strain system; 1 is connection carrier pBI121-35s-CsCOL1 plasmid positive control; CK is the wild-type tobacco negative control.

Embodiment:

Further explain the present invention below in conjunction with specific embodiment.Should be understood that these examples only are not used in to be used to the present invention is described limits the scope of the invention.Unreceipted concrete experimental technique in the following example all can carry out according to ordinary method.Condition described in " fine works molecular biology experiment guides " such as " molecular cloning experiment guide ", F. Ao Sibai such as J. Sa nurse Brookers, or according to the operation instruction of used products production manufacturer.

Embodiment 1:

One, the clone of Chinese cymbidium CsCOL1 gene and homology analysis thereof.

(1) be test materials with Chinese cymbidium kind " enterprise sword chalk " (Cymbidium sinense. ' Qi Jian Bai Mo '), vegetable material under the greenhouse normal condition, grow (L/D, 14h/10h; 25-28 ℃).

(2) RNA extracts: the total RNA that carries out test materials with Trizol reagent (available from Invitrogen company) extracts, and the entire operation process is extracted process description in strict accordance with the RNA of Trizol reagent.

(3) adopt M-MLV ThermoScript II (available from Promgra company) reverse transcription mRNA to become cDNA first chain, method is carried out according to the reagent specification sheets.

The clone of gene: Chinese cymbidium bud cDNA first chain with reverse transcription is a template, according to homogenic two forward special primer CO-3A of conserved sequence design of CONSTANS-like and CO-3B, adopts the amplification of 3 '-RACE method to obtain 3 terminal sequences of 348bp.

Primer is: CO-3A:GGAGGCNAGGGTBHTGAG;

CO-3B：GARVAAGAVBMGGMRGTTYGAG

Adopt Golden DNA polymerase (TIANGEN) to carry out pcr amplification, the specification sheets of application of sample system reference enzyme, first round PCR response procedures is: 94 ℃ of pre-sex change 4min; 94 ℃ of sex change 30s, 56 ℃ of annealing 45s, 72 ℃ are extended 1min, carry out 20 circulations altogether; 72 ℃ are extended 10min.Second takes turns the PCR response procedures is: 94 ℃ of pre-sex change 4min; 94 ℃ of sex change 30s, 56 ℃ of annealing 45s, 72 ℃ are extended 1min, carry out 35 circulations altogether; 72 ℃ are extended 10min, 4 ℃ of termination reactions.

According to the sword chalk COL of enterprise 3 ' terminal nucleotide sequence, design two special primer CO-5A and CO-5B that point to 5 ' end, adopting the amplification of 5 '-RACE method to obtain the purpose clip size is 929bp.

Primer is: CO-5A:5-GAACGACGCCGTAGCCTTGAACTGC-3

CO-5B：5-GACTCCACTTCCGTCCGCTTCGCAA-3

5 ' terminal sequence pcr amplification reaction program is: adopt Golden DNA polymerase (TIANGEN) to carry out pcr amplification, the specification sheets of application of sample system reference enzyme, first round PCR response procedures are 95 ℃ of sex change 1min, follow 5 circulating reaction (94 ℃ of 30s, 72 ℃ of 2min), follow 5 circulating reactions (94 ℃ of 30s, 70 ℃ of 30s again, 72 ℃ of 1.5min), last 25 circulating reactions (94 ℃ of 30s, 68 ℃ of 30s, 72 ℃ of 1.5min), 72 ℃ are extended 10min, 4 ℃ of termination reactions.Second takes turns the PCR response procedures is: 95 ℃ of pre-sex change 1min, follow 30 circulating reactions (94 ℃ of 30s, 68 ℃ of 30s, 72 ℃ of 1.5min), and 72 ℃ are extended 10min, 4 ℃ of stopped reactions.

5 ' end and the splicing of 3 ' terminal sequence are obtained full length cDNA sequence, its nucleotide sequence is shown in SEQ ID NO.1, this sequence length is 1186bp, the open reading frame of this sequence be SEQ ID NO.1 from 5 ' end the 40th to the 1020th bit base, be total to 981bp, with this open reading frame called after CsCOL1 gene, the polypeptide that this genes encoding is made up of 326 amino-acid residues, its aminoacid sequence is shown in SEQ ID NO.2, and proteinic pI/Mw is respectively 5.93/34375.7.Utilize SMART program on-line prediction, the albumen of CsCOL1 genes encoding does not all have the membrane structure of striding and signal peptide, is water-soluble protein.The CDD program of using among the NCBI is carried out the amino acid structure domain analysis to it, and the result shows that it contains two B-box type Zinc finger domains and a CCT structural domain.The aminoacid sequence of Chinese cymbidium CsCOL1 genes encoding is analyzed its homology with ClustalW2, and the result shows that the PhalCOL homology of it and butterfly orchid is the highest, is 84～85%; Next is the COL of barley, is 49%; Be respectively 43～44%, 42% with the homology of the Hd1 of the AtCOL3 of Arabidopis thaliana, paddy rice; Lower with the homology of Arabidopis thaliana AtCO, be 38% (see figure 1).

Two, Chinese cymbidium CsCOL1 gene expression pattern is analyzed

Vegetative growth phase and reproductive stage at Chinese cymbidium, extract the root, pseudobulb, blade, bud, bennet of Chinese cymbidium plant and total RNA of different floral organ respectively with Trizol reagent (Invitrogen), remove genomic dna with DNase I (Takara) processing, quantitatively take out 2 μ g RNA behind the mensuration OD260.And then use oligo-dT primer and PrimeScript ^TMReverse Transcriptase (available from Takara company) carries out reverse transcription reaction (method is with reference to specification sheets).

Stride the intron special primer according to enterprise's sword chalk CsCOL1 gene order and confidential reference items ACTIN sequences Design, primer sequence is as follows:

qCO-F：5’-TGGGAGGAAAAGGAGCAGAA-3’；

qCO-R：5’-CGCCCGACAGAATAGAACC-3’；

qACT-F：5’-TTTATGAGGGTTATGCGCTTCC-3’；

qACT-R：5’-ATTTCCCGTTCCGCAGTAGTT-3’。

With after 5 times of the gained cDNA dilutions as template, carry out the real-time quantitative RT-PCR reaction.Reaction system and program reference Premix Ex Taq ^TMII (TaKaRa) specification sheets reacts on ABI 7500 Real-time PCR instrument.Four repetitions are established in each reaction, and the gained data use ABI 7500 Real-time PCR system softwares to handle.

Analyze the expression characteristic of CsCOL1 gene in enterprise's sword chalk Different Organs, the result as shown in Figure 2, Fig. 2 shows that the CsCOL1 gene all has expression in the root of plant, stem, leaf, but the expression intensity in blade will be apparently higher than the expression in root and stem, and the expression in root is the most weak; Behind the plant blossom, the CsCOL1 gene also all has expression (Fig. 3) in bennet, bud and different floral organ, and wherein the expression intensity in petal and sepal will be apparently higher than the expression in other organ.

Three, the expression of Chinese cymbidium CsCOL1 gene in tobacco and the phenotypic evaluation of transfer-gen plant

(1) contains the structure of goal gene CsCOL1 expression vector

The cDNA that obtains with the front reverse transcription is a template, uses the LA Taq enzyme of Takara company to increase, the reaction system by specification, and amplimer is

CsCO-F：5’-AATGGATCCATGGGAGGAAAAGGAGCAGAAGGC-3’；

CsCO-R-5’-CATGGATCCTTAGAAAGATGGAACGACGCCGTA-3’。

Response procedures is 94 ℃ of 4min; 94 ℃ of 30sec, 53 ℃ of 45sec, 72 ℃ of 2min, 35cycles; 72 ℃ of 5min.

Amplified production is through agarose electrophoresis, and glue reclaims order-checking, determines to obtain the CsCOL1 gene, and the CsCOL1 gene that amplification is obtained is connected with the pMD18-T carrier of Takara company, transforms and enters (idiographic flow is referring to the specification sheets of T carrier) in the intestinal bacteria.

Extraction contains the T vector plasmid of CsCOL1 gene, utilize restriction enzyme site BamH I that the CsCOL1 gene is downcut and purifying from the T carrier, plant expression vector pBI121 cuts the back phosphorylation with BamH I enzyme and handles, be connected with CsCOL1 gene after enzyme is cut purifying again, ligase enzyme T4DNA Ligase (available from Takara company), concrete operations by specification method is carried out, and makes up to obtain to contain goal gene CsCOL1 expression carrier pBI121-35s-CsCOL1.

(2) adopt electric shocking method to be transformed among the agrobacterium tumefaciens LBA4404 recombinant plasmid expression vector pBI121-35s-CsCOL1.

Get 1 μ l recombinant plasmid expression vector pBI121-35s-CsCOL1 and the Agrobacterium LBA4404 competent cell mixing that has just made, place 10min on ice.

This mixture is transferred to the pole cup electric shock of precooling.

In the electric shock cup, add the YM liquid nutrient medium of 1000 μ l, behind the re-suspended cell, transfer in the centrifuge tube of 1.5ml, 28 ℃, 220-250rpm recovery 2-4 hour.Described YM liquid nutrient medium is this area substratum commonly used, and it is filled a prescription with reference to " molecular cloning experiment guides " such as J. Sa nurse Brookers.

Converted product is coated on the flat board of YM+Kan (kantlex) 50mg/L+ Vetstrep 25mg/L,

Being put in 28 ℃ of incubators cultivated 48 hours.

The picking mono-clonal carries out bacterium colony PCR and identifies that the PCR primer that bacterium colony is identified is CsCO-F and CsCO-R, and bacterium colony PCR identifies that as shown in Figure 4 wherein 1～11 is that the positive colony, 12 that screens is connection carrier pBI121-35s-CsCOL1 plasmid positive control; 13 is empty carrier plasmid pBI121 negative control.As can be seen from Figure 4, positive colony 1～11 all amplifies the CsCOL1 gene fragment, illustrates that thus expression vector pBI121-35s-CsCOL1 has changed among positive colony 1～11 agrobacterium tumefaciens LBA4404.Choosing the agrobacterium tumefaciens LBA4404 that has changed expression vector pBI121-35s-CsCOL1 over to clones as positive colony.

(3) utilize leaf dish method transformation of tobacco

The picking positive colony is inoculated in the YM liquid nutrient medium that contains Kan (kantlex) 50mg/L and Vetstrep 25mg/L, and 28 ℃ of 200rpm shaking culture 24-36h make OD ₆₀₀About=0.5.

Bacterium liquid is changed in the aseptic 50ml centrifuge tube, 5000rpm, the centrifugal collection bacterial classification of 15min is used the MS liquid nutrient medium suspension bacterial classification of equal volume again, prepares to contaminate blade.Described MS substratum is this area substratum commonly used, and its prescription is with reference to (Murashige T and Skoog F, 1962).

Under aseptic condition, the mature leaf of tobacco aseptic seedling is removed the limb edge, be cut into the fritter of 0.5 * 1.0cm, be immersed in the bacterium liquid for preparing.

Take out blade suction on the filter paper of sterilization behind the 10min and remove bacterium liquid, be placed on that to contain massfraction be that 3% sucrose and massfraction are in the MS substratum of 0.6-0.7% agar, place 24 ± 1 ℃ of illumination boxs, cultivated altogether 48 hours under 14h illumination/10h dark condition.

When seeing that blade and substratum engagement edge grow white Agrobacterium, blade is transferred in the MS liquid nutrient medium that does not add hormone, vibration rinsing 45-60min on 28 ± 1 ℃ of constant temperature shaking tables presss from both sides out on the filter paper that blade is put in sterilization and removes the excess liquid substratum.

Change blade over to the screening culture medium of sprouting, place 24 ± 1 ℃ of illumination boxs, 14h illumination/10h dark condition is cultivated down, and the described screening culture medium of sprouting is to contain 500mg Carbenicillin (Pyocianil), 300mg Kanamicine (kantlex), 0.1mgNAA (α-Nai Yisuan), 1.0mg BA (6-benzyladenine), 0.59g MES[2-(N-morpholino) ethyl sulfonic acid in every liter of MS substratum], 30g sucrose, 6-7g agar, pH 5.7-5.8;

Visible differentiation bud grows after about 20 days, after treating that bud is grown up, downcut and change root media over to and screen, place 24 ± 1 ℃ of illumination boxs, 14h illumination/10h dark condition is cultivated screening down, and described root media is that every liter of MS substratum contains 200mg Carbenicillin, 100mg Kanamicine, 15g sucrose and 6-7g agar, pH 5.7-5.8;

After treating well developed root system, plant is taken out, clean the solid medium that adheres to, move in the soil, cultivate in the greenhouse and obtain transfer-gen plant with sterilized water.

(4) Molecular Identification of transfer-gen plant.

" the Universal Genomic DNA Extraction Kit " of Takara adopted in the extraction of DNA.Genomic dna with transfer-gen plant is that template is carried out pcr amplification, design forward primer P35S:GAAACCTCCTCGGATTCCAT on the CaMV35S section in the pBI121 carrier, CsCO-R is that reverse primer carries out the pcr amplification evaluation, detects with 1% agarose gel electrophoresis.Wherein M is that Marker 2000,2-10 are CsCOL1 transgene tobacco strain system; 1 is connection carrier pBI121-35s-CsCOL1 plasmid positive control; CK is the wild-type tobacco negative control.As seen from Figure 5,1-10 has and goal gene (981bp)+490bp fragment of the same size, and wild-type plant CK does not detect corresponding fragment, shows that carrying external source Chinese cymbidium CsCOL1 expression of gene plasmid has been inserted in the tobacco gene group.

(5) transfer-gen plant carries out phenotypic evaluation.

To cultivate under above-mentioned transgenic tobacco plant that carries external source Chinese cymbidium CsCOL1 expression of gene plasmid and the wild-type tobacco equal conditions, compare with wild-type tobacco, transgene tobacco is bloomed in advance than wild-type tobacco, under the equal culture condition, wild-type tobacco needed bloom in 63 days, and the tobacco that changes the CsCOL1 gene over to only needed bloom in 49 days.Show that according to the result external source CsCOL1 gene has been realized overexpression in the host tobacco, thereby shortened flowering time.Test-results shows that Chinese cymbidium CsCOL1 gene is the gene that function is arranged, and can influence the growth of plant, has the promotion reproductive growth, shortens the effect of flowering time.

By the The above results analysis revealed, CsCOL1 gene of the present invention is a new CONSTANS-like gene relevant with the photoperiod, and this gene can promote the reproductive growth of plant, shortens flowering time, thereby influences the growth of plant.

Claims (5)

1. relevant CsCOL1 gene of Chinese cymbidium photoperiod is characterized in that, the nucleotide sequence of described CsCOL1 gene as the 40th of SEQ ID NO.1 to shown in 1020 bit bases.

2. the protein by the described CsCOL1 genes encoding of claim 1 is characterized in that, its aminoacid sequence is shown in SEQ ID NO.2.

3. recombinant plant expression vector that contains the described CsCOL1 gene of claim 1.

4. recombinant plant expression vector according to claim 3 is characterized in that, described plant expression vector is pBI serial carrier, pBin serial carrier, Gateway ^TWSerial carrier or pCAMBIA serial carrier.

5. the described CsCOL1 gene of claim 1 is shortening the virgin phase of tobacco, the application during the promotion tobacco blooms.

Images