CN101845085B - Wild soybean AP1 type protein and coding gene and application thereof - Google Patents

Abstract

The invention discloses a wild soybean AP1 type protein and a coding gene and application thereof, which belong to the field of biotechnology. The wild soybean AP1 type protein is known as a GsAP1 protein and is the protein which has an amino acid sequence of SEQ ID NO.2 in a sequence table. The coding gene of the wild soybean AP1 type protein is a DNA sequence of SEQ ID NO.1 of a GsAP1 gene. The wild soybean AP1 type protein and the coding gene thereof can be used for cultivating early flowering plant varieties, in particular early flowering and early maturing soybean varieties. The GsAP1 is mainly expressed in flowers, has an extreme low expression level in roots, stems and seeds, and has no expression in other tissues. Compared with a tobacco transferred into an empty carrier, a tobacco plant over-expressing the GsAP1 has a much earlier blooming stage, about 65.7 days in advance, which proves that the GsAP1 gene can cause the blooming stage of plants to be earlier and promote the plants to bloom in advance.

Description

A kind of Wild soybean AP 1 type protein and encoding sox thereof and application

Technical field

The present invention relates to plant genetic engineering field.Be specifically related to wild soybean MADS-box gene family SQUA subfamily AP1 proteinoid and encoding sox and the application relevant, and relate to the MADS-box gene family SQUA subfamily AP1 proteinoid relevant and encoding sox and its application in cultivating the early blossoming plant variety that derives from wild soybean with early blossoming with early blossoming.

Background technology

Soybean (Glycine max L.) originates from China, and cultivation history is the longest, is important farm crop and cash crop, is again the important feed of industrial raw material and livestock poultry, or the important export goods and materials.Not only there is abundant the cultivated soybean resource in China as the native place of soybean, and wild soybean germ plasm resource is also very abundant.Wild soybean is integral parts always of plant germplasm resource as ancient species.Its genetic diversity scope is wide, and many pods branch is overgrow, spent more to stalk, has bigger high yield potentiality; Having protein content height, the low multiple important good characters such as disease-resistant worm, anti-adverse circumstance that reach of lipid content, is the important gene source of soybean germplasm improvement.Therefore, its hybridization utilizes more and more and is paid attention to by breeding man, becomes the improvement soybean quality, improves the important germ plasm resource of soybean yields.

In south, the summer soybean production later stage often meets with rainy season, and soybean has little time results and just on plant, begins to germinate.Some kind makes maturation be in high temperature because vegetative growth phase is long, and the protein in the seed takes place rotten, and seed becomes brown and produces toxic substance.Therefore, through breeding.Using gene engineering technique carries out breeding, makes southern soybeans they grow avoid high temperature and rainy season the breeding time of appropriate change soybean, to improving the yield and quality of southern soybean, has great significance.

Summary of the invention

Technical problem

The purpose of this invention is to provide a kind of wild soybean MADS-box gene family SQUA subfamily AP1 proteinoid and encoding sox and application.

Technical scheme

Wild soybean MADS-box gene family SQUA subfamily AP1 proteinoid provided by the present invention; Name is called the GsAP1 proteinoid; Deriving from Glycine wild soybean (Glycine soja Sled.et Zucc.), is the protein with the said aminoacid sequence of SEQ ID NO.2 in the sequence table.

The encoding sox of above-mentioned wild soybean MADS-box gene family SQUA subfamily AP1 proteinoid, its cDNA gene has the dna sequence dna of GsAP1 genes of SEQ ID NO.1 in the sequence table; Wherein, the GsAP1 genes of SEQ ID NO.1 in the sequence table is by 711 based compositions, and this sequence is the reading frame of GsAP1 gene, and coding has the protein of 236 amino acid residue sequences of SEQ ID NO.2 in the sequence table.

The expression vector that contains GsAP1 genes of SEQ ID NO.1 of the present invention is meant pMDC83-GsAP1 plant overexpression carrier, and the host bacterium is meant the agrobacterium tumefaciens bacterial strain EHA105 that the GsAP1 gene is changed over to.

The primer of amplification GsAP1 gene is:

GsAP1-ORF sense：5’ATGGGAAGGGGTAGGGTT 3’，

GsAP1-ORF antisense：5’TGTCAAATGCCATACCAAAGC 3’

The qPCR primer of the GsAP1 gene that relates in the real-time fluorescence quantitative PCR analysis is:

GsAP1-qPCR sense：5’GGAGAAAGTGATACAGGAGCAGAAT 3’，

GsAP1-qPCR antisense：5’GCTGCGGTAGCAAGAAAGATG 3’。

Above-mentioned wild soybean MADS-box gene family SQUA subfamily AP1 proteinoid and encoding sox GsAP1 gene thereof can early be applied in the flowering plant in cultivation.

Beneficial effect

GsAP1 can make advance flowering period, and GsAP1 is induced strong in the flower tissue of wild soybean, and faint expression is arranged in root, stem and seed.The tobacco that imports overexpression GsAP1 is compared with the tobacco that changes empty carrier over to, and significantly shift to an earlier date its flowering period, explains that the GsAP1 gene is playing an important role aspect shifting to an earlier date the flowering period of impelling plant.

GsAP1 of the present invention is to cultivating the particularly precocious soybean of early blossoming of early blossoming plant variety, and particularly the output of soybean is significant to improve farm crop.

Utilize plant expression vector, with the encoding sox importing vegetable cell of GsAP1 of the present invention, transgenic cell line that can obtain to bloom in advance and transfer-gen plant.

When using GsAP1 to make up plant expression vector, before its transcription initiation Nucleotide, can add any enhancement type promotor or inducible promoter.For the ease of transgenic plant cells or plant being identified and screening; Can process used plant expression vector, as adding selected marker's (gus gene, GFP gene etc.) that can in plant, express or antibiotic marker thing (qingfengmeisu qiong affinity tag, kantlex affinity tag, Totomycin affinity tag etc.) with resistance.From the security consideration of transgenic plant, can not add any selected marker, directly with adverse circumstance screening transformed plant.

Carry GsAP1 of the present invention plant expression vector can Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, electricity be led, conventional biological method transformed plant cells or tissue such as agriculture bacillus mediated through using, and the plant transformed tissue cultivating is become plant.By the plant transformed host both can be monocotyledonss such as paddy rice, wheat, corn, also can be dicotyledonss such as soybean, cucumber, tomato, willow, turfgrass, clover.

Below in conjunction with accompanying drawing and embodiment the present invention is further specified.

Description of drawings

Fig. 1 is the expression characterization figure of GsAP1 in wild soybean different tissues or organ

Rt, young root; St, young stem; Lf, blade; Sa, stem apex; In contains flower; Sd, the back 21 days seed of blooming.The expression of B.GsAP1 in wild soybean four-wheel floral organ.Se, calyx; Pe, petal; St, stamen; Ca, carpel.C.GsAP1 is in the expression of the different flower growth period of wild soybean.Bd, bud; Fd, bud; In contains flower.D.GsAP1 interim expression when the different seed development of wild soybean.

Fig. 2 is the part-structure synoptic diagram that contains the plant expression vector of GsAP1

Annotate: wild soybean GsAP1 plant conversion carrier is kalamycin resistance and hygromycin resistance in bacillus coli DH 5 alpha, and the agrobacterium tumefaciens bacterial strain uses therefor is EHA105.

Fig. 3 be the cDNA of tobacco plant WT-1 and WT-2 of transgenic tobacco plant Line4, Line15, Line25, Line27, Line28, Line30 and commentaries on classics empty carrier as template, as interior mark, carry out the real-time fluorescence quantitative PCR analysis with the actin of tobacco.

Annotate: template used is the RNA of tobacco leaf.

Fig. 4 is for comparing (* *, P≤0.01) flowering period of transgene tobacco and the tobacco plant that changes empty carrier over to, and be 105.05 days the average flowering period of changeing the GsAP1 gene, and comparison is according to blooming about 65.7 days in advance.

Annotate: be 105.05 days the average flowering period of changeing the GsAP1 gene, and comparison is according to blooming about 65.7 days in advance.

Embodiment

Method therefor is ordinary method if no special instructions among the following embodiment.

(1) cDNA of wild soybean GsAP1 and encoding sox thereof clone and evaluation

With wild soybean Jiangpu wild beans-5 (He Hui etc., 2009, soybean science; 28 (5): 784-790) be material, through the method for information biology, with the Arabidopis thaliana AP1 protein sequence (AP1 that has reported; The number of landing AAM65504.1) is kind of a subsequence; The est database of search soybean finds a height homologous EST fragment, and unnamed gene is GsAP1.CDNA with the wild soybean flower is that template is carried out pcr amplification, and the result amplifies and expects and carries out rubber tapping purifying, connection and the transformation of PCR product subsequently by band of the same size, the order-checking of picking positive colony.Sequencing result shows the sequence of being cloned into wild soybean GsAP1 gene, and ORFs is complete, and wild soybean GsAP1 gene ORF total length is 711bp, 236 amino acid of encoding.

The primer of amplification GsAP1 gene is:

GsAP1-ORF sense：5’ATGGGAAGGGGTAGGGTT 3’，

GsAP1-ORF antisense：5’TGTCAAATGCCATACCAAAGC 3’。

Use the method for real-time fluorescence quantitative PCR, amplification GsAP1 gene from total RNA of wild soybean flower.Get the flower of wild soybean, place liquid nitrogen to grind, be suspended from the 4mol/L sulphur hydracid guanidine, and, in supernatant, add absolute ethyl alcohol and precipitate, will precipitate total RNA that obtains soluble in water at last with acid phenol, chloroform extracting.Getting the total RNA of 5 μ g and carry out reverse transcription with reverse transcription test kit (TOYOBO company) by the method for test kit, is that template is carried out pcr amplification reaction with the cDNA fragment that obtains.20 μ l PCR reaction systems are: 1 μ l, one chain cDNA (0.05 μ g), each 1 μ l (10 μ M) of upstream and downstream primer, 2 μ l, 10 * PCR damping fluid, 0.4 μ l dNTP (10mM) and 1U Taq archaeal dna polymerase, supply 20 μ l with ultrapure water.Be reflected on the Bio-RAD PTC200 type PCR appearance and carry out, its program is 94 ℃ of preparatory sex change 5min; 94 ℃ of sex change 50s, 58 ℃ of annealing 50s, 72 ℃ are extended 1min, totally 32 circulations; 72 ℃ are extended 10min then; 4 ℃ of preservations.The sequential analysis after reclaiming of PCR product, the result shows that this PCR product has the nucleotide sequence of SEQ ID NO.1 in the sequence table.

(2) expression characteristic of wild soybean GsAP1 gene in different tissues or organ

To the wild soybean kind--Jiangpu wild beans-5 carry out the real-time fluorescence quantitative PCR analysis, analyze the expression of GsAP1 gene in each tissue of wild soybean or organ.The wild soybean material is seeded in the Agricultural University Of Nanjing solarium in the beginning of June after handling through hilum back otch, seedling stage built.Field management is with conventional.4 weeks got root, stem, leaf, stem apex after emerging; Initial bloom stage is got bud; Full-bloom stage is got petal and is contained flower; Take away the seed of spending back 10D, 15D, 20D, 21D, 25D, 30D, 35D, 40D, 45D, 50D.Containing flower takes off under the aseptic condition of back rapid separation and respectively take turns floral organ: calyx, petal, stamen and gynoecium ,-80 ℃ of preservations are subsequent use behind the liquid nitrogen flash freezer respectively.

The same step of extraction (one) of total RNA.Actin gene (GenBank accession No.V00450) with the soybean constitutive expression is an internal reference, is template with the total RNA from wild soybean different tissues or organ, carries out qPCR (real-time fluorescence quantitative PCR) and analyzes.The qPCR primer of GsAP1 gene is: GsAP1-qPCR sense:5 ' GGAGAAAGTGATACAGGAGCAGAAT 3 ', GsAP1qPCR antisense:5 ' GCTGCGGTAGCAAGAAAGATG 3 '.

Interpretation of result shows (Fig. 1), and GsAP1 is spending middle strong expression, and faint expression is arranged in root, stem and seed, and GsAP1 mainly expresses in the calyx in the four-wheel floral organ and the petal.GsAP1 belongs to the category-A gene in the classical ABC model, and the category-A gene is expressed in calyx and petal, in stamen and gynoecium, does not express.

(3) Function Identification of GsAP1 proteins encoded

Utilize Invitrogen company

Technology with Clonase ^TMThe II test kit is inserted into expression vector pMDC83 (Sokolov et al, 2005, PNAS, 103 with the GsAP1 forward; 9732-9737) in (Fig. 2); Obtain pMDC83-GsAP1 plant overexpression carrier, change pMDC83-GsAP1 over to agrobacterium tumefaciens bacterial strain EHA105 (Avsian-Kretchmer et al, 2004 with freeze-thaw method; PlantPhysiology, 135:1685-1696) in.PMDC83-GsAP1 is through the mediated transformation tobacco of Agrobacterium EHA105, and the PCR detected result shows acquisition 45 strain positive plants.Selected 6 positive transgenic lines (Line4, Line15, Line25, Line27, Line28, Line30) and changed the tobacco WT-1 of empty carrier over to and the blade RNA of WT-2 makes template in conjunction with the qPCR analytical results, the result shows that GsAP1 significantly expresses in transgene tobacco.The interpretation of result in statistics flowering period shows, explains that shift to an earlier date about 65.7 days the flowering period that overexpression GsAP1 gene can the render transgenic tobacco.

Sequence table

< 110>Agricultural University Of Nanjing

< 120>a kind of Wild soybean AP 1 type protein and encoding sox thereof and application

< 130>specification sheets

<160>6

<170>Patent In version 3.1

<210>1

<211>711

<212>DNA

< 213>Glycine wild soybean (Glycine soja Sled.et Zucc.)

<220>

< 221>GsAP1 gene reading frame (ORF)

<222>(1)..(711)

<223>

<400>1

atgggaaggg gtagggttca gctgaagagg atagagaaca agatcaatcg gcaggtaact 60

ttctccaaaa ggagagctgg gttactcaag aaagcacacg agatctctgt gctctgtgac 120

gctgaggtcg ctttgattgt cttctcccac aaaggaaagc tctttgaata tgccaccgat 180

tcttgcatgg agaagatact ggaacgctat gaaaggtatg cctatgcaga gagacaactt 240

gttgcaaatg attccgagtc acagggaaat tggaccattg agtatactag actcaaggca 300

aagattgacc ttttgcagag aaaccatagg cactatatgg gagaagattt aggttcaatg 360

agcctcaaag agcttcagag tctggagcag cagttagata ctgctctcaa gcaaattcgt 420

acccgcagaa accaactcat gtacgagtcc atttcggagc ttcaaaagaa ggagaaagtg 480

atacaggagc agaataacat gcttgcaaag aagatcaagg agaaagaaaa ggttgcagcg 540

cagcaagcac aatgggagca tccaaaccac ggagttaatg catctttctt gctaccgcag 600

ccacttttga acatgggtgg caattaccgt gaggaagcat cagaagtagg gaggaatgaa 660

cttgacctga ctctggaacc attatattcc tgtcaccttg gatgcttttg a 711

<210>2

<211>236

<212>PRO

< 213>Glycine wild soybean (Glycine soja Sled.et Zucc.)

<220>

< 221>GsAP1 protein sequence

<222>(1)..(236)

<223>

<400>2

Met Gly Arg Gly Arg Val Gln Leu Lys Arg Ile Glu Asn Lys Ile Asn

1 5 10 15

Arg Gln Val Thr Phe Ser Lys Arg Arg Ala Gly Leu Leu Lys Lys Ala

20 25 30

His Glu Ile Ser Val Leu Cys Asp Ala Glu Val Ala Leu Ile Val Phe

35 40 45

Ser His Lys Gly Lys Leu Phe Glu Tyr Ala Thr Asp Ser Cys Met Glu

50 55 60

Lys Ile Leu Glu Arg Tyr Glu Arg Tyr Ala Tyr Ala Glu Arg Gln Leu

65 70 75 80

Val Ala Asn Asp Ser Glu Ser Gln Gly Asn Trp Thr Ile Glu Tyr Thr

85 90 95

Arg Leu Lys Ala Lys Ile Asp Leu Leu Gln Arg Asn His Arg His Tyr

100 105 110

Met Gly Glu Asp Leu Gly Ser Met Ser Leu Lys Glu Leu Gln Ser Met

115 120 125

Glu Gln Gln Leu Asp Thr Ala Leu Lys Gln Ile Arg Thr Arg Arg Asn

130 135 140

Gln Leu Met Tyr Glu Ser Ile Ser Glu Leu Gln Lys Lys Glu Lys Val

145 150 155 160

Ile Gln Glu Gln Asn Asn Met Leu Ala Lys Lys Ile Lys Glu Lys Glu

165 170 175

Lys Val Ala Ala Gln Gln Ala Gln Trp Glu His Pro Asn His Gly Val

180 185 190

Asn Ala Ser Phe Leu Leu Pro Gln Pro Leu Leu Asn Met Gly Gly Asn

195 200 205

Tyr Arg Glu Glu Ala Ser Glu Val Gly Arg Asn Glu Leu Asp Leu Thr

210 215 220

Leu Glu Pro Leu Tyr Ser Cys His Leu Gly Cys Phe

225 230 235

<210>3

<211>18

<212>DNA

< 213>synthetic

<220>

<221>GsAP1-ORF sense

<222>(1)..(18)

<223>

<400>3

atgggaaggg gtagggtt 18

<210>4

<211>21

<212>DNA

< 213>synthetic

<220>

<221>GsAP1-ORF antisense

<222>(1)..(21)

<223>

<400>4

tgtcaaatgc cataccaaag c 21

<210>5

<211>25

<212>DNA

< 213>synthetic

<220>

<221>GsAP1-qPCR sense

<222>(1)..(25)

<223>

<400>5

ggagaaagtg atacaggagc agaat 25

<210>6

<211>21

<212>DNA

< 213>synthetic

<220>

<221>GsAP1-qPCR antisense

<222>(1)..(21)

<223>

<400>6

gctgcggtag caagaaagat g 21

Claims (10)

1. wild soybean MADS-box gene family SQUA subfamily AP1 proteinoid, called after GsAP1 albumen is the protein of the said aminoacid sequence of SEQ ID N0.2 in the sequence table.

2. the encoding sox of the described wild soybean MADS-box of claim 1 gene family SQUA subfamily AP1 proteinoid.

3. encoding sox according to claim 2 is characterized in that: the cDNA gene of wild soybean MADS-box gene family SQUA subfamily AP1 proteinoid is the dna sequence dna of GsAP1 genes of SEQ ID NO.1 in the sequence table.

4. contain claim 2 or 3 said expression carrier.

5. expression vector according to claim 4 is meant pMDC83-GsAP1 plant overexpression carrier.

6. the host bacterium that contains claim 2 or 3 said genes.

7. host bacterium according to claim 5 is meant the agrobacterium tumefaciens bacterial strain EHA105 that the GsAP1 gene is changed over to.

8. the primer of amplification claim 2 or 3 said genes is characterized in that:

The primer of amplification GsAP1 gene is:

GsAP1-ORF sense：5’ATGGGAAGGGGTAGGGTT 3’，

GsAP1-ORF antisense：5’TGTCAAATGCCATACCAAAGC 3’；

The qPCR primer of the GsAP1 gene that relates in the real-time fluorescence quantitative PCR analysis is:

GsAP1-qPCR sense：5’GGAGAAAGTGATACAGGAGCAGAAT 3’，

GsAP1-qPCR antisense：5’GCTGCGGTAGCAAGAAAGATG 3’。

9. the application of the described AP1 proteinoid of claim 1 in cultivating flowering plant morning.

10. claim 2 or the 3 described genes application in cultivating flowering plant morning.

Images