CN105505946B - A kind of gene GF14e, albumen and its application improving Pyricularia Oryzae resistance - Google Patents
A kind of gene GF14e, albumen and its application improving Pyricularia Oryzae resistance Download PDFInfo
- Publication number
- CN105505946B CN105505946B CN201510828431.1A CN201510828431A CN105505946B CN 105505946 B CN105505946 B CN 105505946B CN 201510828431 A CN201510828431 A CN 201510828431A CN 105505946 B CN105505946 B CN 105505946B
- Authority
- CN
- China
- Prior art keywords
- rice
- gene
- gf14e
- resistance
- blast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention discloses a kind of gene GF14e, albumen and its application for improving Pyricularia Oryzae resistance, the gene has the nucleotide sequence as shown in SEQ ID No:1.First demonstration that paddy gene GF14e is the functional gene of Pyricularia Oryzae resistance, the clone of the gene and biological function verification have the Study on Molecular Mechanism of Rice Resistance To Rice Blast important reference significance;The expression quantity of GF14e can be greatly improved after the rice conversion over-express vector rice transformation of overexpression GF14e gene, along with the raising of expression quantity, the rice blast neck blast resistance of transformed plant is remarkably reinforced, and transgenic plant does not change significantly on growth conditions and economical character.The technology that the present invention is overexpressed GF14e can be applied to the gene genetic Engineering Breeding of rice, and can be applied in production practices, improve the rice blast resistance of rice, to ensure the Rice Production safety under the weather conditions that current rice disease takes place frequently.
Description
Technical field
The invention belongs to crop genetic technical field, more particularly it relates to a kind of Pyricularia Oryzae resistance that improves
Gene GF14e, albumen and its application.
Background technique
The rice blast as caused by fungi Magnaporthe grisea (Hebert) Barr is each rice region harm in the world
One of rice disease of most serious makees cultivation to global rice and generates destructive influence.The whole world caused by rice blast every year because producing
Amount loss is up to 11~30%, and about 5,000,000,000 dollars of direct economic loss, the grain of loss is enough to support 60,000,000 populations.In China,
There is rice blast in all places for having rice cropping.South And North Rice Regions per being endangered in various degree every year, the general underproduction 10~
20%, weight up to 40~50%, even No kernels or seeds are gathered, as in a year of scarcity for local field.
Currently, using the resistance of kind, it is considered most economical, efficient and environmentally friendly for carrying out rice blast resistance breeding
Controlling way.In recent years, breeding scholars have cultivated many rice blast disease-resistant varieties using traditional breeding techniques.But
It is that most of disease-resistant variety loses its rice blast resistance after promoting and applying 2~3 years.Such as high resistant to rice blast kind " narrow leaf blueness 8
Number " popularizing planting just lost resistance less than 3 years, high-yield disease resisting fine quality " round-grained rice Xian 89 " was promoted less than 4 years, disease resistance
It is decreased obviously.It can be seen that the Rice Blast resistance period it is short be in Rice Production one universal and distinct issues, prolong
The holding property service life of long Rice Blast, which has become, in China or even each Rice Production state rice modification to be needed preferentially to solve
Problem.
Rice blast may all occur in paddy growth each period, and You Yiye pest and fringe pest are most commonly seen.Compared with leaf pest
For, the harm of fringe pest is bigger, can lead to most serious when that No kernels or seeds are gathered, as in a year of scarcity.Although existing research shows that leaf blast in rice is anti-
Property and neck blast resistance have intercommunity, but resistance to leaf blast and neck blast resistance also have different place.We are with 31 early period
Discovery when near isogenic lines detects its leaf pest and neck blast resistance has some gene lines to have resistance to leaf blast but no neck blast resistance, instead
?.In addition, we have found when excavating the gene of leaf blast in rice and fringe pest response with biochip technology, at least 40%
Gene leaf pest and fringe pest inoculation after expression pattern be different.
In summary studies have shown that leaf blast in rice resistance and neck blast resistance are different to a certain extent.Therefore, it is
Solve the problems, such as that paddy disease-resistant sexual cycle is short, the neck blast resistance for solving rice also seems is even more important.However be currently known
Research be essentially all for leaf blast in rice resistance, and it is then considerably less to the research of neck blast resistance.Currently, in order to improve rice
Rice blast resistance, it is very urgent for the research of Pyricularia Oryzae resistance.
Summary of the invention
Based on this, in order to overcome the defects of the prior art described above, the present invention provides a kind of raising Pyricularia Oryzae resistances
Gene GF14e, albumen and its application.
In order to achieve the above-mentioned object of the invention, this invention takes following specific technical solutions:
A kind of gene GF14e improving Pyricularia Oryzae resistance, the gene have the nucleotide as shown in SEQ ID No:1
Sequence.
The present invention also provides a kind of albumen for improving Pyricularia Oryzae resistance, the albumen has such as SEQ ID No:2 institute
The amino acid sequence shown.
In wherein some embodiments, the albumen is as nucleotide sequence coded as shown in SEQ ID No:1.
The present invention also provides the gene GF14e for improving Pyricularia Oryzae resistance in terms of improving Pyricularia Oryzae resistance
Using.
14-3-3 gene family is a kind of very important Analysis of Defence Genes Involved, plant it is disease-resistant in played important function.
In rice, 14-3-3 gene family includes 8 members, i.e. GF14a-h altogether.Existing research shows that GF14e is in leaf blast in rice
The regulating and controlling effect of negative sense is played in resistance.It will lead to the rice blast resistance of rice leaf with the expression of RNAi technology silencing GF14e
Increase.However, the present inventor has found when excavating the gene of leaf blast in rice and fringe pest response with biochip technology,
Response of the GF14e after leaf pest and fringe pest inoculation is different.After the inoculation of leaf pest, the expression of GF14e is lowered, this with before
Result of study be consistent, but after fringe pest inoculation, the expression of GF14e is up-regulation, this show its in leaf pest and
Opposite effect may be played in neck blast resistance.Therefore, GF14e is possible to play positive regulating and controlling effect in neck blast resistance.
Compared with prior art, the invention has the following advantages:
1. first demonstration that paddy gene GF14e is the functional gene of Pyricularia Oryzae resistance, the clone of the gene
There is important reference significance with Study on Molecular Mechanism of the biological function verification for Rice Resistance To Rice Blast;
2. the present invention provides the rice conversion over-express vectors for being overexpressed GF14e gene using Camv35S promoter.It should
The expression quantity that GF14e can be greatly improved after carrier rice transformation, along with the raising of expression quantity, the rice blast fringe pest of transformed plant
Resistance is remarkably reinforced, and transgenic plant does not change significantly on growth conditions and economical character.Therefore, the present invention is logical
The technology for crossing Camv35S promoter overexpression GF14e can be applied to the gene genetic Engineering Breeding of rice, and can be applied to
In production practices, the rice blast resistance of rice is improved, to ensure that the rice under the weather conditions that current rice disease takes place frequently is raw
Produce safety.
Detailed description of the invention
Fig. 1 is the Vector map of over-express vector PHQSN used in embodiment 1;
Fig. 2 is GF14e expression detection figure in the transgenic plant of embodiment 2;
Fig. 3 is that influence of the GF14e to the neck blast resistance of rice plant is overexpressed in embodiment 3, and wherein * * is indicated and compareed
Compared to there are extremely significant differences.
Specific embodiment
The following examples are further illustrations of the invention, rather than limiting the invention.In the following example not
It indicates specific experiment condition and method, used technological means is usually conventional means well-known to those skilled in the art.
Embodiment 1 improves the building of the gene and over-express vector of Pyricularia Oryzae resistance
(1), it takes three Huang of rice blast highly resistance kind to account for No. 2 (SHZ-2) seedling leaves positions, uses TriZol
Reagent (Invitrogen company, article No. are as follows: 15596026) extract blade total serum IgE, using denaturing formaldehyde gel electrophoresis and
The purity and amount of UV spectrophotometer measuring total serum IgE;
(2), the total serum IgE of 1 μ g is taken to do starting reverse transcription reaction, used reverse transcriptase is PrimeScript
The step of (TAKARA company), reverse transcription reaction the operation instruction with reference to the reverse transcriptase.Using reverse transcription product as template, use
Primer: F, ACGCGTCGACATATCTGGCCCAAGAGCAGTA (SEQ ID No:3);R, GGAATTCAGGCTCACAACTGACA
TACCG (SEQ ID No:4), carries out PCR amplification, and polymerase used in PCR is KOD FX (Toyobo company).Reaction system is
50uL prepares PCR reaction system according to the specification of KOD FX.Reaction condition are as follows: 94 DEG C of 5min;94 DEG C of 30sec, 57 DEG C
30sec, 68 DEG C of 80sec, 35 circulations;68℃10min.The segment of PCR amplification acquisition about 1268bp;
(3), after recycling the segment using the method for PCR product direct purification, with SalI and EcoRI to segment and PHQSN
(its carrier figure is as shown in Figure 1, those skilled in the art can be with bibliography: the cDNA clone of arabidopsis AtNHX5 gene for carrier
And its building of justice, antisense expression vector;Shi Leyi, Li Hongqing, Li Meiru, Chen Yizhu;Plant Physiology Communications, 2005
Year, volume 41, the 5th phase constructed and obtain) carry out double digestion respectively, 37 DEG C digestion 6 hours, be separately recovered after digestion target fragment with
Carrier segments, overnight with 16 DEG C of T4 ligase (NEB company) connections, linked system are as follows: T4 ligase 1ul, 10 × buffer
1ul, GF14e genetic fragment 4ul (51ng), PHQSN carrier 2uL (50ng), aqua sterilisa 2uL;
(4), whole connection products are taken, are transformed into bacillus coli DH 5 alpha with electric shocking method, converted product is coated with kanamycins
The LB solid medium of resistance.37 DEG C of overnight incubations choose 6 positive white monoclonals and extract plasmid, digestion identification, selection
Two positive colonies are sequenced.Sequencing result shows: 1268 bases of the sequence, includes an open reading frame, i.e.,
For GF14e gene, size is 789 bases, and for nucleotide sequence as shown in SEQ ID No:1, coding albumen has 262
A amino acid residue, amino acid sequence is as shown in SEQ ID No:2.
Overexpression effect identification of the 2 GF14e gene of embodiment in transgenic plant
Over-express vector is transferred to by normal japonica rice variety OryzasativaLcv.Nipponbare using the genetic transforming method that Agrobacterium EHA105 is mediated
In.Convert primary (T0Generation) by PCR and quantitative PCR detection, positive transformants plant, card are identified from DNA level and rna level
Bright target gene GF14e has been transformed into rice, and realizes that the expression quantity of target gene GF14e improves.
Transgenic positive plant selfing is obtained homozygous 1 generation of positive transgenic (T in controlled greenhouse1Generation) strain, often
A strain selects 10 plants of plant breedings through PCR test positive, obtains T2For plant, T2PCR detection is carried out again for strain, is looked for
To from different T0For the T of plant2For homozygous lines 3 (5-1,12-1,12-2).The seedling leaves of 3 strains are carried out
Quantitative fluorescent PCR detects the expression quantity of target gene GF14e, is control with wild-type results.
It is as follows that quantitative fluorescent PCR identification GF14e gene is overexpressed effect programs in transgenic plant:
1, the small ear for the transgenic plant beginning ear period for taking PCR detection positive carries out Total RNAs extraction, the reagent used for
TriZol Reagent (Invitrogen company, article No. are as follows: 15596026), according to the step of the specification of the reagent into
Row, and with the purity and amount of denaturing formaldehyde gel electrophoresis and UV spectrophotometer measuring total serum IgE;
2, the total serum IgE of 1 μ g is taken to do starting reverse transcription reaction, used reverse transcriptase is PrimeScript (Takara
Company), with reference to the operation instruction of the reverse transcriptase the step of reverse transcription reaction.Using reverse transcription product as template, using primer
The expression of GF14eF and GF14eR primer pair detection GF14e gene;Primer sequence is as follows: GF14eF,
GATATTGCCCTGGCAGAGTTG (SEQ ID No:5);GF14eR, GAGATATCGGAAGTCCACAGC (SEQ ID No:
6);
3, using the expression of the EF1 α F and EF1 α R primer pair detection rice EF1 α gene of rice house-keeping gene EF1 α gene
As internal reference, quantitative PCR reagent isPremix Ex TaqTM(TAKARA), quantitative PCR instruments are CFX 96
(BioRAD company),
EF1 α F, TTTCACTCTTGGTGTGAAGCAGAT (SEQ ID No:7);
EF1 α R, GACTTCCTTCACGATTTCATCGTAA (SEQ ID No:8).
The opposite mRNA of GF14e expresses water in 3 transgenic homozygous strains (5-1,12-1,12-2) and WT lines
For reef knot fruit as shown in Fig. 2, Fig. 2 is the result shows that 3 strains are relative to wild type, the expression quantity of GF14e all increases substantially 10-40
Times.
The identification of 3 GF14e of embodiment overexpression transgenic plant rice blast neck blast resistance
3 overexpression transgenosis T homozygous in embodiment 22For homozygous lines (5-1,12-1,12-2) and wild type
Rice paddy seed germinates at 32 DEG C, moves in the vinyl disc equipped with soil young shoot respectively after 2 days and sows, when it grew to for 3 leaf phase
By seedling replanting into large plastic barrel, every barrel 4 plants of kind, each strain at least plants 10 plants.Naturally heading stage is grown in solarium
It is inoculated with.The rice blast bacterial strain used is the GD08-T13 of OryzasativaLcv.Nipponbare sensitivity.
When spike of rice extracts 2~8cm or so out, goes out spike of rice with hand sowing, small pieces cotton is taken to wrap at the lower edge 1/3 of spike of rice,
Then spore liquid (the 1x 10 of 2ml is drawn6Spores/ml it) is injected into cotton, is wrapped up outside cotton with masking foil to prevent bacterium solution
Evaporation.It in solarium, sprayed water 2 minutes every 2 hours, to guarantee that humidity is conducive to spore germination.Investigation morbidity result after 3 weeks.Knot
Fruit as shown in Figure 3, Fig. 3 the result shows that GF14e be overexpressed strain neck blast resistance be remarkably reinforced, compared with wild type, spike of rice main shaft
Susceptible length is obviously reduced.
The embodiments described above only express several embodiments of the present invention, and the description thereof is more specific and detailed, but simultaneously
Limitations on the scope of the patent of the present invention therefore cannot be interpreted as.It should be pointed out that for those of ordinary skill in the art
For, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to guarantor of the invention
Protect range.Therefore, the scope of protection of the patent of the invention shall be subject to the appended claims.
Claims (3)
1. a kind of application of gene GF14e for improving Pyricularia Oryzae resistance in terms of the resistance for improving Pyricularia Oryzae.
2. application according to claim 1, which is characterized in that in the nucleotide sequence of the gene GF14e such as sequence table
Shown in SEQ ID NO:1.
3. application according to claim 1, which is characterized in that it is anti-that the gene GF14e encodes a kind of raising Pyricularia Oryzae
The albumen of property, the amino acid sequence of the albumen is as shown in SEQ ID NO:2 in sequence table.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510828431.1A CN105505946B (en) | 2015-11-25 | 2015-11-25 | A kind of gene GF14e, albumen and its application improving Pyricularia Oryzae resistance |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510828431.1A CN105505946B (en) | 2015-11-25 | 2015-11-25 | A kind of gene GF14e, albumen and its application improving Pyricularia Oryzae resistance |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105505946A CN105505946A (en) | 2016-04-20 |
CN105505946B true CN105505946B (en) | 2019-04-23 |
Family
ID=55714239
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510828431.1A Expired - Fee Related CN105505946B (en) | 2015-11-25 | 2015-11-25 | A kind of gene GF14e, albumen and its application improving Pyricularia Oryzae resistance |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105505946B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111606977B (en) * | 2020-05-27 | 2021-11-09 | 福建农林大学 | Method for regulating and controlling weak grain filling of rice by using GF14f protein targeted polypeptide ligand |
CN116655764B (en) * | 2023-07-14 | 2024-04-12 | 广东省农业科学院水稻研究所 | Application of rice OsUGT706E2 gene in regulation and control of rice blast resistance |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001077355A2 (en) * | 2000-04-07 | 2001-10-18 | Basf Plant Science Gmbh | Signal transduction stress-related proteins and use in plants |
-
2015
- 2015-11-25 CN CN201510828431.1A patent/CN105505946B/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001077355A2 (en) * | 2000-04-07 | 2001-10-18 | Basf Plant Science Gmbh | Signal transduction stress-related proteins and use in plants |
Non-Patent Citations (3)
Title |
---|
GenBank: AK068248.1;Adachi,J. et al.;《NCBI》;20081204;FEATURES、ORIGIN * |
GenBank: AK104907.1;Adachi,J. et al.;《NCBI》;20081204;FEATURES、ORIGIN * |
Rice 14-3-3 protein (GF14e) negatively affects cell death and disease resistance;Patricia M. Manosalva et al.;《The Plant Journal》;20110913;第68卷;第777-787页 * |
Also Published As
Publication number | Publication date |
---|---|
CN105505946A (en) | 2016-04-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109628439B (en) | Gene for promoting synthesis and photosynthetic efficiency of tomato chlorophyll and application thereof | |
CN102766618B (en) | Rice OsICL protein and coding gene thereof, and application of the two | |
CN105753953B (en) | Disease-resistant wheat albumen and encoding gene and its application in regulation disease resistance of plant | |
CN109750047B (en) | Tea tree hexose transporter gene CsSWEET17 and application thereof in regulating and controlling vegetative growth and seed size of plants | |
CN101914147A (en) | Plant disease resistance-related protein and coding gene and application thereof | |
CN103695438A (en) | Arabidopsis MYB family transcription factor AtMYB17 gene as well as coding sequence and application thereof | |
WO2023065966A1 (en) | Application of bfne gene in tomato plant type improvement and biological yield increase | |
CN105505955B (en) | A kind of gene Os02g0532500, albumen and its application improving Rice Resistance To Rice Blast | |
CN110004156A (en) | GhCML20 gene relevant to resistance to verticillium wilt and its application | |
RU2665804C2 (en) | Cotton phya1 rnai improving fiber quality, root elongation, flowering, maturity and yield potential in upland cultivars (gossypium hirsutum l.) | |
CN109852618A (en) | A kind of section melon WRKY class transcription factor gene CqWRKY1 and its application | |
CN105505946B (en) | A kind of gene GF14e, albumen and its application improving Pyricularia Oryzae resistance | |
CN104818258B (en) | Upland cotton glycosyl transferase GhUGT85O1 and its encoding gene and application | |
CN112250745B (en) | MYB21 gene for regulating and controlling bacterial leaf blight resistance of rice and application thereof | |
Li et al. | Overexpression of TCP transcription factor OsPCF7 improves agronomic trait in rice | |
CN104004073B (en) | Derive from disease resistance associated protein TaCPK7-R of Semen Tritici aestivi and relevant biological material thereof and application | |
CN104017061B (en) | Transcription factor ZmbZIP17 and encoding gene and its application in response adverse circumstance | |
CN102719451A (en) | Poncirus trifoliata basic helix-loop-helix (PtrbHLH) and application in improving cold resistance of plant | |
CN103172716B (en) | Heat-resistant plant gene and application thereof | |
CN101914539A (en) | Root specificity expression promoter and plant expression vector thereof | |
CN108864264B (en) | Corn OXS2a gene, and encoding protein and application thereof | |
CN108165557A (en) | Application of the wheat TaZCCT2 genes in the flowering of plant time is regulated and controled | |
CN113564200A (en) | Application of tea tree CsCIPK20 gene in improving cold resistance of plants | |
CN107177565A (en) | Anti- tomato stem wilt gene mLCB2b and its application | |
CN104561040B (en) | Genes For Plant Tolerance hot radical is because of HTT3 and its application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190423 Termination date: 20191125 |
|
CF01 | Termination of patent right due to non-payment of annual fee |