CN105017395B - A kind of rubber tree blooms modulin HbTFL1-2 and its encoding gene and application - Google Patents
A kind of rubber tree blooms modulin HbTFL1-2 and its encoding gene and application Download PDFInfo
- Publication number
- CN105017395B CN105017395B CN201510366358.0A CN201510366358A CN105017395B CN 105017395 B CN105017395 B CN 105017395B CN 201510366358 A CN201510366358 A CN 201510366358A CN 105017395 B CN105017395 B CN 105017395B
- Authority
- CN
- China
- Prior art keywords
- hbtfl1
- gene
- genes
- inflorescence
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Physiology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Bloom modulin HbTFL1 2 and its encoding gene and application the present invention provides a kind of rubber tree.The amino acid sequence of the modulin HbTFL1 2 of blooming is as shown in SEQ ID No.6, by its encoding gene transformed plant, can obtain the transfer-gen plant of florescence delay.
Description
Technical field
The present invention relates to biological technical field, specifically, be related to a kind of rubber tree bloom modulin HbTFL1-2 and
Its encoding gene and application.
Background technology
TFL1/CEN-like genes are widely present in flowering plant, are a kind of very important suppression persons of blooming.They
Gene A P1 and LFY gene is determined by the downstream floral organ for suppressing FT genes, realizes the purpose for suppressing to bloom.
In arabidopsis tfl1 mutant, arabidopsis vegetative growth phase significantly shortens, while inflorescence changes from indefinite inflorescence
For terminal inflorescence.Hence it is demonstrated that arabidopsis TFL1 genes have the function of while regulate and control nutrient growth and inflorescence development (Bradley
D, Ratcliffe O, Vincent C, Carpenter R, Coen E (1997) Inflorescence commitment and
architecture in Arabidopsis.Science 275:80–83).In pea, two TFL1-like genes are demonstrate,proved
Bright regulation and control two different stages of development of pea, LF gene regulations maintain the uncertainty of apical meristem, and DET genes are then
Regulate and control the uncertainty of inflorescence meristem.Therefore, in lf/DET plant, florescence shifts to an earlier date, but the development of inflorescence does not have
It is affected；In LF/det plant, florescence is not affected, but inflorescence is changed into terminal inflorescence by indefinite inflorescence；
In the double mutant plants of lf/det, just as arabidopsis tfl1 mutant, vegetative growth phase and inflorescence development are all subject to sternly phenotype
Ghost image rings (Foucher F, Morin J, Courtiade J, Cadioux S, Ellis N, Banfield M J, Rameau C
(2003)DETERMINATE and LATE FLOWERING are two TERMINAL FLOWER1/CENTRORADIALIS
homologs that control two distinct phases of flowering initiation and
development in pea.Plant Cell 15:2742–2754).And CEN genes, model plant goldfish is found in earliest
In grass, it has very strong tissue expression specificity, begins to express soon when inflorescence meristem is formed, and with inflorescence
Develop and gradually strengthen.Toad's-mouth cen mutant plants show inflorescence and are changed into terminal inflorescence from indefinite inflorescence, but nutrition is given birth to
Length is not affected, and thus illustrates that CEN regulates and controls inflorescence development in toad's-mouth and maintains inflorescence meristem uncertain
(Bradley D, Carpenter R, Copsey L, Vincent C, Rothstein S, Coen E (1996) Control of
inflorescence architecture in Antirrhinum.Nature 379:791-797.).And in another pattern
In plant tobacco, CET2/CET4 but show different expression patterns, Amaya etc. (1999) research show they only in
High expression in the lateral bud of nutrient growth, when tobacco enters flowering period, their expression is subject to NFL genes to suppress and gradually drops
It is low.Illustrate maintenance that CET2/CET4 develops nutrition organs have very important effect (Amaya I, Ratcliffe O J,
Bradley D J(1999)Expression of CENTRORADIALIS(CEN)and CEN-like genes in
tobacco reveals a conserved mechanism controlling phase change in diverse
species.Plant Cell 11:1405–1418)。
Above result of study shows that the regulation and control of TFL1/CEN-like gene pairs vegetation growth of plant and/or reproductive development rise
Very important effect.Para rubber tree has the vegetative growth phase up to 5-8, studies different TFL1/CEN-like bases
Because the mechanism in rubber tree helps to carry out Effective Regulation to rubber tree growth period.At present, in Para rubber tree, there has been no
Close the report of TFL1/CEN-like genes.
The content of the invention
In order to solve the problems in the existing technology, bloom modulin the object of the present invention is to provide a kind of rubber tree
HbTFL1-2 and its encoding gene and application.
In order to realize the object of the invention, bloom modulin HbTFL1-2 present invention firstly provides a kind of rubber tree, its ammonia
Base acid sequence is as shown in SEQ ID No.6.
Present invention also offers the encoding gene of the albumen.
Further, its nucleotides sequence is classified as shown in 171bp~689bp in SEQ ID No.4.
Present invention also offers a kind of controlling gene HbTFL1-2 of blooming from rubber tree, its cDNA sequence such as SEQ ID
Shown in No.4.
Further, its DNA sequence dna is as shown in SEQ ID No.5.
Present invention also offers the carrier containing afore-mentioned code gene.
Present invention also offers the engineering bacteria containing aforementioned bearer.
Invention further provides afore-mentioned code gene and application of the forementioned gene in terms of plant blossom is postponed.
Further, the application is that the engineering bacteria is infected plant, obtains the transfer-gen plant of florescence delay.
Main feature shows wheel seat leaf and major branch number of nodes showed increased, and floral organ lacks, and causes silique abnormal,
Setting percentage reduces.Most serious causes transfer-gen plant not flowering phenotype occur.
The beneficial effects of the present invention are：
Present invention firstly discloses 5 controlling genes of blooming, i.e. TFL1/CEN-like homologous genes, they are in rubber tree
There is different expression patterns in nutrition organs：
1) for TFL1-like homologous genes, HbTFL1-1 is mainly expressed in root and stabilization vane, HbTFL1-2 master
Will in root specifically expressing, and HbTFL1-3 is then expressed in stem and apical meristem.In addition they have a common table
It is exactly that 3 genes are in the respective nutrition in generative growth phase plant in florescence (annual March) up to feature
Expression in organ is significantly lower than the plant in juvenile phase nutrient growth.During inflorescence development, the expression of 3 genes all with
The development of inflorescence and gradually rise, but different relative expression quantities is showed in the male flower and female flower bloomed, wherein,
HbTFL1-1 is expressed almost in male flower and female flower, and HbTFL1-2 is expressed in female flower apparently higher than the expression in male flower；
And the HbTFL1-3 then expression being higher than in female flower for expressing highly significant in male flower.
2) for CEN-like homologous genes, they have similar expression pattern in rubber tree nutrition organs,
It is but not exactly the same.The two is mainly expressed in root, stem and bud in 3 months big seedling.In growth and development process, the two table
The expression trend revealed is divided into three kinds.First, in root, all expression gradually reduces with age for the two, is dropped in 2 years in tree
Low is zero.Second, in stem, the two shows first to raise the trend reduced afterwards；In bud, HbCEN1 shows first to raise to drop afterwards
Low expression trend, and HbCEN2 then shows the trend gradually reduced with age.During inflorescence development, the two
Similar expression pattern is shown, i.e., their expression gradually reduces with the development of inflorescence, especially HbCEN1, expresses trend
Clearly.
In addition, being respectively transferred to 5 genes in wildtype Arabidopsis thaliana respectively, transfer-gen plant is than WT lines in nutrition
There are obvious extension at growth period and florescence.Main feature shows as wheel seat leaf and major branch number of nodes showed increased, and floral organ goes out
Now lack, cause silique abnormal, setting percentage reduces.Most serious causes transfer-gen plant not flowering phenotype occur.Again by 5
Gene is transferred in tfl1-1 mutant respectively, as a result, tfl1-1 mutant phenotypes all effectively can be reverted to open country by 5 genes
Raw type phenotype, some have also appeared the phenotype of serious delay vegetative growth phase and florescence, and What is more occurs not blooming now
As.
Therefore, this 5 genes can bloom the important candidate gene of regulation and control as Para rubber tree, by Para rubber tree
Genetic transformation be expected to realize to Para rubber tree florescence control.Equally, it can also be applied in other crops, solve sibling species
Or a series of problems that florescence infertility is brought during different cultivars hybridization, in addition breeding time can also be regulated and controled.
Brief description of the drawings
Fig. 1 analyzes for 3 TFL1-like Tissue-specific expressions and spatial and temporal expression.Wherein A is HbTFL1-1 genes
Spatial and temporal expression profile is analyzed；B analyzes for HbTFL1-2 genes spatial and temporal expression profile；C is HbTFL1-3 gene spatial and temporal expression profiles
Analysis.
Fig. 2 analyzes for 2 CEN-like Tissue-specific expressions and spatial and temporal expression.When wherein A is HbCEN1 genes
Null representation pattern analysis；B analyzes for HbCEN2 genes spatial and temporal expression profile.
Fig. 3 is expression analysis of 3 TFL1-like genes in 5 different developmental phases of inflorescence.I, the first stage of development
Inflorescence；II, the inflorescence of the second stage of development；III, the inflorescence of the 3rd stage of development；IV, the inflorescence of the 4th stage of development；V, the
The inflorescence of five stages of development；A is HbTFL1-1 gene expression analysis；B is HbTFL1-2 gene expression analysis；C is HbTFL1-3
Gene expression analysis.
Fig. 4 is expression analysis of 2 CEN-like genes in 5 different developmental phases of inflorescence.I, the first stage of development
Inflorescence；II, the inflorescence of the second stage of development；III, the inflorescence of the 3rd stage of development；IV, the inflorescence of the 4th stage of development；V, the
The inflorescence of five stages of development；A is HbCEN1 gene expression analysis；B is HbCEN2 gene expression analysis.
Fig. 5 for wildtype Arabidopsis thaliana respectively with turn 3 TFL1-like gene plant flowering phenotypes compared with.Wherein A is wild
Type arabidopsis is compared with it turns HbTFL1-1 gene flowering phenotypes；B turns HbTFL1-2 gene plants for wildtype Arabidopsis thaliana with it
Flowering phenotype compares；C is wildtype Arabidopsis thaliana compared with it turns HbTFL1-3 gene plant flowering phenotypes.
Fig. 6 for wildtype Arabidopsis thaliana respectively with turn 2 CEN-like gene plant flowering phenotypes compared with.Wherein A is wild
Type arabidopsis is compared with it turns HbCEN1 gene flowering phenotypes；B turns HbCEN2 gene plants with it for wildtype Arabidopsis thaliana and blooms
Phenotype compares.
Fig. 7 is the recovery confirmatory experiment that arabidopsis tfl1-1 mutant converts 3 TFL1-like genes.
Fig. 8 is the recovery confirmatory experiment that arabidopsis tfl1-1 mutant converts 2 CEN-like genes.
Embodiment
Following embodiments are used to illustrate the present invention, but are not limited to the scope of the present invention.
The acquisition of 15 target genes of Para rubber tree of embodiment
According to the rubber tree genome database of Rubber Institute, Chinese Academy of Agricultural Science and blade transcript profile data
Storehouse, the contig obtained by way of homologous comparison, is then spliced, then predicts open reading by NCBI online softwares
And design special primer and obtain the DNA sequence dna and cDNA sequence for including entire open reading frame.
Specific method is as follows：
The acquisition of 5 gene open reading frames
5 gene specific primers are as follows：
HbTFL1-1OF(EcoRI):GATGTCAAGGATCATGGAGCC
HbTFL1-1OR(XbaI):GCTCATCTTCTTCTTGCAGCAGTTT
HbTFL1-2OF(EcoRI):GATGGCAAGAATAATAGAACCTCT
HbTFL1-2OR(XbaI):GCTTAGCGCCTTCTTGCAGCAGTT
HbTFL1-3OF(EcoRI):GATGGCAAGAATAATAGAACCTCT
HbTFL1-3OR(XbaI):GCTTAGCGTCTTCTTGCAGCAGTT
HbCEN1OF(EcoRI):GATGGCGAAGACAACAGATCCTC
HbCEN1OR(XbaI):GCTCAGCGCCTCCTTGCAGC
HbCEN2OF(EcoRI):GATGGCCAAGACTTCAGACCCTC
HbCEN2OR(XbaI):GCTCAGCGTCTCCTTGCTGCT
Respectively with HbTFL1-1OF (EcoRI) and HbTFL1-1OR (XbaI), HbTFL1-2OF (EcoRI) and HbTFL1-
2OR (XbaI), HbTFL1-3OF (EcoRI) and HbTFL1-3OR (XbaI), HbCEN1OF (EcoRI) and HbCEN1OR
(XbaI), HbCEN2OF (EcoRI) and HbCEN2OR (XbaI) compositions are primer pair, and each primer pair is again respectively with rubber tree
The cDNA of root, blade, bud and inflorescence is masterplate, expands 5 target genes respectively.
PCR response procedures are：95 DEG C of 3min pre-degenerations, 95 DEG C are denatured 30s, and 55 DEG C of 30s that anneal, 72 DEG C of 1min extend,
35 circulations, 72 DEG C of 10min extend eventually.
Amplified production is connected with pMD-19 carriers, converts in escherichia coli DH5a and is sequenced.Finally, 5 genes are obtained
Entire open reading frame.
The acquisition of 5 gene 5 ' UTR：
For HbTFL1-3,5 ' UTR are obtained by 5 ' RACE, and adapter-primer used shares 3：
QT (CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTT),
Q1 (GAGGACTCGAGCTCAAGC) and Q0 (CCAGTGAGCAGAGTGACG).
(Dieffenbacher C W, moral Vickers strangle the yellow trainings of G R.PCR technology experiment guides to 5 ' RACE operating processes reference literatures
Hall translates Beijing：Science Press, 1998:268-277).
5 ' RACE special primers are used in HbTFL1-3：
HbTFL1-3-GSP51st:(GGGCCTTGGAATTTCATAGCTC),
HbTFL1-3-GSP52nd:(GTGCAGGTGCTCCCTCAAATAAG)。
Remaining gene, upstream from start codon devise the positive primers of some diverse locations respectively with open reading frame it
Interior anti-sense primer pairing carries out PCR, untill obtaining longest 5 ' UTR.
The primer pair that HbTFL1-1 obtains used in longest 5 ' UTR is：
HbTFL1-15UF:(CTCCTCTCACGAGTCCCTTTCTACC),
HbTFL1-15UR:(ACATCGCCTACAACTCTCCCT)。
The primer pair that HbTFL1-2 obtains used in longest 5 ' UTR is：
HbTFL1-25UF:(ATTCCAGGACCAGGAGTCTTATTCTTGATG),
HbTFL1-25UR:(ATGTCCATTGTAGACTTGCCTGTTATTGTA)。
The primer pair that HbCEN1 obtains used in longest 5 ' UTR is：
HbCEN15UF:(TCCACCCCCATTGCCTTACAAGAG),
HbCEN15UR:(ATCTGTTGTCTTCGCCATTAGAGACTTG)。
The primer pair that HbCEN2 obtains used in longest 5 ' UTR is：
HbCEN25UF:(GGTCTGCTTCCACCCTCATTGCCTTAC),
HbCEN25UR:(TCTCCAATAACCCCCCCAACCACC)。
Amplification program is：95 DEG C of pre-degeneration 3min, 95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1min, 35 are followed
Ring, 72 DEG C extend 10min eventually.
The acquisition of 5 UTR of gene 3 '：
3 ' UTR of HbTFL1-1 genes is complete in transcript profile.3 ' UTR of remaining gene obtain 3 ' by 3 ' RACE
UTR.Adapter-primer used is as 3 adapter-primers that 5 ' RACE are used, while 3 ' RACE operating processes are also with reference to text
Offer (Dieffenbacher C W, moral Vickers strangle G R.PCR technology experiment guide Huang Peitangs translate Beijing：Science Press, 1998:
268-277).First by the use of QT primers as reverse transcription primer, by reverse transcription, book carries out reverse transcription program as directed.Afterwards respectively with
The GSP3 of HbTFL1-2, HbTFL1-3, HbCEN1 and HbCEN2 gene1stFirst round PCR is carried out respectively for primer with Q0, afterwards
Masterplate using 50 times of dilution PCR products as the second wheel PCR respectively.When carrying out the second wheel PCR, then respectively with this 4 genes
GSP32ndPrimer pair is combined as with Q1 and carries out the second wheel PCR, and product digs glue by electrophoresis and obtains.Amplification program is：95 DEG C of pre- changes
Property 3min, 95 DEG C denaturation 30s, 55 DEG C annealing 30s, 72 DEG C extension 1min, 35 circulation, 72 DEG C eventually extension 10min.
HbTFL1-2-GSP31st:GTGAGCGACATCCCTGGAACA
HbTFL1-2-GSP32nd:CGAAGACAGACAATCAACCCACC
HbTFL1-3-GSP31st:CGAAGACAGACAATCAACCCACC
HbTFL1-3-GSP32nd:GAAACTGCTGCAAGAAGACGCTAAC
HbCEN1-GSP31st:GCACTTGCACTGGATAGTTACGGAC
HbCEN1-GSP32nd:TCCATAGGTTTGTTTTCCTTCTGTTCA
HbCEN2-GSP31st:ATAGTGACAGACATCCCGGGCA
HbCEN2-GSP32nd:TCCATAGGTTTGTGTTCCTTCTGTT
The acquisition of 5 gene cDNA sequences：
According to the acquisition of 5 ' and 3 ' UTR, special primer is devised again.
Wherein：
HbTFL1-1 primer pairs are：
HbTFL1-1F:CTCCTCTCACGAGTCCCTTTCTACCCTTG,
HbTFL1-1R:GAGAGAAACAATTTCATACTTACATTAC；
HbTFL1-2 primer pairs are：
HbTFL1-2F：ATTCCAGGACCAGGAGTCTTATTCTTG,
HbTFL1-2R：GACAGATATATATGTTTCTGCAAGCTTA；
HbTFL1-3 primer pairs are：
HbTFL1-3F：AGAGAGAGAGAGAGAGATGACAGATTCC,
HbTFL1-3R：GACAGATGAAACAGATTATATAGAGAGC；
HbCEN1 primer pairs are：
HbCEN1F：TCCACCCCCATTGCCTTACA,
HbCEN1R：ACTTTTGGCTAATACCCATTTTTATTCA；
HbCEN2 primer pairs are：
HbCEN2F：GGTCTGCTTCCACCCTCATTGC,
HbCEN2R：ACGAGGAAGAAGTCCATTGTTAGGACAC.
The amplification program of 5 target gene cDNA sequences is：95 DEG C of pre-degeneration 3min, 95 DEG C of denaturation 30s, 55 DEG C are annealed
30s, 72 DEG C of extension 90s, 35 circulations, 72 DEG C extend 10min eventually.The PCR product of acquisition is connected and is sequenced with pMD19.
Numbering is Isosorbide-5-Nitrae in 5 genetic fragments that sequencing result obtains such as sequence table, 7,10,13 sequence.
The amplification program of 5 target gene DNA sequence dnas is：95 DEG C of pre-degeneration 3min, 95 DEG C of denaturation 30s, 55 DEG C are annealed
30s, 72 DEG C of extension 2min, 35 circulations, 72 DEG C extend 10min eventually.The PCR product of acquisition is connected and is sequenced with pMD19.
5 genetic fragments that sequencing result obtains are the sequence of sequence table 2,5,8,11,14.
25 specific expressed analyses of target gene tissue of embodiment
It is experiment material that 3 months big rubber tissue-cultured seedling are chosen in this research.Root, stem, bud, bronze leaf, discoloration are gathered respectively
Leaf, pale green leaf and stabilization vane, the RNA for extracting them respectively are spare.
After being digested to above-mentioned obtained RNA into DnaseI excessively reverse transcription is carried out according to reverse transcription reagent box.Pass through fluorescence
Quantitative technique carries out 5 specific expressed analyses of target gene tissue.
5 gene by fluorescence quantitative primers are respectively：
HbTFL1-1QF:CCTCCTTAATCCCTGGCTACG,
HbTFL1-1QR:ACATCGCCTACAACTCTCCCT,
HbTFL1-2QF:GCCACATTTGGAAGGGAGATAG,
HbTFL1-2QR:TAACACTTATTATTGAAGGCCACTTG,
HbTFL1-3QF:ATACACCTCTTAGCCAGACGCTC,
HbTFL1-3QR:TGTCGCCTCCTTGGACCTCA,
HbCEN1QF:CTAATGGCGAAGACAACAGAT,
HbCEN1QR:CACCTCCCTGGACCTCAAC,
HbCEN2QF:GAAACAGCAGCAAGGAGACG,
HbCEN2QR:ATTGGTGCGACTGATACGAC。
The result shows that：For TFL1-like genes, HbTFL1-1 is mainly expressed in root and stabilization vane, HbTFL1-
2 main specifically expressings in root, and HbTFL1-3 is then expressed in stem and apical meristem, as shown in Figure 1.For CEN-
For like genes, HbCEN1 and HbCEN2 are mainly expressed in root, stem and bud.As shown in Figure 2.
The spatial and temporal expression profile analysis of 35 target genes of embodiment
Respectively with 3 months, 2 years and 10 years trees for research object, section (March) gathers an age bracket respectively during the blossom season
Root, stem, bud, bronze leaf, discoloration leaf, pale green leaf and stabilization vane, and the 10 years male flowers and female flower set when blooming, are extracted respectively
RNA is spare.
After being digested to above-mentioned obtained RNA into DnaseI excessively reverse transcription is carried out according to reverse transcription reagent box.Pass through fluorescence
Quantitative technique carries out spatial and temporal expression profile analysis to 5 target genes respectively.
The results show：Save during the blossom season, for TFL1-like genes, HbTFL1-1, HbTFL1-2 and HbTFL1-
Expression of 33 genes in 10 years trees in respective nutrition organs was set significantly lower than 3 months and 2 years.In the inflorescence just broken up
In the expression of 3 genes be almost 0, and in the male flower and female flower bloomed, the expression of 3 genes all substantially rises and shows
Different expressions.HbTFL1-1 is expressed almost in male flower and female flower, HbTFL1-2 expressed in female flower apparently higher than
Expression in male flower；And the HbTFL1-3 then expression being higher than in female flower for expressing highly significant in male flower, such as Fig. 3 institutes
Show.And for CEN-like genes, the expression trend that HbCEN1 and HbCEN2 are shown is divided into three kinds.First, in root,
All expression gradually reduces with age for the two, and zero was reduced in tree in 2 years.Second, in stem, the two shows first to raise
The trend reduced afterwards；In bud, HbCEN1 shows first to raise the expression trend reduced afterwards, and HbCEN2 was then shown with year
The trend that age increase gradually reduces.As shown in Figure 4.
Expression analysis of 45 target genes of embodiment during inflorescence development
Using just growth course inflorescence as research object.Inflorescence development is divided into 5 periods, the criteria for classifying is first
Period：Inflorescence length is about 0.5cm, second period：Inflorescence length is about 2.0cm, the 3rd period：Inflorescence length is about
4.0cm, the 4th period：Inflorescence length is about 8.0cm, and the 5th period is flowering period, inflorescence length>8.0cm.Adopt respectively
Collect the inflorescence in 5 periods and to extract RNA spare.
After being digested to above-mentioned obtained RNA into DnaseI excessively reverse transcription is carried out according to reverse transcription reagent box.Pass through fluorescence
Quantitative technique respectively carries out 5 target genes the expression analysis in different inflorescence development stages.
The results show：Development of 3 TFL1-like genes all with inflorescence during inflorescence development constantly raises, such as
Shown in Fig. 5.And development of 2 CEN-like genes all with inflorescence during inflorescence development constantly reduces, as shown in Figure 6.
The functional verification of 55 target gene conversion wildtype Arabidopsis thalianas of embodiment
Using pXCS plant expression vectors (being preserved by Rubber Institute, Chinese Academy of Agricultural Science) respectively with 5 targets
Gene connects, and builds arabidopsis thaliana transformation wild type conversion carrier.Specific embodiment is as follows：
Separately design the primer of 5 target genes of structure plant expression vector.Used is used to build plant expression
The primer of carrier is the special primer of 5 genes described in embodiment 1, wherein the positive primer 5 ' end of 5 genes respectively added with
EcoRI restriction enzyme sites, anti-primer 5 ' are held respectively added with XbaI enzyme cutting site.The PCR product of acquisition is connected simultaneously with pMD19 carriers
It is sequenced.Then, correct plasmid is sequenced in extraction, with EcoRI and XbaI difference double digestion pXCS and 5 correct matter of sequencing
Grain, and respectively connected pXCS carriers and 5 target gene with T4DNA ligases, and pXCS-HbTFL1-1/WT is named as,
PXCS-HbTFL1-2/WT, pXCS-HbTFL1-3/WT, pXCS-HbCEN1/WT, pXCS-HbCEN2/WT.
Afterwards, the plant expression vector containing 5 target genes is directed respectively into Agrobacterium tumefaciems GV3101 (PMP90RK)
In (preserved by Rubber Institute, Chinese Academy of Agricultural Science).
For infecting for wildtype Arabidopsis thaliana, reference literature (Clough, S.J.and Bent, A.F. (1998) Floral
dip:a simplified method for Agrobacterium-mediated transformation of
Arabidopsis thaliana.Plant J.16:735-743.).The T0 of acquisition first soaks it with tap water for seed,
And it is positioned over vernalization 3 days in 4 DEG C of environment darkrooms.Sowed afterwards on the vermiculite soaked through 1/2M culture mediums in 22 DEG C of long days
According to ambient growth (16h/8h), when seedling germinates, the herbicide for being 10g/L with concentration is sprayed, and is planted to screen resistance
Strain.After 10 days, normal seedling will be grown and be transplanted to Nutrition Soil (Nutrition Soil：Vermiculite=2：1) grown in and wait sowing.It is positive
The detection of plant passes through southern methods, the method reference literature (Blanc G, Baptiste C, Oliver G, Martin
F, Montoro P. (2006) Efficient Agrobacterium tumefaciens-mediated transformation
of embryogenic calli and regeneration of Hevea brasiliensis M¨ull
Arg.Plants.Plant Cell Rep(2006)24:724–733)。
5 gene T3 are cultivated with wild type in identical environment respectively for transfer-gen plant, and compares and they is carried out
Flowering phenotype compares.
The results show：For TFL1-like genes, when wildtype Arabidopsis thaliana is being bloomed for 32 days or so, 3
Bolting has not yet been viewed in TFL1-like gene transgenic plant, as shown in Figure 5；And for CEN-like genes, wild type is intended
Southern mustard has tied many siliques after 40 days, but 2 CEN-like gene transgenics plant just start to bloom, such as Fig. 6 institutes
Show.
65 target genes of embodiment recover confirmatory experiment to tfl1-1 mutation type surfaces
This recovers the plant expression vector that confirmatory experiment has rebuild 5 target genes, and used primer is as follows：
HbTFL1-1OF(EcoRI):GATGTCAAGGATCATGGAGCC
HbTFL1-1OR(XmaI):CCCTCTTCTTCTTGCAGCA
HbTFL1-2OF(EcoRI):GATGGCAAGAATAATAGAACCTCT
HbTFL1-2OR(XmaI):CCCGCGCCTTCTTGCAGCA
HbTFL1-3OF(EcoRI):GATGGCAAGAATAATAGAACCTCT
HbTFL1-3OR(XmaI):CCCGCGTCTTCTTGCAGCA
HbCEN1OF(EcoRI):GATGGCGAAGACAACAGATCCTC
HbCEN1OR(XmaI):CCCGCGCCTCCTTGCAGC
HbCEN2OF(EcoRI):GATGGCCAAGACTTCAGACCCTC
HbCEN2OR(PstI):TGCAGCGTCTCCTTGCTG
The positive primer 5 ' of 5 genes is held respectively added with EcoRI restriction enzyme sites.For anti-primer, HbTFL1-1, HbTFL1-
2nd, the 5 ' ends of HbTFL1-3 and HbCEN1 are all respectively added with XmaI restriction enzyme sites, and the 5 ' of HbCEN2 ends are then added with PstI digestions position
Point.The PCR product of acquisition is connected and is sequenced with pMD19 carriers.Finally, correct plasmid is sequenced in extraction, with EcoRI and
XmaI distinguishes double digestion pXCS carriers and correct HbTFL1-1, HbTFL1-2, HbTFL1-3 and HbCEN1 plasmid is sequenced, and is used in combination
T4 DNA ligases respectively connect pXCS carriers with target gene, at the same time, with EcoRI and PstI difference double digestions pXCS
Carrier and the correct HbTFL1-2 plasmids of sequencing, are connected with T4 DNA ligases.The plant of 5 target genes is finally constructed respectively
Thing expression vector, is named as pXCS-HbTFL1-1/tfl1-1, pXCS-HbTFL1-2/tfl1-1, pXCS-HbTFL1-3/
Tfl1-1, pXCS-HbCEN1/tfl1-1, pXCS-HbCEN2/tfl1-1.
Afterwards, the plant expression vector containing 5 target genes is directed respectively into Agrobacterium tumefaciems GV3101 (PMP90RK)
In (preserved by Rubber Institute, Chinese Academy of Agricultural Science).
Build 5 target gene plant expression vectors are distinguished in arabidopsis thaliana transformation tfl1-1 mutant, with reference to text
Offer (Clough, S.J.and Bent, A.F. (1998) Floral dip:a simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana.Plant J.16:735-
743.).The T0 of acquisition first soaks it with tap water, and be positioned over vernalization 3 days in 4 DEG C of environment darkrooms for seed.Sow afterwards
In 22 DEG C of long-day ambient growths (16h/8h) on the vermiculite soaked through 1/2M culture mediums, when seedling germinates, use is dense
Spend and sprayed for the herbicide of 10g/L, to screen resistant plant.After 10 days, normal seedling will be grown and be transplanted to nutrition
Native (Nutrition Soil：Vermiculite=2：1) grown in and wait sowing.
5 tfl1-1 mutant transfer-gen plants are trained with wild type, tfl1-1 mutant plants in identical environment respectively
Support, and be respectively compared they and wild type, the flowering phenotype of tfl1-1 mutant plants.
The results show：Tfl1-1 mutant plants flowering time is 27 days or so, and WT lines flowering time is 32 days
Left and right, and 5 tfl1-1 mutant transfer-gen plants can the effectively late blooming time, and being longer than 32 days, such as the institutes of Fig. 7 and 8
Show.
Conclusion：
The present invention obtains 5 TFL1-like genes in Para rubber tree first.3 TFL1-like genes have different
Tissue expression specificity；(March) is saved during the blossom season, expression of 3 genes in 10 years trees in respective nutrition organs is substantially low
Big tree and 2 years trees in 3 months；Development of 3 genes all with inflorescence during inflorescence development at the same time constantly raises.Opening
In colored male flower and female flower, the expression of 3 genes is all apparently higher than in the inflorescence but each comfortable male flower and female flower just broken up
Expression but differs.HbTFL1-1 is expressed almost in male flower and female flower, and HbTFL1-2 expresses obvious height in female flower
In the expression in male flower；And the HbTFL1-3 then expression being higher than in female flower for expressing highly significant in male flower.These knots
Fruit speculates that this 3 genes may simultaneously participate in maintenance and the inflorescence development of rubber tree juvenile phase, at the same time, HbTFL1-2 and
HbTFL1-3 may play a different role female flower and male Floral development respectively.For 2 CEN-like genes, they
There is similar expression pattern in rubber tree nutrition organs, but it is not exactly the same.The two mainly exists in 3 months big seedling
Expressed in root, stem and bud.It is divided into three kinds with growth and development, the two expression trend shown.First, in root, two
All expression gradually reduces person with age, and zero was reduced in tree in 2 years.Second, in stem, the two is shown after first raising
The trend of reduction；In bud, HbCEN1 shows first to raise the expression trend reduced afterwards, and HbCEN2 was then shown with the age
Increase the trend gradually reduced.During inflorescence development, the two shows similar expression pattern, i.e., with the development of inflorescence
Their expression gradually reduces, especially HbCEN1, and expression trend is clearly.These results presumptions, the two genes have very much
It may participate in maintaining rubber tree nutrient growth.By showing arabidopsis wild type genetic transformation, 5 genes can significantly affect
Arabidopsis nutrient growth and the development of inflorescence.Meanwhile 5 genes are overexpressed in tfl1-1 mutant plants, tfl1-1 mutation
Phenotype all can effectively be reverted to wild type phenotype, or even late blooming or not flowering phenotype occur.In short, no matter from rubber
Gum tree nutrient growth is still from the point of view of the inflorescence development stage of reproductive growth is entered, and the high expression of 5 genes is to rubber tree juvenile phase
Maintenance and/or have very important effect to inflorescence development.And these act on and body are all able in transgenic arabidopsis
It is existing.Therefore this 5 candidate genes of blooming that can be highly useful as Para rubber tree, can by gain-of-function mutation or
Afunction mutation research realizes the Effective Regulation bloomed to rubber tree.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Claims (9)
- A kind of modulin HbTFL1-2 1. rubber tree blooms, it is characterised in that its amino acid sequence such as SEQ ID No.6 institutes Show.
- 2. the encoding gene of albumen described in claim 1.
- 3. encoding gene according to claim 2, it is characterised in that its nucleotides sequence is classified as in SEQ ID No.4 Shown in 171bp~689bp.
- A kind of 4. controlling gene HbTFL1-2 of blooming from rubber tree, it is characterised in that its cDNA sequence such as SEQ ID No.4 It is shown.
- 5. gene HbTFL1-2 according to claim 4, it is characterised in that its DNA sequence dna is as shown in SEQ ID No.5.
- 6. the carrier containing encoding gene described in Claims 2 or 3.
- 7. the engineering bacteria containing carrier described in claim 6.
- 8. encoding gene described in Claims 2 or 3 and application of the gene of claim 4 or 5 in terms of plant blossom is postponed.
- 9. application according to claim 8, it is characterised in that the engineering bacteria described in claim 7 is infected into plant, is obtained The transfer-gen plant of florescence delay.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510366358.0A CN105017395B (en) | 2015-06-29 | 2015-06-29 | A kind of rubber tree blooms modulin HbTFL1-2 and its encoding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510366358.0A CN105017395B (en) | 2015-06-29 | 2015-06-29 | A kind of rubber tree blooms modulin HbTFL1-2 and its encoding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105017395A CN105017395A (en) | 2015-11-04 |
| CN105017395B true CN105017395B (en) | 2018-05-15 |
Family
ID=54407739
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510366358.0A Active CN105017395B (en) | 2015-06-29 | 2015-06-29 | A kind of rubber tree blooms modulin HbTFL1-2 and its encoding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105017395B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106916829B (en) * | 2017-05-10 | 2019-07-09 | 中国热带农业科学院橡胶研究所 | A kind of rubber tree blooms controlling gene HbFT1 and its clone and application |
| CN107119057B (en) * | 2017-05-10 | 2019-08-23 | 中国热带农业科学院橡胶研究所 | A kind of rubber tree blooms controlling gene HbFT2 and its clone and application |
| CN108017696B (en) * | 2017-12-22 | 2021-04-20 | 北京林业大学 | Chrysanthemum CmTFL1c gene and application thereof |
| CN108070026B (en) * | 2017-12-22 | 2021-04-30 | 北京林业大学 | Chrysanthemum CmTFL1a gene and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103103168A (en) * | 2013-02-06 | 2013-05-15 | 中国热带农业科学院橡胶研究所 | Protein for promoting plant growth and flowering and application of coding gene of protein |
| WO2013130016A1 (en) * | 2012-02-27 | 2013-09-06 | Temasek Life Sciences Laboratory Limited | Flowering modification in jatropha and other plants |
-
2015
- 2015-06-29 CN CN201510366358.0A patent/CN105017395B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013130016A1 (en) * | 2012-02-27 | 2013-09-06 | Temasek Life Sciences Laboratory Limited | Flowering modification in jatropha and other plants |
| CN103103168A (en) * | 2013-02-06 | 2013-05-15 | 中国热带农业科学院橡胶研究所 | Protein for promoting plant growth and flowering and application of coding gene of protein |
Non-Patent Citations (2)
| Title |
|---|
| Inflorescence Commitment and Architecture in Arabidopsis;Desmond Bradley等;《SCIENCE》;19970103;第275卷;第80-83页 * |
| 巴西橡胶树FCA基因的克隆及功能分析;鲁旭等;《广东农业科学》;20141231(第15期);第116-120页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105017395A (en) | 2015-11-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105017395B (en) | A kind of rubber tree blooms modulin HbTFL1-2 and its encoding gene and application | |
| CN105037518B (en) | A kind of rubber tree blooms modulin HbTFL1 3 and its encoding gene and application | |
| CN113088526B (en) | Heat shock related gene ZmHsf11 and application thereof in regulation and control of plant heat resistance | |
| CN112342236B (en) | Application of rice histone methyltransferase in enhancing crop drought resistance and improving single plant yield | |
| CN105017396B (en) | A kind of rubber tree blooms modulin HbTFL1 1 and its encoding gene and application | |
| CN107325162A (en) | SPL genes and its application in enhancing Heat Resistance of Plant performance | |
| US20180092319A1 (en) | Growing strawberry plug plants at low elevation without the need for conditioning | |
| KR100860199B1 (en) | the production of fruit tree for transforming tree form by using MADS-Box gene | |
| CN105017397B (en) | A kind of rubber tree blooms modulin HbCEN1 and its encoding gene and application | |
| CN103820480B (en) | The application of a kind of rice transcription factor in improvement rice high yield proterties | |
| CN105017398B (en) | A kind of rubber tree blooms modulin HbCEN2 and its encoding gene and application | |
| CN106978499B (en) | Transgenic soybean event GC1-1 external source Insert Fragment flanking sequence and its application | |
| CN105400792A (en) | Application of corn kernel factor gene ZmNF-YA3 to changing plant resistance tolerance | |
| CN101845085B (en) | Wild soybean AP1 type protein and coding gene and application thereof | |
| CN103665129B (en) | One kind of plant associated protein TaMYB72 at heading stage and application thereof | |
| CN102115751A (en) | Rape BnPABP 5 gene and application of promoter thereof | |
| CN104119432A (en) | Apocarya MADS-box transcription factor CiMAD9 as well as encoding gene and application of apocarya MADS-box transcription factor CiMAD9 | |
| CN104004076B (en) | A kind of apocarya MADS-box class transcription factor CiAG and encoding gene thereof and application | |
| CN104098662A (en) | Rice drought resistance related protein, coding gene and application thereof | |
| CN103255148B (en) | Application of paddy rice transcription factor Os01g18440 gene | |
| CN103266114B (en) | Application of rice transcription factor Os01g23760 gene | |
| CN103626856A (en) | Transcription factor AtGT4, coding gene thereof and applications | |
| CN102250947A (en) | Preparation method of plant male sterile line and restorer line and application thereof | |
| Malnoy et al. | The role of Vfa1, Vfa2 and Vfa4 genes in resistance to Venturia inaequalis in transgenic'McIntosh'apple plants | |
| CN114891805A (en) | MsHMG-Y gene and encoding protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |