AU2021106574A4 - Primer probe set for human histamine receptor hrh1 mrna detection, kit and use - Google Patents

Abstract

OF THE DISCLOSURE The present disclosure provides a primer probe set for human histamine receptor HRH1 mRNA detection, a kit and use, and relates to the technical field of biological detection. In the present disclosure, the primer probe set includes a HRH1-F, a HRH1-R and a probe Hi-Probe; where the HRH1-F has a nucleotide sequence shown in SEQ ID NO. 1, the HRH1-R has a nucleotide sequence shown in SEQ ID NO. 2, and the probe H1-Probe has a nucleotide sequence shown in SEQ ID NO. 3. The present disclosure provides a kit including the primer probe set and a detection method. An expression level of the HRH1 mRNA can be detected using an RNA one-step method. The present disclosure provides a detection method with high accuracy, wide detection range and high sensitivity for detection of HRH1 proteins. 5/5 pGM-T Fast Vector map Seal T-7 p~M-T~astsecto (3031 bp) co pGM-Tast~ctorplyclningstema TITAM~4~Not4I $'-~GTAAA~OAT~ATATA~~AAGQQCCQ~GTC~AT~c~cCGCCGC&T z I~ -JW I PACT ATGTGG &TTITA =TTTTATGC JLTGCTGATATAC AGCCGCGTAAATG~r I I fs~ 'srL EcQ~f _ FIG.8

Description

5/5

pGM-T Fast Vector map

Seal T-7

p~M-T~astsecto

(3031 bp) co

pGM-Tast~ctorplyclningstema

TITAM~4~Not4I $'-~GTAAA~OAT~ATATA~~AAGQQCCQ~GTC~AT~c~cCGCCGC&T z I~

-JW I

PACT ATGTGG &TTITA =TTTTATGC JLTGCTGATATACAGCCGCGTAAATG~r

I I fs~ 'srL

EcQ~f _ FIG.8

PRIMER PROBE SET FOR HUMAN HISTAMINE RECEPTOR HRH1 MRNA DETECTION, KIT AND USE

TECHNICAL FIELD

[01] The present disclosure belongs to the technical field of biological detection, and specifically relates to a primer probe set for human histamine receptor HRHI mRNA detection, a kit and use.

BACKGROUNDART

[02] Histamine is an active amine compound widely present in animals and plants. The histamine is formed by the decarboxylation of histidine and is usually stored in mast cells of tissues. Histamine is an important chemical conductive substance in the body, and can affect many cellular reactions, including allergies, inflammatory reactions, gastric acid secretion, etc. When the body is stimulated to trigger an antigen-antibody reaction, the cell membrane permeability of mast cells is changed to release the histamine, and the histamine interacts with a histamine receptor to produce pathophysiological effects. The synthesis of a histamine mainly occurs in mast cells, basophils, lungs, skin and gastrointestinal mucosa, and is consistent with the tissues that store the histamine. Histamine, like other transmitters, binds to specific receptors on target cells, thereby changing the biological activity of cells and exerting wide physiological or pathological effects. The inflammatory effect of histamine, namely the effect of histamine on the immune homeostasis in the body depends on the expression and activity of currently-known 4 histamine receptors. The 4 histamine receptors are named in the order of discovery as follows: a histamine 1 (HI) receptor, a histamine 2 (H2) receptor, a histamine 3 (H3) receptor, and a histamine 4 (H4) receptor; where, the HI receptor is very important in mediating the occurrence of allergic inflammations, including promoting the maturation of dendritic cells and regulating the balance between T helper 1 (Thl) cells/T helper 2 (Th2) cells. The HI receptor is a member of the rhodopsin-like family of G protein-coupled receptors (GPCR). The HI receptor is mainly expressed in endothelium, smooth muscle, vascular endothelial cells, heart and central nervous system, and regulate vasodilation and bronchoconstriction. The HI receptor is a main therapeutic target for allergy. When histamine acts on the HI receptor, the intracellular cyclic guanosine monophosphate (C-GMP) increases, showing increased heart rate, vasoconstriction, bronchoconstriction, small intestinal smooth muscle contraction, and increased microvascular permeability. Generally, the activated and non-activated forms of the HI receptor are in an equilibrium state. In allergic diseases, a large amount of immunoglobulins E (IgE) stimulate the mast cells and basophils to release histamine to activate the histamine receptors, leading to symptoms of allergic diseases. The expression level of histamine receptor mRNA in allergic patients is higher than that in healthy people.

[03] Hi antihistamines are widely used in the treatment of allergic diseases such as seasonal and perennial allergic rhinitis, urticaria and atopic dermatitis. The HI antihistamines exert the antihistamine effect mainly by inversely agonizing an inactive form of the HI receptor. HI antihistamines can not only down-regulate the expression level of HI receptor mRNA induced by histamine, but also down-regulate the basal expression level of HI receptor and reduce its inherent activity without histamine stimulation.

[04] Most patients with allergic diseases use symptomatic treatment based on the experience of doctors and use antihistamines to relieve allergic symptoms. However, antihistamine therapy is not effective for all patients, and cannot quantify the therapeutic effect. There are no relevant studies or records on this at present.

SUMMARY

[05] In view of this, the present disclosure provides a primer probe set for human histamine receptor HRH1 mRNA detection, a kit and use. An expression level of the HRH1 mRNA can be one-step quantitatively detected. The present disclosure provides a detection method with high accuracy, wide detection range and high sensitivity for the detection of HRH1 proteins.

[06] In order to realize the above objective, the present disclosure provides the following technical solutions:

[07] The present disclosure provides a primer probe set for human histamine receptor HRH1 mRNA detection, including a HRHI-F, a HRHI-R and a probe HI-Probe; where

[08] the HRHi-F has a nucleotide sequence shown in SEQ ID NO. 1, the HRHi-R has a nucleotide sequence shown in SEQ ID NO. 2, and the probe H-Probe has a nucleotide sequence shown in SEQ ID NO. 3.

[09] Preferably, the primer probe set may further include a primer pair and a probe of a reference gene GAPDH, where the primer pair of the GAPDH may include a GAPDH-F and a GAPDH-R, and the probe of the GAPDH may include a G-Probe; and

[10] the GAPDH-F may have a nucleotide sequence shown in SEQ ID NO. 4, the GAPDH-R may have a nucleotide sequence shown in SEQ ID NO. 5, and the G-Probe may have a nucleotide sequence shown in SEQ ID NO. ID NO. 6.

[11] Preferably, 5'-ends of the probes HI-Probe and G-Probe may be each labeled with different fluorescent labeling groups, and 3'-ends of the probes Hi-Probe and G-Probe may be each labeled with a same quenching group or different quenching groups.

[12] Preferably, the fluorescent labeling group may include a 6-carboxyfluorescein (FAM) or a 2,7-dimethyl-4,5-dichloro-6-carboxyfluorescein (JOE), and the quenching group may include a Black Hole Quencher-i (BHQ1).

[13] The present disclosure further provides a kit for one-step detection of an expression level of a human histamine receptor HRH1 mRNA, including a mixed solution of the primer probe set, a

PCR reaction solution, an enzyme mixed solution, a human histamine receptor HRH1 standard, an carboxy-X-rhodamine (ROX)reference dye and nuclease-free water. ) [14] Preferably, the HRH1-F, the HRH1-R, the probe Hi-Probe, the GAPDH-F, the GAPDH-R and the G-Probe in the mixed solution of the primer probe set may have a concentration of 1 nM, 1 nM, 1.5 nM, 2 nM, 2 nM and 3 nM, respectively.

[15] Preferably, the PCR reaction solution may include a deoxy-ribonucleoside triphosphate (dNTP) mix, MgCl2 and a buffer; and

[16] the enzyme mixed solution may include a thermus aquaticus (Taq) enzyme, a reverse transcriptase, a ribonuclease (RNase) inhibitor and a Taq enzyme antibody with a mass ratio of 15:6:3:1.

[17] The present disclosure further provides a method for one-step detection of an expression level of the human histamine receptor HRH1 mRNA based on the kit, including the following steps: preparing a reaction system with the kit by using the human histamine receptor HRH1 standard as a template, conducting a quantitative real-time polymerase chain reaction (qRT-PCR), and constructing a standard curve using a logarithm of a copy number as an abscissa and a Ct value as an ordinate;

[18] preparing the same reaction system using an RNA extracted from a sample as a template, conducting the same qRT-PCR, and measuring the expression level of the human histamine receptor HRH1 mRNA using the standard curve.

[19] Preferably, the reaction system, calculated in 20 L, may include: 2.4 L of the nuclease-free water, 10 L of the PCR reaction solution, 0.5 L of the enzyme mixed solution, 0.5 pL of the ROX reference dye, 2 L of the mixed solution of the primer probe set and 5 tL of the template.

[20] Preferably, a qRT-PCR program may include: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 s, 40 cycles.

[21] Preferably, the standard curve may be y=-3.177x+34.178, R2 =0.996.

[22] The present disclosure further provides use of the primer probe set or the kit as a basis for the preparation of a medicine for treating immune diseases or as a tool for dynamically monitoring therapeutic effects.

[23] The present disclosure provides a primer probe set for human histamine receptor HRHI1 mRNA detection, and a kit including the primer probe set, which can detect the expression level of the human histamine receptor HRHI1mRNA by an RNA one-step method. On the one hand, whether the patient's allergic symptoms are caused by the histamine pathway can be determined (allergy symptoms caused by a non-histamine pathway do not express histamine receptors) and the dosage can be guided (a higher HI receptor expression requires a higher dose of H antihistamines). On the other hand, the treatment effect of H antihistamines can be dynamically monitored, thereby providing a detection method with high accuracy, wide detection range and high sensitivity for the detection of HRH1 proteins.

[24] In the present disclosure, the primer probes constitute a kit, and one-step detection is conducted based on the kit without separate reverse transcription, which greatly reduces the risk of causing aerosol pollution. Compared with immunological detection methods, the detection method of the present disclosure has high sensitivity, can detect low-concentration clinical samples, can sensitively detect changes in HRH1 content, and has a detection range spanning at least 6 orders of magnitude. Accordingly, the accuracy of the detection results is increased, and at least 80 people can be detected within 1 hour, such that the treatment effect can be dynamically monitored and evaluated in an earlier, more accurate, and faster manner.

BRIEF DESCRIPTION OF THE DRAWINGS

[25] FIG. 1 is a standard curve of TaqMan real-time fluorescence quantitative RT-PCR for HRH1 mRNA.

[26] FIG. 2 is a result of precision detection, where 1: 1.0x107 copies/L, and 2: 1.0x104 copies/pL.

[27] FIG. 3 is a result of accuracy detection.

[28] FIG. 4 is a result of sensitivity detection.

[29] FIG. 5 is a result of clinical sample detection, where 1: Case 1 GAPDH mRNA before treatment; 2: Case 1 GAPDH mRNA after treatment; 3: Case 1 HRH1 mRNA before treatment; 4: Case 1 HRH1 mRNA after treatment.

[30] FIG. 6 is a low-precision amplification curve in the case of non-optimal primer and probe designs.

[31] FIG. 7 is an effect of enzyme mixed solution on amplification.

[32] FIG. 8 is a plasmid map of pGM-T vector.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[33] The present disclosure provides a primer probe set for human histamine receptor HRH1 mRNA detection, including a HRH1-F, a HRH1-R and a probe HI-Probe; where

[34] the HRH1-F has a nucleotide sequence shown in SEQ ID NO. 1, the HRH1-R has a nucleotide sequence shown in SEQ ID NO. 2, and the probe H-Probe has a nucleotide sequence shown in SEQ ID NO. 3.

[35] In the present disclosure, the primer probe set preferably further includes a primer pair and a probe of a reference gene GAPDH, the primer pair of the GAPDH preferably includes a GAPDH-F and a GAPDH-R, and the probe of the GAPDH preferably includes a G-Probe; the GAPDH-F preferably has a nucleotide sequence shown in SEQ ID NO. 4, the GAPDH-R preferably has a nucleotide sequence shown in SEQ ID NO. 5, and the G-Probe preferably has a nucleotide sequence shown in SEQ ID NO. 6. In the present disclosure, 5'-ends of the probes Hi-Probe and G-Probe are each labeled with different fluorescent labeling groups, and 3'-ends of the probes HI-Probe and G-Probe are each labeled with a same quenching group or different quenching groups; and the fluorescent labeling group preferably includes a FAM or a JOE, and the quenching group includes a BHQ1. In an example of the present disclosure, for the probe Hi-Probe, the 5'-end is labeled with the FAM, and the 3'-end is labeled with the BHQI; for the probe G-Probe, the 5'-end is labeled with the JOE, and the 3'-end is labeled with the BHQ. The present disclosure preferably entrusts Shanghai Sunny Biotechnology Co., Ltd. to synthesize the above primers (Table 1).

[36] Table 1 TaqMan real-time fluorescence quantitative PCR of primer probe Name Primer sequence (5'->3') Amplified fragment HRH1-F AATCCTTCTCTCGAACGGACT HRH1-R GGCCTGTGTTAGACCCACTC 84 bp Hi-Probe (FAM)-TTGCCTTTGCCTGGTGCTGTC-(BHQ1) GAPDH-F GACAACAGCCTCAAGATCATC GAPDH-R CGCCACAGTTTCCCGGAG 70 bp G-Probe (JOE)-ACTCATGACCACAGTCCATGCCAT-(BHQ1)

[37] In the present disclosure, the primer probe set when being used is preferably in the form of a mixed solution; and the HRHI-F, the HRHI-R, the probe H-Probe, the GAPDH-F, the GAPDH-R and the G-Probe in the mixed solution of the primer probe set have a concentration of 1 nM, 1 nM, 1.5 nM, 2 nM, 2 nM and 3 nM, respectively.

[38] The present disclosure further provides a kit for one-step detection of an expression level of a human histamine receptor HRH1 mRNA, including a mixed solution of the primer probe set, a PCR reaction solution, an enzyme mixed solution, a human histamine receptor HRH1 standard, an ROX reference dye and nuclease-free water.

[39] In the present disclosure, the mixed solution is preferably the same as the above mixed solution and is not further described any more.

[40] In the present disclosure, the PCR reaction solution preferably includes a dNTP mix, MgCl2 and a buffer; the dNTP mix is preferably a mixture of a dATP, a dTTP, a dCTP, and a dGTP, which is purchased from Thermo Fisher Scientific (product number: R0192), and has a working concentration of preferably 0.1-i mM; the MgCl2 has a concentration of preferably 5-20 mM; and the buffer is a 10-50 mM Tris-HCl buffer (at pH 8.0). The enzyme mixed solution preferably includes a Taq enzyme, a reverse transcriptase, an RNase inhibitor and a Taq enzyme antibody with a mass ratio of preferably 15:6:3:1 to obtain the best amplification efficiency. The histamine receptor HRHi standard is preferably an RNA standard for preparing a standard curve.

[41] In the present disclosure, the Taq enzyme is a heat-resistant Taq DNA polymerase, deoxynucleotides in the dNTP are added to a 3-OH terminus one by one using the 3'--5' polymerase activity of the Taq enzyme and using DNA as a template; meanwhile, mismatched primer ends can be identified and eliminated using the 5'--3' exonuclease activity of the Taq enzyme, which is related to the correction function during the replication process, nucleotides can also be hydrolyzed from the 5'-end and mismatched nucleotides can also be excised through several nucleotides. In this way, the chain replacement is realized during the chain extension, and the replaced probe is cut off. The reverse transcriptase can reverse transcribe a mRNA into a cDNA for PCR reaction. The RNase inhibitor is used to suppress the activity of an exogenous RNase. The Taq enzyme antibody is an anti-Taq antibody for hot-start PCR, inhibits DNA polymerase activity after binding to the Taq enzyme, and can effectively suppress the non-specific annealing of primers and the non-specific amplification caused by primer dimers under low temperature conditions. Taq enzyme antibody is denatured during the initial DNA denaturation of the PCR reaction, and the Taq enzyme recovers the activity to realize PCR amplification.

[42] The present disclosure further provides a method for one-step detection of the expression level of the human histamine receptor HRH1 mRNA based on the kit, including the following steps: preparing a reaction system with the kit by using the human histamine receptor HRH1 standard as a template, conducting a quantitative real-time polymerase chain reaction (qRT-PCR), and constructing a standard curve using a logarithm of a copy number as an abscissa and a Ct value as an ordinate;

[43] preparing the same reaction system using an RNA extracted from a sample as a template, conducting the same qRT-PCR, and measuring the expression level of the human histamine receptor HRH1 mRNA using the standard curve.

[44] In the present disclosure, the reaction system, calculated in 20 L, preferably includes: 2.4 pL of the nuclease-free water, 10 L of the PCR reaction solution, 0.5 L of the enzyme mixed solution, 0.5 L of the ROX reference dye, 2 L of the mixed solution of the primer probe set and 5 L of the standard or a to-be-tested RNA sample. The qRT-PCR reaction program preferably includes: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 s, 40 cycles. The standard curve is constructed using a logarithm of a copy number as an abscissa (x) and a Ct value as an ordinate (y): y=-3.422x + 37.235 (R2 =1.000). There is no special limitation on the source of the RNA, and the RNA can be extracted from human blood, nasal secretions, bronchial irrigating fluid, saliva or tear samples.

[45] The present disclosure further provides use of the primer probe set or the kit as a basis for the preparation of a medicine for treating immune diseases or as a tool for dynamically monitoring therapeutic effects.

[46] In the present disclosure, the use is preferably the same as the above method and is not further described any more.

[47] The primer probe set for human histamine receptor HRH1 mRNA detection, the kit and the use provided by the present disclosure are described in detail below with reference to the examples, but these examples should not be understood as limiting the claimed protection scope of the present disclosure.

[48] Unless otherwise specified, the reagents, kits and instruments used in the present disclosure are all commercially-available conventional in the art:

[49] a whole-blood total RNA kit (Hangzhou Simgen Biological Reagent Development Co., Ltd., product number: 5201050);

[50] a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, product number: E2040S);

[51] an Applied Biosystems T M 7300 fluorescence quantitative PCR instrument (Thermo Fisher Scientific, USA);

[52] a -80°C low-temperature refrigerator (Thermo Fisher Scientific, USA);

[53] a high-speed and low-temperature table centrifuge (Eppendorf, Germany); and

[54] a Qubit 3 Fluorometer (Thermo Fisher Scientific, USA).

[55] Example 1

[56] 1. Shanghai Sunny Biotechnology Co., Ltd. was entrusted to synthesize the primers and probes shown in Table 1.

[57] 2. Preparation of a standard

[58] In-vitro transcription: a pGM-T ligation kit [TIANGEN Biotech (Beijing) Co., Ltd., product number: VT202-01] was used, a HRH1 plasmid DNA (constructed and synthesized by entrusting Nanjing GenScript Biotech Co., Ltd., FIG. 8) was constructed using a pGM-T as a vector, and HRH1 plasmid DNA was transcribed into a mRNA in vitro using the HiScribe T7 High Yield RNA Synthesis Kit (NEW ENGLAND BioLabs, product number: E2040S).

[59] The initial copy number of RNA was calculated according to a copy number calculation formula: copy number=[6.02x1023xRNA concentration (ng/L)x10-9]/[RNA length (bp)x340]. The HRH1 mRNA was diluted with nuclease-free water to 1.Ox1010 copies/4L, to obtain a HRH1 mRNA standard.

[60] 3. Extraction and dilution of whole-blood RNA: whole-blood total RNA was extracted from ethylenediaminetetraacetic acid (EDTA) anticoagulated whole-blood samples with the whole-blood total RNA kit, quantificated with the Qubit 3 fluorometer, and diluted with the nuclease-free water to 20 ng/L.

[61] 4. TaqMan real-time fluorescent quantitative PCR

[62] A 20 L system was prepared using the standard/whole-blood RNA as a template with: 2.4 pL of the nuclease-free water, 10 L of the PCR reaction solution, 0.5 L of the enzyme mixed solution, 0.5 L of the ROX reference dye, 2 L of the mixed solution of the primer probe set and 5 L of the standard or a to-be-tested RNA sample.

[63] A qRT-PCR program was as follow: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and °C for 31 s, 40 cycles. A detection fluorescein was set up: FAM, JOE; a reference fluorescence was: ROX; reaction system was: 20 L; and the fluorescence signal collection was: 60°C for 31 sec.

[64] 5. Generation of a standard curve

[65] The HRH1 standard was diluted in a 10-fold gradient using1.0x108-1.0x103 copies/pL as a template, 3 replicates were conducted for each dilution, and TaqMan real-time fluorescence quantitative RT-PCR detection was conducted to generate a standard curve.

[66] The result is shown in FIG. 1. The logarithm of the copy number is taken as the abscissa (x) and the Ct value is taken as the ordinate (y), and a regression equation is obtained: y=-3.422x+37.235 (R 2=1.000), indicating the logarithm of the copy number of the standard equation has a very high correlation with the Ct value.

[67] 6. Precision detection

[68] Standards of 1.0x107 copies/pL and 1.0x104 copies/pL were taken as templates, 10 replicates were conducted for each concentration; 10 times of TaqMan real-time fluorescent quantitative RT-PCR detections were conducted, a coefficient of variation of the logarithm of each concentration was calculated, respectively; and a statistical analysis was conducted to analyze the precision of the detection method.

[69] The results are shown in Table 2 and FIG. 2. The coefficient of variation of the logarithm of each concentration is 0.380% and 0.539% separately, and is less than 5%, indicating that the TaqMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has excellent precision.

[70] Table 2 Precision detection result Theoretical copy number Mean logarithm of copy number SD C.V 1.0x107 6.976 0.027 0.380%

1.Ox104 4.003 0.022 0.539%

[71] 7. Accuracy detection

[72] A 1.Ox106 copies/pL standard was subjected to a 30-time dilution (2 pL1.x106 copies/pL standard + 58 pL nuclease-free water) as a template, for 3 replicates; 3 times of TaqMan real-time fluorescence quantitative RT-PCR detections were conducted, and an absolute deviation of the logarithm of each concentration was calculated. The results are shown in FIG. 3. The absolute deviation of the logarithm of each concentration is 0.013, -0.004, and -0.010, respectively, within the range of 0.5, indicating that the TaqMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has excellent accuracy.

[73] Table 3 Accuracy detection data

Results Copy number Theoretical copy number Theoretical copy Absolute CT (copies/ptL) logarithm (copies/ptL) number logarithm deviation 21.713 3.434x104 4.536 0.013 21.771 3.302x104 4.519 3.333x104 4.523 -0.004 21.790 3.259x104 4.513 -0.010

[74] 8. Sensitivity detection

[75] A 10.0 copies/pL standard was taken as a template, for 25 replicates, 25 times of TaqMan real-time fluorescence quantitative RT-PCR detection were conducted to check whether there were amplifications, and the sensitivity of the detection method was analyzed.

[76] The results are shown in Table 4 and FIG. 4. A total of 25 detection results are obtained, reaching 100%. This indicates that the TaqMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has very high sensitivity, and the minimum number of detected copies is less than 10 copies/ pL.

[77] Table 4 Ct value results of sensitivity detection 32.435 32.450 32.998 33.082 31.590 32.149 31.957 32.612 32.142 31.225 31.892 32.739 32.496 32.059 32.104

31.829 32.396 32.925 32.076 31.819

33.021 31.887 32.168 32.670 31.634

[78] 9. Clinical sample detection

[79] Whole-blood samples of patients and normal persons were taken to extract and dilute whole-blood RNA according to the above steps, and TaqMan real-time fluorescent quantitative RT-PCR detection was conducted according to the above steps.

[80] Compared with a domestic brand of human histamine HI receptor (HRH1) detection kit (enzyme-linked immunosorbent assay), the results are shown in Table 5 and FIG. 5. The TaqMan real-time fluorescent quantitative RT-PCR detection method established in the present disclosure has better sensitivity and specificity than that of a counterpart reagent, and can effectively monitor the treatment effect.

[81] Table 5 Comparison of clinical sample detection experiments

Human histamine Hi receptor (HRH1) detection kit

Product ofmpe te p(enzyme-linked immunosorbent assay) SN Sample type

Results Positive/negative Results (ng/mL) Positive/negative (copies/ptL)

Case 1 before 1 74.407 + 156.7

+ treatment

Case 1 after 2 11.480 - 89.3

+ treatment

Case 2 before 3 84.491 + 267.9

+ treatment

Case 2 after 4 1.479 - 49.7 treatment

Case 3 before 89.283 + 187.6

+ treatment

Case 3 after 6 1.017 - 42.7 treatment

7 Case 4 29.012 + 56.1

Healthy 8 3.964 - 32.7 control 1

Healthy 9 3.027 - 67.9 +

control 2

Healthy 2.244 - 47.6 control 3

[82] Comparative Example 1 Results of amplification using other non-optimal primers and probes

[83] The primers and probes in the system used in the present disclosure in Example 6 were replaced with other non-optimal primers and probes. The results are shown in Table 6 and FIG. 6. A coefficient of variation of the logarithm of the low-precision concentration exceeds 5%, reaching 8.006%.

[84] Sequences of non-optimal HRH1 primers and probes were used:

[85] HRH1-F(SEQIDNO.7):CAGGGACTATGTAGCCGTCA;

[86] HRH1-R (SEQ ID NO.8): AGAGAAGGATTGGCTATCACC; and

[87] Hi-Probe (SEQ ID NO.9): (FAM)-CTGATATCTCGCTGGCCCCATG-(BHQ1).

[88] Table 6 Amplification of non-optimal primers and probes Theoretical copy number Mean logarithm of copy number SD C.V 1.Ox104 3.657 0.293 8.006%

[89] Comparative Example 2 Comparison of the effect of enzyme mixed solution

[90] An amplification was conducted on 4 cases of whole-blood RNA samples using a non-optimal ratio of enzyme mixed solution (the Taq enzyme, reverse transcriptase, RNase inhibitor and Taq enzyme antibody had a mass ratio of 13:7:4:1) and a best ratio of enzyme mixed solution. An amplification result using the non-optimal ratio of enzyme mixed solution is shown in FIG. 7 A, and an amplification result using the best ratio of enzyme mixed solution is shown in FIG. 7 B. It can be seen that the best enzyme mixed solution has better repeatability and better amplification effect.

[91] The above descriptions are merely preferred implementations of the present disclosure. It should be noted that a person of ordinary skill in the art may further make several improvements and modifications without departing from the principle of the present disclosure, but such improvements and modifications should be deemed as falling within the protection scope of the present disclosure.

[92] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[93] The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

Claims (5)

WHAT IS CLAIMED IS:

1. A kit for one-step detection of an expression level of a human histamine receptor HRHI mRNA, comprising a mixed solution of a primer probe set for human histamine receptor HRH1 mRNA detection, a PCR reaction solution, an enzyme mixed solution, a human histamine receptor HRHI1 standard, an carboxy-X-rhodamine (ROX) reference dye and nuclease-free water; wherein the primer probe set comprises a HRH1-F, a HRHI-R and a probe H1-Probe; the HRHI-F has a nucleotide sequence shown in SEQ ID NO. 1, the HRHI-R has a nucleotide sequence shown in SEQ ID NO. 2, and the probe H1-Probe has a nucleotide sequence shown in SEQ ID NO. 3; the primer probe set further comprises a primer pair and a probe of a reference gene GAPDH, the primer pair of the GAPDH comprises a GAPDH-F and a GAPDH-R, and the probe of the GAPDH comprises a G-Probe; the GAPDH-F has a nucleotide sequence shown in SEQ ID NO. 4, the GAPDH-R has a nucleotide sequence shown in SEQ ID NO. 5, and the G-Probe has a nucleotide sequence shown in SEQ ID NO. ID NO. 6; 5'-ends of the probes H-Probe and G-Probe are each labeled with different fluorescent labeling groups, and 3'-ends of the probes Hi-Probe and G-Probe are each labeled with a same quenching group or different quenching groups; and the fluorescent labeling group comprises a 6-carboxyfluorescein (FAM) or a 2,7-dimethyl-4,5-dichloro-6-carboxyfluorescein (JOE), and the quenching group comprises a Black Hole Quencher-i (BHQ1).

2. The kit according to claim 1, wherein the HRHi-F, the HRHI-R, the probe H-Probe, the GAPDH-F, the GAPDH-R and the G-Probe in the mixed solution of the primer probe set have a concentration of 1 nM, 1 nM, 1.5 nM, 2 nM, 2 nM and 3nM, respectively.

3. The kit according to claim 1, wherein the PCR reaction solution comprises a deoxy-ribonucleoside triphosphate (dNTP) mix, MgCl2 and a buffer; and the enzyme mixed solution comprises a thermus aquaticus (Taq) enzyme, a reverse transcriptase, a ribonuclease (RNase) inhibitor and a Taq enzyme antibody with a mass ratio of :6:3:1.

4. Use of the kit according to any one of claims 1-3 as a basis for the preparation of a medicine for treating immune diseases or as a tool for dynamically monitoring therapeutic effects.

5. The use according to claim 4, wherein a reaction system is prepared using the primer probe set or the kit, to conduct a quantitative real-time polymerase chain reaction (qRT-PCR); and the reaction system, calculated in 20 L, comprises: 2.4 L of the nuclease-free water, 10 L of the PCR reaction solution, 0.5 L of the enzyme mixed solution, 0.5 L of the ROX reference dye, 2 L of the mixed solution of the primer probe set and 5 L of the standard or a to-be-tested RNA sample; wherein a qRT-PCR program comprises: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and °C for 31 s, 40 cycles.