AU2021106586A4

AU2021106586A4 - Reagent for detecting expression level of human histamine receptor hrh4 mrna, kit and use

Info

Publication number: AU2021106586A4
Application number: AU2021106586A
Authority: AU
Inventors: Weiyue Cai; Xuehan JIANG; Yi Liu; Meijie Wang; Shandong Wu; Zhoujie Wu; Xukai Yang
Original assignee: Hangzhou Zheda Dixun Biological Gene Engineering Co Ltd
Current assignee: Hangzhou Zheda Dixun Biological Gene Engineering Co Ltd
Priority date: 2021-08-04
Filing date: 2021-08-23
Publication date: 2021-11-11
Anticipated expiration: 2029-08-23
Also published as: ZA202200490B; CN113584154A; NL2030977B1

Abstract

OF THE DISCLOSURE The present disclosure provides a reagent for detecting an expression level of a human histamine receptor HRH4 mRNA, a kit and use, and relates to the technical field of biological detection. In the present disclosure, the reagent includes a specific primer and a probe for a human histamine receptor HRH4, the specific primer includes an HRH4-F and an HRH4-R, and the probe includes an H4-Probe; and the HRH4-F has a nucleotide sequence shown in SEQ ID NO. 1, the HRH4-R has a nucleotide sequence shown in SEQ ID NO. 2 and the 114-Probe has a nucleotide sequence shown in SEQ ID NO. 3. In the present disclosure, a kit for one-step detection based on the reagent is prepared, and the expression level of the HRH4 mRNA can be one-step quantitatively detected with simple operation and short detection time. The present disclosure provides a kit product that can guide the medication and accurately quantify the efficacy for H4 antihistamines. 16 4/4 FIG. 7 pGM-T Fast Vector map 17Pri~wN f a ri AJaI D11 d~ ~GMT~OTA~AA1AT~AT~T~2IATAJACT~1~G11CCCpCh I ~~TTAA~&TA~iZHCT&~TTA~AM~TiLYC ITATA~CCGA Jmp Lco -~EEtg I 10ZNo pGM-M~ecto hi C ~~TAG~A~~TA (3031 bp)CTCCTTTTAACCT EcoAAAI ~CGAAT~ATAGATATACAOTT1AI FIG.8

Description

4/4

FIG. 7

pGM-T Fast Vector map

17Pri~wN fa ri D11 AJaI d~

~GMT~OTA~AA1AT~AT~T~2IATAJACT~1~G11CCCpCh I ~~TTAA~&TA~iZHCT&~TTA~AM~TiLYC ITATA~CCGA Jmp Lco -~EEtg I 10ZNo pGM-M~ecto hi C

~~TAG~A~~TA (3031 bp)CTCCTTTTAACCT EcoAAAI ~CGAAT~ATAGATATACAOTT1AI

FIG.8

REAGENT FOR DETECTING EXPRESSION LEVEL OF HUMAN HISTAMINE RECEPTOR HRH4 MRNA, KIT AND USE

TECHNICAL FIELD

[01] The present disclosure belongs to the technical field of biological detection, and specifically relates to a reagent for detecting an expression level of a human histamine receptor HRH4 mRNA, a kit and use.

BACKGROUNDART

[02] Histamine is an active amine compound widely present in animals and plants, is formed by the decarboxylation of a histidine, and is usually stored in the tissues. The histamine is an important chemical conductive substance in the body, can affect many cell reactions, including allergies, inflammatory reactions, and gastric acid secretion, etc. When the body is stimulated to trigger an antigen-antibody reaction, the cell membrane permeability of mast cells changes to release histamine, and the histamine interacts with a histamine receptor to produce pathophysiological effects. The synthesis of a histamine mainly occurs in mast cells, basophils, lungs, skin and gastrointestinal mucosa, and is consistent with the tissues that store the histamine. The histamine, like other transmitters, binds to specific receptors on target cells, thereby changing the biological activity of cells and exerting wide physiological or pathological effects. The inflammatory effect of histamine, namely the effect of histamine on the immune homeostasis in the body depends on the expression and activity of currently-known 4 histamine receptors. The 4 histamine receptors are named in the order of discovery: a histamine 1 (HI) receptor, a histamine 2 (H2) receptor, a histamine 3 (H3) receptor, and a histamine 4 (H4) receptor; where, the H4 receptor is predominantly distributed in the immune system or hematopoietic-related tissues or cells, and is highly expressed in bone marrow, peripheral hematopoietic cells and other sites related to inflammation. Therefore, the H4 receptor has become a new therapeutic target in immune diseases such as allergic reactions and asthma. The H4 receptor is involved in the chemotaxis of mast cells, eosinophils, and dendritic cells, as well as the production of cytokines in T cells and dendritic cells, and is involved in inflammatory reactions.

[03] Most patients with allergic diseases use symptomatic treatment based on the experience of doctors and use antihistamines to relieve allergic symptoms. The antihistamines that target the HI receptor are effective for some allergic patients, but still have limitations. H4 receptor antagonists can have a desirable therapeutic effect on patients that have ineffective treatment effect with HI receptor antagonists. However, the treatment with antihistamines is not effective for all patients, and cannot quantify the therapeutic effect; and long-term medication will also produce a series of side effects. There are no relevant studies and records on this at present.

SUMMARY

[04] In view of this, the present disclosure provides a reagent for detecting an expression level of a human histamine receptor HRH4 mRNA, a kit and use. The expression level of the HRH4 mRNA can be detected using an RNA one-step method. The present disclosure provides a detection method with high accuracy, wide detection range and high sensitivity for the detection of HRH4 proteins.

[05] In order to realize the above objective, the present disclosure provides the following technical solutions:

[06] The present disclosure provides a reagent for detecting an expression level of a human histamine receptor HRH4 mRNA, including a specific primer and a probe for a human histamine receptor HRH4, where the specific primer includes an HRH4-F and an HRH4-R, and the probe includes an H4-Probe; and

[07] the HRH4-F has a nucleotide sequence shown in SEQ ID NO. 1, the HRH4-R has a nucleotide sequence shown in SEQ ID NO. 2 and the H4-Probe has a nucleotide sequence shown in SEQ ID NO. 3.

[08] Preferably, the reagent may further include a specific primer and a probe of a reference gene GAPDH, where the specific primer of the GAPDH may include a GAPDH-F and a GAPDH-R, and the probe of the GAPDH may include a G-Probe; and

[09] the GAPDH-F may have a nucleotide sequence shown in SEQ ID NO. 4, the GAPDH-R may have a nucleotide sequence shown in SEQ ID NO. 5 and the G-Probe may have a nucleotide sequence shown in SEQ ID NO. ID NO. 6.

[10] Preferably, 5'-ends of the H4-Probe and G-Probe may be separately labeled with different fluorescent reporter groups, and 3'-ends of the H4-Probe and G-Probe may be labeled with a same quenching group or different quenching groups.

[11] Preferably, the fluorescent reporter group may include a 6-carboxyfluorescein (FAM) and a 2,7-dimethyl-4,5-dichloro-6-carboxyfluorescein (JOE), and the quenching group may include a Black Hole Quencher-i (BHQ1).

[12] Preferably, the HRH4-F, the HRH4-R, the H4-Probe, the GAPDH-F, the GAPDH-R and the G-Probe in the reagent may have a concentration of 2.25 nM, 1.5 nM, 1.5 nM, 1 nM, 1 nM and 1.5 nM, respectively.

[13] The present disclosure further provides a kit for one-step detection of an expression level of a human histamine receptor HRH4 mRNA, including the reagent, a PCR reaction solution, an enzyme mixed solution, a carboxy-X-rhodamine (ROX) reference dye and nuclease-free water.

[14] Preferably, the PCR reaction solution may include a deoxy-ribonucleoside triphosphate (dNTP) mix, MgCl2 and a buffer; and

[15] the enzyme mixed solution may include a thermus aquaticus (Taq) enzyme, a reverse transcriptase, a ribonuclease (RNase) inhibitor and a Taq enzyme antibody with a mass ratio of :5:4:1.

[16] Preferably, the kit may further include an RNA standard of the human histamine receptor HRH4.

[17] The present disclosure further provides use of the reagent or the kit as a basis for the preparation of a medicine for treating immune diseases or as a tool for dynamically monitoring therapeutic effects.

[18] Preferably, a reaction system may be prepared using the reagent or the kit to conduct a quantitative real-time polymerase chain reaction (qRT-PCR);

[19] the reaction system, calculated in 20 L, may include: 2.4 L of the nuclease-free water, 10 pL of the PCR reaction solution, 0.5 L of the enzyme mixed solution, 0.5 L of the ROX reference dye, 2 L of the reagent and 5 L of the RNA standard or a to-be-tested RNA sample; and

[20] a qRT-PCR program may include: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 s, 40 cycles.

[21] The present disclosure provides a reagent for detecting an expression level of a human histamine receptor HRH4 mRNA, and a kit for one-step detection of the expression level of the HRH4 mRNA is prepared based on the reagent. The expression level of the HRH4 mRNA in human blood, nasal secretions, bronchial irrigating fluid, saliva, and tear samples can be one-step quantitatively detected using the reagent or the kit with simple operation and short detection time. The present disclosure provides a kit product that can guide the medication and accurately quantify the efficacy for H4 antihistamines.

[22] In the present disclosure, the one-step detection is conducted based on the reagent and the kit without separate reverse transcription, which greatly reduces the risk of causing aerosol pollution. Compared with immunological detection methods, the detection method of the present disclosure has high sensitivity, can detect low-concentration clinical samples, can sensitively detect changes in HRH4 content, and has a detection range spanning at least 6 orders of magnitude. Accordingly, the accuracy of the detection results is increased, and at least 80 people can be detected within 1 hour, such that the treatment effect can be dynamically monitored and evaluated in an earlier, more accurate, and faster manner.

BRIEF DESCRIPTION OF THE DRAWINGS

[23] FIG. 1 is a standard curve of TaqMan real-time fluorescence quantitative RT-PCR for HRH4 mRNA.

[24] FIG. 2 is a result of precision detection, where 1: 1.0x107 copies/L, and 2: 1.0x104 copies/pL.

[25] FIG. 3 is a result of accuracy detection.

[26] FIG. 4 is a result of sensitivity detection.

[27] FIG. 5 is a result of clinical sample detection, where 1: Case 3 GAPDH mRNA before treatment; 2: Case 3 GAPDH mRNA after treatment; 3: Case 3 HRH4 mRNA before treatment; 4: Case 3 HRH4 mRNA after treatment.

[28] FIG. 6 is a low-precision amplification curve in the case of non-optimal primer and probe designs.

[29] FIG. 7 is an effect of the enzyme mixed solution on amplification.

[30] FIG 8 is a plasmid structure map of pGM-T vector.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[31] The present disclosure provides a reagent for detecting an expression level of a human histamine receptor HRH4 mRNA, including a specific primer and a probe for a human histamine receptor HRH4, where the specific primer includes an HRH4-F and an HRH4-R, and the probe includes an H4-Probe; and

[32] the HRH4-F has a nucleotide sequence shown in SEQ ID NO. 1, the HRH4-R has a nucleotide sequence shown in SEQ ID NO. 2 and the H4-Probe has a nucleotide sequence shown in SEQ ID NO. 3.

[33] In the present disclosure, the reagent preferably further includes a specific primer and a probe of a reference gene GAPDH; the specific primer of the reference gene GAPDH preferably includes a GAPDH-F and a GAPDH-R, and the probe of the reference gene GAPDH preferably includes a G-Probe; the GAPDH-F preferably has a nucleotide sequence preferably shown in SEQ ID NO. 4, the GAPDH-R preferably has a nucleotide sequence preferably shown in SEQ ID NO. 5 and the G-Probe preferably has a nucleotide sequence preferably shown in SEQ ID NO. 6. 5'-ends of the H4-Probe and G-Probe are separately labeled with different fluorescent reporter groups, and 3'-ends of the H4-Probe and G-Probe are labeled with a same quenching group or different quenching groups. In an example, the fluorescent reporter group preferably includes an FAM and a JOE, and the quenching group includes a BHQ1, and Shanghai Sunny Biotechnology Co., Ltd. is entrusted to synthesize the specific primer and the probe (Table 1).

[34] Table 1 TaqMan real-time fluorescence quantitative PCR of primer probe Name Primer sequence (5'-3') Amplified fragment

HRH4-F CTCCATATTCTCTGTTCACAAT

HRH4-R TGGATACAAAAGAGGATTGACA 128 bp

H4-Probe (FAM)-AACAGGTCCTAAATCAGTTTGGTA-(BHQ1)

GAPDH-F GACAACAGCCTCAAGATCATC 70 bp GAPDH-R CGCCACAGTTTCCCGGAG

G-Probe (JOE)-ACTCATGACCACAGTCCATGCCAT-(BHQ1)

[35] In the present disclosure, the HRH4-F, the HRH4-R, the H4-Probe, the GAPDH-F, the GAPDH-R and the G-Probe in the reagent have a concentration or number of moles of 2.25 nM, 1.5 nM, 1.5 nM, 1 nM, 1 nM and 1.5 nM, or respectively.

[36] The present disclosure further provides a kit for one-step detection of an expression level of a human histamine receptor HRH4 mRNA, including the reagent, a PCR reaction solution, an enzyme mixed solution, an ROX reference dye and nuclease-free water.

[37] In the present disclosure, the PCR reaction solution preferably includes a dNTP mix, MgCl2 and a buffer; the dNTP mix is preferably a mixture of a dATP, a dTTP, a dCTP, and a dGTP, which is purchased from Thermo Fisher Scientific (product number: R0192), and has a working concentration of preferably 0.1-1 mM; the MgCl2 has a concentration of preferably 5-20 mM; and the buffer is a 10-50 mM Tris-HCl buffer (at pH 8.0).

[38] The enzyme mixed solution includes a Taq enzyme, a reverse transcriptase, an RNase inhibitor and a Taq enzyme antibody with a mass ratio of 15:5:4:1 to obtain the best amplification effect.

[39] In the present disclosure, the kit preferably further includes an RNA standard of the human histamine receptor HRH4 to prepare a standard curve.

[40] In the present disclosure, the TaqMan real-time fluorescent quantitative PCR is directly conducted using the RNA as a template without a separate reverse transcription when detecting by the kit; the Taq enzyme is a heat-resistant Taq DNA polymerase, deoxynucleotides in the dNTP are added to a 3-OH terminus one by one using the 3'--5' polymerase activity of the Taq enzyme and using DNA as a template. Meanwhile, mismatched primer ends can be identified and eliminated using the 5'--3' exonuclease activity of the Taq enzyme, which is related to the correction function during the replication, nucleotides can also be hydrolyzed from the 5'-end and mismatched nucleotides can also be excised through several nucleotides. In this way, the chain replacement is realized during the chain extension, and the replaced probe is cut off. The reverse transcriptase can reverse transcribe an mRNA into a cDNA for PCR reaction. The RNase inhibitor is used to suppress the activity of an exogenous RNase. The Taq enzyme antibody is an anti-Taq antibody for hot-start PCR, inhibits DNA polymerase activity after binding to the Taq enzyme, and can effectively suppress the non-specific annealing of primers and the non-specific amplification caused by primer dimers under low temperature. The Taq enzyme antibody is denatured during the initial DNA denaturation of the PCR reaction, and the Taq enzyme recovers the activity to realize PCR amplification.

[41] The present disclosure further provides use of the reagent or the kit as a basis for the preparation of a medicine for treating immune diseases or as a tool for dynamically monitoring therapeutic effects.

[42] In the present disclosure, the immune diseases preferably include allergic diseases. The expression of the histamine H4 receptor (HRH4) mRNA is detected using the reagent or the kit of the present disclosure. On the one hand, whether the patient's allergic symptoms are caused by the histamine activation pathway of the H4 receptor can be determined (allergy symptoms caused by a non-histamine pathway do not express histamine receptors) and the dosage can be guided (a higher H4 receptor expression requires a higher dose of H4 receptor antagonists). On the other hand, the treatment effect of H4 receptor antagonists can be dynamically monitored.

[43] In the present disclosure, preferably a reaction system is prepared using the reagent or the kit to conduct a qRT-PCR reaction; the reaction system, calculated in 20 L, preferably includes: 2.4 L of the nuclease-free water, 10 L of the PCR reaction solution, 0.5 L of the enzyme mixed solution, 0.5 L of the ROX reference dye, 2 L of the reagent and 5 L of the standard or the RNA; a qRT-PCR program includes: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 s, 40 cycles; and an expression of HRH4 mRNA is calculated according to the standard curve prepared with the standard. The standard curve uses a copy number logarithm as an abscissa (x) and a Ct value as an ordinate (y): y=-3.177x + 34.178 (R 2 =0.996). There is no special limitation on the source of the RNA, and the RNA can be extracted from human blood, nasal secretions, bronchial irrigating fluid, saliva or tear samples.

[44] The reagent for detecting an expression level of a human histamine receptor HRH4 mRNA, the kit and the use provided by the present disclosure are described in detail below with reference to the examples, but these examples should not be understood as limiting the claimed protection scope of the present disclosure.

[45] Unless otherwise specified, the reagents, kits and instruments used in the present disclosure are all commercially-available conventional in the art:

[46] a whole-blood total RNA kit (Hangzhou Simgen Biological Reagent Development Co., Ltd., product number: 5201050);

[47] a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, product number: E2040S);

[48] an Applied Biosystems T M 7300 fluorescence quantitative PCR instrument (Thermo Fisher Scientific, USA);

[49] a -80°C low-temperature refrigerator (Thermo Fisher Scientific, USA);

[50] a high-speed and low-temperature table centrifuge (Eppendorf, Germany); and

[51] a Qubit 3 fluorometer (Thermo Fisher Scientific, USA).

[52] Example 1

[53] 1. Shanghai Sunny Biotechnology Co., Ltd. was entrusted to synthesize the primers and probes shown in Table 1.

[54] 2. Preparation of a standard

[55] In-vitro transcription: a pGM-T ligation kit [TIANGEN Biotech (Beijing) Co., Ltd., product number: VT202-01] was used, a HRH4 plasmid DNA (constructed and synthesized by entrusting Nanjing GenScript Biotech Co., Ltd., FIG. 8) was constructed using a pGM-T as a vector, and the HRH4 plasmid DNA was transcribed into an mRNA in vitro using a HiScribe T7 High Yield RNA Synthesis Kit (NEW ENGLAND BioLabs, product number: E2040S).

[56] An initial copy number of the RNA was calculated according to a copy number calculation formula: copy number=[6.02x1023xRNA concentration (ng/4L)x10-9]/[RNA length (bp)x340]. The HRH4 mRNA was diluted with nuclease-free water to 1.Ox1010 copies/4L to obtain a HRH4 mRNA standard.

[57] 3. Extraction and dilution of whole-blood RNA

[58] Whole-blood total RNA was extracted from ethylenediaminetetraacetic acid (EDTA) anticoagulated whole-blood samples with the whole-blood total RNA kit, quantificated with the Qubit 3 fluorometer, and diluted with the nuclease-free water to 20 ng/L.

[59] 4. TaqMan real-time fluorescent quantitative PCR

[60] A 20 L system was prepared using the standard/whole-blood RNA as a template with: 2.4 pL of the nuclease-free water, 10 L of the PCR reaction solution, 0.5 L of the enzyme mixed solution, 0.5 L of the ROX reference dye, 2 L of a mixed solution of the primer and the probe, and 5 L of the standard or the RNA.

[61] A qRT-PCR program was as follow: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and °C for 31 s, 40 cycles.

[62] A detection fluorescein was set up: FAM, JOE; a reference fluorescence was: ROX; the reaction system was: 20 L; and a fluorescence signal collection was: 60°C for 31 sec.

[63] 5. Generation of a standard curve

[64] The HRH4 standard was diluted in a 10-fold gradient using1.0x108-1.0x103 copies/pl as a template, 3 replicates were conducted for each dilution, and TaqMan real-time fluorescence quantitative RT-PCR detection was conducted to generate the standard curve.

[65] The result is shown in FIG. 1. A copy number logarithm is taken as an abscissa and a Ct value is taken as an ordinate, and a regression equation is obtained: y=-3.177x+34.178 (R2 =0.996), indicating the copy number logarithm of a standard equation has very high correlation with the Ct value.

[66] 6. Precision detection

[67] 1.0x107 copies/pL and 1.0x104 copies/pL of standards were taken as templates, 10 replicates were conducted for each concentration; 10 times of TaqMan real-time fluorescent quantitative RT-PCR detections were conducted, the coefficient of variation of the logarithm of each concentration was calculated, respectively; and statistical analysis was conducted to analyze the precision of the detection method.

[68] The results are shown in Table 2 and FIG. 2. The coefficient of variation of the logarithm of each concentration is 0.443% and 0.430% separately, which are less than 5%, indicating that the TaqMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has excellent precision.

[69] Table 2 Precision detection result Theoretical copy number Mean logarithm of copy number SD C.V 1.0x107 6.907 0.031 0.443%

1.0x104 3.988 0.017 0.430%

[70] 7. Accuracy detection

[71] A 1.0x106 copies/pL of standard was subjected to 30-fold dilution (2 pL1.0x106 copies/pL of a standard + 58 pL of nuclease-free water) as a template, for 3 replicates; 3 times of TaqMan real-time fluorescence quantitative RT-PCR detections were conducted, and the absolute deviation of the logarithm of each concentration was calculated. The results are shown in FIG. 3. The absolute deviation of the logarithm of each concentration is 0.126, 0.137, and 0.131, respectively, within the range of 0.5, indicating that the TaqMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has excellent accuracy.

[72] Table 3 Accuracy detection data Theoretical Theoretical copy Copy number CT Results (copies/ptL) copy number number Absolute deviation logarithm (copies/ptL) logarithm 19.409 4.454x104 4.649 0.126 19.373 4.570x104 4.660 3.333x104 4.523 0.137 19.393 4.505x104 4.654 0.131

[73] 8. Sensitivity detection

[74] A 10.0 copies/pL of standard was taken as a template, for 25 replicates, 25 times of TaqMan real-time fluorescence quantitative RT-PCR detection were conducted to check whether there were amplifications, and the sensitivity of the detection method was analyzed.

[75] The results are shown in Table 4 and FIG. 4. A total of 25 detection results are obtained, reaching 100%. This indicates that the TaqMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has very high sensitivity, and the minimum number of detected copies is less than 10 copies/pL.

[76] Table 4 Ct value results of sensitivity detection 32.533 32.716 33.514 32.321 31.944

32.110 31.967 33.336 33.215 31.506

31.673 33.513 32.747 31.747 31.961

31.605 32.968 33.157 31.965 32.189

32.769 32.178 32.692 32.465 31.669

[77] 9. Clinical sample detection

[78] Whole-blood samples of patients and normal persons were taken to extract and dilute whole-blood RNA according to the above steps, and TaqMan real-time fluorescent quantitative RT-PCR detection was conducted according to the above steps.

[79] Compared with a domestic brand of histamine H4 receptor (HRH4) kit of enzyme-linked immunosorbent assay (ELISA) , the results are shown in Table 5 and FIG. 5. The TaqMan real-time fluorescent quantitative RT-PCR detection method established in the present disclosure has better sensitivity and specificity than that of a counterpart reagent, and can effectively monitor the treatment effect.

[80] Table 5 Comparison of clinical sample detection effect Histamine H4 receptor (HRH4) kit of Product of the present disclosure ELISA SN Sample type Results positive/negative Result (ng/mL) positive/negative (copies/ptL)

Case 1 before 1 1154.669 + 678.3

+ treatment

2 Case 1 after treatment 960.673 + 153.2

+ Case 2 before 3 911.955 + 487.3

+ treatment

4 Case 2 after treatment 496.380 - 37.6

Case 3 before 1620.624 + 781.4 +

treatment

6 Case 3 after treatment 32.378 147.6 +

7 Case 4 1447.242 + 539.1 +

8 Healthy control 1 756.543 - 356.4 +

9 Healthy control 2 30.457 - 19.2

Healthy control 3 61.125 28.7

[81] Comparative Example 1 Results of amplification using other non-optimal primers and probes

[82] The primers and probes in the system used in the present disclosure in Example 5 were replaced with other non-optimal primers and probes. The results are shown in FIG. 6. When using non-optimal HRH4 primers and probes, the amplification results of the standard curve are poor, with almost no amplification.

[83] Non-optimal HRH4 primers and probes were as follows:

[84] HRH4-F (SEQ ID NO.7): GCCAGATACTAATAGCACAAT;

[85] HRH4-R (SEQ ID NO.8): CCACAAAAGCTAAAATGACCAA; and

[86] H4-Probe (SEQ ID NO.9): (FAM)-AAGCACTCGTGTTACTTTAGCA-(BHQ1).

[87] Comparative Example 2 Comparison of the effect of enzyme mixed solution

[88] An amplification was conducted using a non-optimal ratio of enzyme mixed solution (the Taq enzyme, reverse transcriptase, RNase inhibitor and Taq enzyme antibody had a mass ratio of 16:3:5:1) and a best ratio of enzyme mixed solution on 4 gradients 1.0x10 3-1.0x10 6 copies/pl on a calibration curve. An amplification result using the non-optimal ratio of enzyme mixed solution is shown in FIG. 7A, and an amplification result using the best ratio of enzyme mixed solution is shown in FIG. 7B. It can be seen that the best enzyme mixed solution has better amplification effect.

[89] The above descriptions are merely preferred implementations of the present disclosure. It should be noted that a person of ordinary skill in the art may further make several improvements and modifications without departing from the principle of the present disclosure, but such improvements and modifications should be deemed as falling within the protection scope of the present disclosure.

[90] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[91] The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

Claims

WHAT IS CLAIMED IS:

1. A reagent for detecting an expression level of a human histamine receptor HRH4 mRNA, comprising a specific primer and a probe for a human histamine receptor HRH4, wherein the specific primer comprises an HRH4-F and an HRH4-R, and the probe comprises an H4-Probe; and the HRH4-F has a nucleotide sequence shown in SEQ ID NO. 1, the HRH4-R has a nucleotide sequence shown in SEQ ID NO. 2 and the H4-Probe has a nucleotide sequence shown in SEQ ID NO. 3.

2. The reagent according to claim 1, further comprising a specific primer and a probe of a reference gene GAPDH, wherein the specific primer of the reference gene GAPDH comprises a GAPDH-F and a GAPDH-R, and the probe of the reference gene GAPDH comprises a G-Probe; and the GAPDH-F has a nucleotide sequence shown in SEQ ID NO. 4, the GAPDH-R has a nucleotide sequence shown in SEQ ID NO. 5 and the G-Probe has a nucleotide sequence shown in SEQ ID NO. ID NO. 6.

3. The reagent according to claim 1 or 2, wherein 5'-ends of the H4-Probe and G-Probe are separately labeled with different fluorescent reporter groups, and 3'-ends of the H4-Probe and G-Probe are labeled with a same quenching group or different quenching groups; wherein the fluorescent reporter group comprises a 6-carboxyfluorescein (FAM) or a 2,7-dimethyl-4,5-dichloro-6-carboxyfluorescein (JOE), and the quenching group comprises a Black Hole Quencher-i (BHQ1); wherein the HRH4-F, the HRH4-R, the H4-Probe, the GAPDH-F, the GAPDH-R and the G-Probe in the reagent have a concentration of 2.25 nM, 1.5 nM, 1.5 nM, 1 nM, 1 nM and 1.5 nM, respectively.

4. A kit for one-step detection of an expression level of a human histamine receptor HRH4 mRNA, comprising the reagent according to any one of claims 1-3, a PCR reaction solution, an enzyme mixed solution, a carboxy-X-rhodamine (ROX) reference dye and nuclease-free water; wherein the PCR reaction solution comprises a deoxy-ribonucleoside triphosphate (dNTP) mix, MgCl2 and a buffer; and the enzyme mixed solution comprises a thermus aquaticus (Taq) enzyme, a reverse transcriptase, a ribonuclease (RNase) inhibitor and a Taq enzyme antibody with a mass ratio of :5:4:1; further comprising an RNA standard of the human histamine receptor HRH4.

5. Use of the reagent according to any one of claims 1-3 or the kit according to claim 4 as a basis for the preparation of a medicine for treating immune diseases or as a tool for dynamically monitoring therapeutic effects; wherein a reaction system is prepared using the reagent or the kit to conduct a quantitative real-time polymerase chain reaction (qRT-PCR); the reaction system, calculated in 20 L, comprises: 2.4 L of the nuclease-free water, 10 L of the PCR reaction solution, 0.5 L of the enzyme mixed solution, 0.5 L of the ROX reference dye, 2 L of the reagent and 5 L of the RNA standard or a to-be-tested RNA sample; and a qRT-PCR program comprises: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 s, 40 cycles.