AU2021106581A4

AU2021106581A4 - Primer probe set and kit for rt-pcr detection of human leukotriene receptor cysltr1 mrna

Info

Publication number: AU2021106581A4
Application number: AU2021106581A
Authority: AU
Inventors: Xuehan JIANG; Wei Lei; Yi Liu; Lei Qian; Jiaofeng Wang; Shandong Wu; Zhoujie Wu
Original assignee: Hangzhou Zheda Dixun Biological Gene Engineering Co Ltd
Current assignee: Hangzhou Zheda Dixun Biological Gene Engineering Co Ltd
Priority date: 2021-08-04
Filing date: 2021-08-23
Publication date: 2021-11-11
Anticipated expiration: 2029-08-23
Also published as: CN113564245A; NL2030976B1; ZA202200487B; NL2030976A

Abstract

OF THE DISCLOSURE The present disclosure relates to a primer probe set and a kit for reverse transcription-polymerase chain reaction (RT-PCR) detection of a human leukotriene receptor CYSLTR1 mRNA, belonging to the technical field of biological detection. In the present disclosure, the primer probe set includes a primer CysLTR1-F, a primer CysLTR1-R and a probe Cl-Probe; where the primer CysLTR1-F has a nucleotide sequence shown in SEQ ID NO. 1, the primer CysLTR1-R has a nucleotide sequence shown in SEQ ID NO.2, and the probe Cl-Probe has a nucleotide sequence shown in SEQ ID NO.3. The primer probe set of TaqMan real-time fluorescence quantitative one-step RT-PCR detection is established for a human CysLTR1, and the primer probe set provides a detection method with high accuracy, wide detection range and high sensitivity for the CysLTR1 protein.

Description

PRIMER PROBE SET AND KIT FOR RT-PCR DETECTION OF HUMAN LEUKOTRIENE RECEPTOR CYSLTR1 MRNA

TECHNICAL FIELD

[01] The present disclosure belongs to the technical field of biological detection, and specifically relates to a primer probe set and a kit for reverse transcription-polymerase chain reaction (RT-PCR) detection of a human leukotriene receptor CYSLTR1 mRNA.

BACKGROUNDART

[02] Leukotriene is an unsaturated eicosanoic acid with a conjugated triene structure isolated from the metabolites of an arachidonic acid in leukocytes. The leukotriene can be prepared by the arachidonic acid through catalyzation of a lipoxygenase. Although there is a low content of leukotriene in human body, the leukotriene show very high physiological activity and serves as a chemical mediator that triggers certain allergic reactions, inflammations and cardiovascular diseases. The leukotriene is important in inflammations of the upper and lower respiratory tract. The leukotriene is over 1,000 times stronger than histamine in inducing nasal allergic reactions. The amount of leukotrienes increases significantly in both an immediate reaction stage and a late reaction stage in allergen-induced nasal allergic reactions. Cysteinyl leukotrienes (CysLTs) are inflammatory mediators and regulators in the pathophysiology of asthma and allergic rhinitis (AR), and are key therapeutic targets. The CysLTs can regulate the production of hematopoietic progenitor cells, the recruitment and survival of eosinophils in inflammatory tissues, the activity of cytokines and chemokines, the amount of exhaled NO, the contraction of smooth muscle and the proliferation of fibroblasts.

[03] The biological function of CysLTs depends on the expression of leukotriene receptors on the cell surface. A CysLTs receptor includes a CysLTR1 and a CysLTR2, where the CysLTR1 is a G protein-coupled receptor that is mainly expressed in the spleen, lung, smooth muscle and the like. After being activated by leukotrienes, the CysLTR1 mediates continuous contraction and proliferation of smooth muscle cells, mucosal edema, eosinophil accumulation, and increased mucus secretion, thereby directly leading to the occurrence and development of airway inflammation in the asthma. The CysLTR1 plays a major role in the pathogenesis of asthma. Approved CysLT1 receptor antagonists (such as montelukast, zafirlukast, and pranlukast) act on the CysLTR1 to block the asthma-causing effect. During treatment, leukotriene receptor antagonists (LTRA) can competitively inhibit the binding of leukotrienes to their receptors in the body, and block the activity of CysLTs, thereby inhibiting inflammatory and allergic reactions. However, the curative effect of the LTRA has obvious individual differences, and has a clear positive correlation with the expression level of a leukotriene receptor gene mRNA. By detecting the expression level of

CYSLTR1 mRNA, whether the LTRA has blocked the activity of the CysLTR1 can be determined. This has a certain therapeutic significance for whether the medicine is effective in treating allergic and inflammatory reactions caused by the CysLTR1 pathway.

[04] At present, the detection of the content of CysLTR1 in the body fluids is still detected using an enzyme-linked immunosorbent assay (ELISA) kit. There is no commercial kit for detecting the CYSLTR1 mRNA. The ELISA method has the problems of small detection range, low sensitivity and unsatisfactory accuracy during the detection.

SUMMARY

[05] The purpose of the present disclosure is to provide a primer probe set and a kit for RT-PCR detection of a human leukotriene receptor CYSLTR1 mRNA. The primer probe set of TaqMan real-time fluorescence quantitative one-step RT-PCR detection is established for a human CysLTR1, and the primer probe set provides a detection method with high accuracy, wide detection range and high sensitivity for the CysLTR1 protein.

[06] The present disclosure provides a primer probe set for RT-PCR detection of a human leukotriene receptor CYSLTR1 mRNA, including a primer CysLTR1-F, a primer CysLTR1-R and a probe Cl-Probe, where the primer CysLTR1-F has a nucleotide sequence shown in SEQ ID NO. 1, the primer CysLTR1-R has a nucleotide sequence shown in SEQ ID NO.2, and the probe C-Probe has a nucleotide sequence shown in SEQ ID NO.3.

[07] Preferably, a 5'-end of the probe C-Probe may be labeled with a fluorescent reporter group, and a 3'-end of the probe C-Probe may be labeled with a quenching group.

[08] Preferably, the primer probe set may further include a primer GAPDH-F, a primer GAPDH-R and a probe G-Probe of a reference gene, where the primer GAPDH-F may have a nucleotide sequence shown in SEQ ID NO.4, the primer GAPDH-R may have a nucleotide sequence shown in SEQ ID NO.5, and the probe G-Probe may have a nucleotide sequence shown in SEQ ID NO.6.

[09] Preferably, a 5'-end of the probe G-Probe may be labeled with a fluorescent reporter group, and a 3'-end of the probe G-Probe may be labeled with a quenching group; and the fluorescent reporter group labeled on the probe G-Probe may be different from the fluorescent reporter group labeled on the probe C-Probe.

[10] Preferably, the fluorescent reporter group may include a 6-carboxyfluorescein (FAM) and a 2,7-dimethyl-4,5-dichloro-6-carboxyfluorescein (JOE), and the quenching group may include a Black Hole Quencher-l (BHQ1).

[11] The present disclosure further provides a kit for RT-PCR detection of a human leukotriene receptor CYSLTR1 mRNA, including the primer probe set, a PCR reaction solution, an enzyme mixed solution, a CysLTR1 standard, a carboxy-X-rhodamine (ROX) reference dye and nuclease-free water.

[12] Preferably, the PCR reaction solution may include a deoxy-ribonucleoside triphosphate (dNTP) mix, MgCl2 and a buffer.

[13] Preferably, the enzyme mixed solution may include a thermus aquaticus (Taq) enzyme, a reverse transcriptase, a ribonuclease (RNase) inhibitor and a Taq enzyme antibody.

[14] The present disclosure further provides a method for using the kit, including the following steps: mixing the primer probe set, the PCR reaction solution, the enzyme mixed solution, the CysLTR1 standard or a CysLTR1 sample to be tested, the ROX reference dye and the nuclease-free water, and conducting fluorescence quantitative amplification.

[15] Preferably, based on 20 pL, a reaction system of the kit may include: 2 pL of the primer probe set, 10 pL of the PCR reaction solution, 0.5 pL of the enzyme mixed solution, 0.1 L of the ROX reference dye, 5 L of the CysLTR1 standard or the CysLTR1 sample to be tested, and 2.4 L of the nuclease-free water; and

[16] the fluorescence quantitative amplification may be conducted by: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 s, for 40 cycles.

[17] The present disclosure provides a primer probe set for RT-PCR detection of a human leukotriene receptor CYSLTR1 mRNA. In the present disclosure, a one-step detection is conducted based on the primer probe set without separate reverse transcription, which greatly reduces the risk of causing aerosol pollution. Compared with immunological detection methods, the detection method using the primer probe set of the present disclosure has high sensitivity, can detect low-concentration (10 copies/L) clinical samples, can sensitively detect changes in CysLTR1 content, and has a detection range spanning at least 5 orders of magnitude. Accordingly, the accuracy of the detection results is increased, such that the treatment effect can be dynamically monitored and evaluated in an earlier, more accurate, and faster manner.

BRIEF DESCRIPTION OF THE DRAWINGS

[18] FIG. 1 is a process diagram of a dilution operation provided by the present disclosure.

[19] FIG. 2 is a standard curve of a TaqMan real-time fluorescence quantitative RT-PCR for CYSLTR1 mRNA provided by the present disclosure.

[20] FIG. 3 is a result of a precision detection provided by the present disclosure. Herein, 1: 1.0x107 copies/4L, and 2: 1.0x104 copies/L.

[21] FIG. 4 is a result of an accuracy detection provided by the present disclosure.

[22] FIG. 5 is a result of a sensitivity detection provided by the present disclosure.

[23] FIG. 6 is a result of a clinical sample detection provided by the present disclosure. Herein, 1: patient GAPDH mRNA; 2: healthy control GAPDH mRNA; 3: patient CYSLTR1 mRNA; and 4: healthy control CYSLTR1 mRNA.

[24] FIG 7 is a low-precision amplification curve in the case of an unreasonable primer design provided by the present disclosure.

[25] FIG. 8 is an amplification result of an enzyme mixed solution (A) with the non-optimal ratio and an enzyme mixed solution (B) with the optimal ratio provided by the present disclosure.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[26] The present disclosure provides a primer probe set for RT-PCR detection of a human leukotriene receptor CYSLTR1 mRNA, including a primer CysLTR1-F, a primer CysLTR1-R and a probe Cl-Probe, where the primer CysLTR1-F has a nucleotide sequence shown in SEQ ID NO. 1: '- AACCTATCACAAGAAGTCAGC-3', the primer CysLTR1-R has a nucleotide sequence shown in SEQ ID NO.2: 5'- CCAAAGAGCCAAATGCCTTT-3', and the probe Cl-Probe has a nucleotide sequence shown in SEQ ID NO.3: 5'-CACTGCCTCTCCGTGTGGTC-3'.

[27] In the present disclosure, a 5'-end of the probe C-Probe is labeled with a fluorescent reporter group, and a 3'-end of the probe C-Probe is labeled with a quenching group. The fluorescent reporter group preferably includes an FAM or a JOE, and the quenching group preferably includes a BHQ. A 5'-end of the probe C-Probe is labeled with an FAM fluorescent reporter group, and a 3'-end of the probe C-Probe is labeled with a BHQ quenching group.

[28] In the present disclosure, the primer probe set further includes a primer GAPDH-F, a primer GAPDH-R and a probe G-Probe of a reference gene, where the primer GAPDH-F may have a nucleotide sequence shown in SEQ ID NO.4: 5'-GACAACAGCCTCAAGATCATC-3', the primer GAPDH-R may have a nucleotide sequence shown in SEQ ID NO.5: '-CGCCACAGTTTCCCGGAG-3', and the probe G-Probe may have a nucleotide sequence shown in SEQ ID NO.6: 5'-ACTCATGACCACAGTCCATGCCAT-3'. A 5'-end of the probe G-Probe is labeled with a fluorescent reporter group, and a 3'-end of the probe G-Probe is labeled with a quenching group; and the fluorescent reporter group labeled on the probe G-Probe is preferably different from the fluorescent reporter group labeled on the probe C-Probe. The fluorescent reporter group preferably includes the FAM or the JOE, and the quenching group preferably includes the BHQ1. In an example, a 5'-end of the probe G-Probe is labeled with a JOE fluorescent reporter group, and a 3'-end of the probe G-Probe is labeled with a BHQ quenching group.

[29] The present disclosure further provides a kit for RT-PCR detection of a human leukotriene receptor CYSLTR1 mRNA, including the primer probe set, a PCR reaction solution, an enzyme mixed solution, a CysLTR1 standard, an ROX reference dye and nuclease-free water.

[30] In the present disclosure, the PCR reaction solution includes a deoxy-ribonucleoside triphosphate (dNTP) mix, MgCl2 and a buffer; the dNTP mix includes a dATP, a dCTP, a dGTP and a dTTP; and the dNTP mix is preferably purchased from Thermo Fisher Scientific (product number: R0192), and has a working concentration of preferably 0.3-0.8 mM. The MgCl2 has a concentration of preferably 5-12 mM during using; and the buffer is preferably a Tris-HCl buffer, more preferably a 20-50 mM Tris-HCl buffer with a pH of preferably 8.0.

[31] In the present disclosure, the enzyme mixed solution includes a Taq enzyme, a reverse transcriptase, an RNase inhibitor and a Taq enzyme antibody with a volume ratio of preferably :5:3:1 to obtain the optimal amplification effect. The Taq enzyme is a heat-resistant Taq DNA polymerase, deoxynucleotides in the dNTP are added to a 3-OH terminus one by one using the 3'--5' polymerase activity of the Taq enzyme and using DNA as a template. Meanwhile, mismatched primer ends can be identified and eliminated using the 5'--3' exonuclease activity of the Taq enzyme, which is related to the correction function during the replication, nucleotides can also be hydrolyzed from the 5'-end and mismatched nucleotides can also be excised through several nucleotides. In this way, the chain replacement is realized during the chain extension, and the replaced probe is cut off. The reverse transcriptase can reverse transcribe an mRNA into a cDNA for PCR reaction. The RNase inhibitor is used to suppress the activity of an exogenous RNase. The Taq enzyme antibody is an anti-Taq antibody for hot-start PCR, inhibits DNA polymerase activity after binding to the Taq enzyme, and can effectively suppress the non-specific annealing of primers and the non-specific amplification caused by primer dimers under low temperature. The Taq enzyme antibody is denatured during the initial DNA denaturation of the PCR reaction, and the Taq enzyme recovers the activity to realize PCR amplification. The CysLTR1 standard is preferably a RNA standard of the CysLTR1 for preparing a quantitative curve.

[32] The present disclosure further provides a method for using the kit, including the following steps: mixing the primer probe set, the PCR reaction solution, the enzyme mixed solution, the CysLTR1 standard or a CysLTR1 sample to be tested, the ROX reference dye and the nuclease-free water, and conducting fluorescence quantitative amplification. In the present disclosure, the kit adopts a quantitative detection method of one-step RT-PCR technology, which can detect an expression level of the CYSLTR1 mRNA in human blood.

[33] In the present disclosure, based on 20 pL, a reaction system of the kit includes: 2 pL of the primer probe set, 10 pL of the PCR reaction solution, 0.5 pL of the enzyme mixed solution, 0.1 L of the ROX reference dye, 5 L of the CysLTR1 standard or the CysLTR1 sample to be tested, and 2.4 L of the nuclease-free water. The fluorescence quantitative amplification is preferably conducted by: 42°C for 30 min (reverse transcription); 95°C for 1 min (pre-denaturation); 95°C for s, and 60°C for 31 s, for 40 cycles.

[34] In the present disclosure, the kit has a simple operation and short detection time. The present disclosure provides a kit product that can guide the medication and accurately quantify the efficacy for CysLTR1 receptor antagonists. Cysteinyl leukotrienes (CysLTs) are inflammatory mediators and regulators in the pathophysiology of asthma and allergic rhinitis (AR), and are key therapeutic targets. During treatment, leukotriene receptor CysLTR1 antagonists can reduce allergic inflammations by blocking the activity of CysLTR1, and produce broad clinical effects. The expression of the leukotriene receptor CYSLTR1 mRNA is detected to be higher than the normal reference range, indicating that the treatment on patients will be effective with a leukotriene receptor CysLTR1 antagonist; and the level of CysLTR1 in the blood is detected to be lowered after treatment, indicating that the treatment is effective. If obvious allergic symptoms are shown, but the expression of leukotriene receptor CysLTR1 is very low; this indicates that the allergic symptoms are not caused by leukotriene pathway, and the treatment with leukotriene receptor CysLTR1 antagonist is invalid.

[35] The primer probe set and the kit for RT-PCR detection of a human leukotriene receptor CYSLTR1 mRNA according to the present disclosure will be further described in detail below with reference to specific examples. The technical solutions of the present disclosure include, but are not limited to, the following examples.

[36] Unless otherwise specified, the experimental methods described in the following examples are all conventional methods. The methods shall be conducted in accordance with the techniques or conditions described in the literature in the art or in accordance with the product specification. The materials and reagents and the like used in the following examples are all commercially available, unless otherwise specified.

[37] Example 1

[38] 1. The reagents and equipment involved were as follows:

[39] 1.1 Reagents

[40] 1.1.1 A whole-blood total RNA kit (Hangzhou Simgen Biological Reagent Development Co., Ltd., product number: 5201050).

[41] 1.1.2 A HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, product number: E2040S).

[42] 1.2 Main instruments

[43] 1.2.1 An Applied Biosystems T M 7300 fluorescence quantitative PCR instrument (Thermo Fisher Scientific, USA).

[44] 1.2.2 A -80°C low-temperature refrigerator (Thermo Fisher Scientific, USA).

[45] 1.2.3 A high-speed and low-temperature table centrifuge (Eppendorf, Germany).

[46] 1.2.4 A Qubit 3 fluorometer (Thermo Fisher Scientific, USA).

[47] 2. Method

[48] 2.1 Design of primers and probes

[49] Fluorescent quantitative primers and probes were designed using a Primer 6.0 software according to the sequence of a CysLTR1 and a GAPDH; after a series of effect verification, primer pairs CysLTR1-F, CysLTR1-R, GAPDH-F, and GAPDH-R and probes E-Probe, and G-Probe of the CysLTR1 and the GAPDH were obtained (Table 1). The primers and probes were synthesized by

Shanghai Sunny Biotechnology Co., Ltd.

[50] Table 1 TaqMan real-time fluorescence quantitative PCR of primers and probes Nameof Amplified primers and Use Primer sequence (5'->3') (SEQ ID NO.) fragment size probes CysLTR1-F Fluorescence AACCTATCACAAGAAGTCAGC (1) CysLTRI-R quantitative CCAAAGAGCCAAATGCCTTT (2) amplification of 126 bp Cl-Probe CYSLTR1 cDNA (FAM)-CACTGCCTCTCCGTGTGGTC (3)-(BHQ1) fragment

GAPDH-F Fluorescence GACAACAGCCTCAAGATCATC (4) GAPDH-R quantitative CGCCACAGTTTCCCGGAG (5) amplification of 70 bp (JOE)-ACTCATGACCACAGTCCATGCCAT G-Probe reference gene (6)-(BHQ1) GAPDH fragment

[51] 2.2. Preparation of a standard

[52] In-vitro transcription: a pGM-T ligation kit [TIANGEN Biotech (Beijing) Co., Ltd., product number: VT202-01] was used, a CysLTR1 plasmid DNA (constructed and synthesized by entrusting Nanjing GenScript Biotech Co., Ltd.) was constructed using a pGM-T as a vector, and the CysLTR1 plasmid DNA was transcribed into an mRNA in vitro using a HiScribe T7 High Yield RNA Synthesis Kit (NEW ENGLAND BioLabs, product number: E2040S).

[53] An initial copy number of RNA was calculated according to a copy number calculation formula: copy number=[6.02x1023xRNA concentration (ng/4L)x10-9]/[RNA length (bp)x340]. The CYSLTR1 mRNA was diluted with nuclease-free water to 1.Ox101 copies/4L to obtain a CYSLTR1 mRNA standard.

[54] 2.3. Extraction and dilution of a whole-blood RNA: the whole-blood total RNA was extracted from ethylenediaminetetraacetic acid (EDTA) anticoagulated whole-blood samples with the whole-blood total RNA kit, quantificated with the Qubit 3 fluorometer and diluted with the nuclease-free water to 20 ng/L.

[55] 2.4 TaqMan real-time fluorescent quantitative PCR

[56] A 20 pL of system was prepared using the CYSLTR1 mRNA standard or the whole blood RNA as a template, the system was shown in Table 2:

[57] Table 2 Reaction system PCR Enzyme ROX CYSLTR1 mRNA Nuclease-free Primer-probe Total reaction mixed reference Standard or water mixed solution volume solution solution dye whole-blood RNA

2.4 pL 10 pL 0.5 pL 0.1 tL 2 tL 5 tL 20 pL

[58] An amplification reaction program was shown in Table 3:

[59] Table 3 Reaction program Stage Temperature Time Number of cycles Other parameter settings Stage 1 42 0 C 30 min 1 Detection fluorescein: FAM, JOE Stage 2 95 0 C 1 min 1 Reference fluorescence: ROX 95 0 C 5 sec Reaction system: 20 pL 0 Stage 3 40 Fluorescence signal collection: Stage 3, 60 C for 60 0 C 31sec 31sec

[60] 2.5 Generation of a standard curve

[61] The CYSLTR1 mRNA standard was diluted in a 10-fold gradient using1.0x108-1.0x103 copies/pL as a template, 3 replicates were conducted for each dilution, and TaqMan real-time fluorescence quantitative RT-PCR detection was conducted to generate a standard curve. The dilution operation was shown in FIG. 1. A 50 pL/tube was taken as an example: for each dilution, 5 L of a sample before dilution was added to a new tube containing 45 L of water.

[62] 2.6 Precision detection

[63] 1.0x107 copies/pL and 1.0x104 copies/pL of CYSLTR1 mRNA standards were taken as a template, 10 replicates were conducted for each concentration; 10 times of TaqMan real-time fluorescent quantitative RT-PCR detections were conducted, the coefficient of variation of the logarithm of each concentration was calculated, respectively; and statistical analysis was conducted to analyze the precision of the detection method.

[64] 2.7 Accuracy detection

[65] A 1.0x106 copies/pL of CYSLTR1 mRNA standard was subjected to 30-fold dilution (2 pL 1.0x10 6 copies/pL of a CYSLTR1 mRNA standard + 58 pL of nuclease-free water) as a template, for 3 replicates; 3 times of TaqMan real-time fluorescence quantitative RT-PCR detections were conducted, and the accuracy of the detection method was analyzed.

[66] 2.8 Sensitivity detection

[67] A 10.0 copies/pL of CYSLTR1 mRNA standard was taken as a template, for 25 replicates, times of TaqMan real-time fluorescence quantitative RT-PCR detection were conducted to check whether there were amplifications, and the sensitivity of the detection method was analyzed.

[68] 2.9 Clinical sample detection

[69] Whole-blood samples of positive samples and healthy control were taken to extract and dilute whole-blood RNA according to the steps of 2.3; TaqMan real-time fluorescent quantitative RT-PCR detection was conducted according to the steps of 2.4.

[70] 3. Experimental results

[71] 3.1 Standard curve

[72] The CYSLTR1 mRNA standard was diluted in a 10-fold gradient using 1.x1O8-1.x13 copies/pL as a template, 3 replicates were conducted for each dilution, and TaqMan real-time fluorescence quantitative RT-PCR detection was conducted to generate a standard curve. The standard curve of the TaqMan real-time fluorescence quantitative RT-PCR of the CYSLTR1 mRNA is shown in FIG. 2. A copy number logarithm was taken as an abscissa and a Ct value is taken as an ordinate, and a regression equation was obtained: y=-3.398x+35.344 (R 2 =1.000), where the regression equation has R2 =1.000, and a linear range of 1.0x10 3 -1.0x10 8 copies/pL. It indicates that the copy number logarithm of the standard equation has a very high correlation with the Ct value.

[73] 3.2 Precision detection

[74] 1.Ox107 copies/pL and 1.Ox104 copies/pL of CYSLTR1 mRNA standards were taken as templates, 10 replicates were conducted for each concentration; 10 times of TaqMan real-time fluorescent quantitative RT-PCR detections were conducted, the coefficient of variation of the logarithm of each concentration was calculated, respectively; and statistical analysis was conducted. The results are shown in FIG. 3 and Table 4. The coefficient of variation of the logarithm of each concentration is 0.320% and 0.444% separately, which are less than 5%, indicating that the TaqMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has excellent precision.

[75] Table 4 Precision detection result Theoretical copy number Mean of copy number logarithm SD C.V 1.Ox107 7.042 0.023 0.320% 1.Ox104 3.996 0.018 0.444%

[76] 3.3 Accuracy detection

[77] A 1.Ox106 copies/pL CYSLTR1 mRNA standard was subjected to 30-time dilution (2 pL 1.0x10 6 copies/pL of a CYSLTR1 mRNA standard + 58 pL of nuclease-free water) as a template, for 3 replicates; 3 times of TaqMan real-time fluorescence quantitative RT-PCR detections were conducted, and the absolute deviation of the logarithm of each concentration was calculated. The results are shown in FIG. 4 and Table 5. The absolute deviation of the logarithm of each concentration is 0.002, 0.011, and 0.008, respectively, within the range of 0.5, indicating that the TaqMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has excellent accuracy.

[78] Table 5 Accuracy detection result Results Copy number Theoretical copy Theoretical copy number Absolute CT (copies/ptL) logarithm number (copies/ptL) logarithm deviation 19.967 3.347x104 4.525 0.002 3.333x104 4.523 19.935 3.422x104 4.534 _________ _ ___________ 0.011

19.946 3.395x104 4.531 0.008

[79] 3.4 Sensitivity detection

[80] A 10.0 copies/pL of CYSLTR1 mRNA standard was taken as a template, for 25 replicates, times of TaqMan real-time fluorescence quantitative RT-PCR detection were conducted to check whether there were amplifications. The results are shown in FIG. 5 and Table 6. A total of 25 detection results are obtained, reaching 100%. This indicates that the TaqMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has very high sensitivity, and the minimum of detected copy number is less than 10 copies/pL.

[81] Table 6 Ct value result of sensitivity detection 33.271 33.123 33.228 32.975 33.800

33.150 33.284 32.547 33.408 33.416

33.270 33.216 34.086 32.939 32.709

33.312 33.788 33.070 33.653 32.923

32.789 33.700 33.624 33.562 32.810

[82] 3.5 Clinical sample detection

[83] A comparison result of the present disclosure and a certain domestic brand of cysteinyl leukotriene receptor 1 (CYSLTR1) kit of enzyme-linked immunosorbent assay (ELISA) are shown in FIG. 6 and Table 7.

[84] Table 7 Comparison result Product of the present CYSLTRI kit of ELISA disclosure SN Sample type Results Results positive/negative positive/negative (copies/ptL) (ng/mL) 1 Sample 1 before treatment 1589.924 + 232.6 +

2 Sample 1 after treatment 87.802 - 52.4

3 Sample 2 before treatment 2432.674 + 353.8 +

4 Sample 2 after treatment 341.476 - 155.7 +

5 Sample 3 before treatment 1543.690 + 274.2 +

6 Sample 3 after treatment 96.472 - 80.7

7 Positive sample 4 3434.793 + 612.3 +

8 Healthy control 4 38.530 - 72.4

9 Healthy control 5 123.466 - 176.7 +

10 Healthy control 6 67.019 - 49.9

[85] In the present disclosure, the detection was conducted using the whole-blood RNA; and the certain domestic brand of CYSLTR1 kit of ELISA was detected using a serum.

[86] Comparative Example 1

[87] Results of amplification using other non-optimal primers and probes

[88] The primers and probes in the system used in the present disclosure were replaced with other non-optimal primers and probes. An amplification system and a program were the same as those in Example 1. The results are shown in FIG. 7 and Table 8. When non-optimal CysLTR1 primers and probes are used, such as:

[89] CysLTR1-F: GTATCTTCTGCCACATGCC (SEQ ID NO. 7);

[90] CysLTR1-R:TTGCCAAAGAAGCCTACAACA(SEQIDNO. 8); and

[91] Cl-Probe: (FAM)-CCGCAATCAAGTGTATTCCACC (SEQ ID NO. 9)-(BHQ1).

[92] The coefficient of variation of the logarithm of the low-precision concentration exceeds 5%, reaching 8.813%.

[93] Table 8 Results of amplification with non-optimal primers and probes Theoretical copy number Mean of copy number logarithm SD C.V 1.Ox104 3.637 0.321 8.813%

[94] Comparative Example 2

[95] Amplification result of non-optimal enzyme mixed solution

[96] An amplification was conducted using a non-optimal ratio of enzyme mixed solution (the Taq enzyme, reverse transcriptase, RNase inhibitor and Taq enzyme antibody had a mass ratio of 14:4:5:1) and an optimal ratio of enzyme mixed solution on the CYSLTR1 mRNA standard with the primers and probes, the amplification system, and the program the same as those in Example 1. 4 gradients 1.Oxi03-1.Ox106 copies/pL of a standard curve were obtained, and the result is shown in FIG. 8. An amplification result using the non-optimal ratio of enzyme mixed solution is shown in FIG. 8A, and an amplification result using the optimal ratio of enzyme mixed solution is shown in FIG. 8B. In a comparison, a standard curve of the amplification result using the optimal enzyme mixed solution has better repeatability, and has Ct differences between adjacent concentrations of 3.3, 3.3, and 3.4, respectively; meanwhile, a standard curve of the amplification result using the non-optimal enzyme mixed solution has Ct differences between adjacent concentrations of 3.8, 3.1, and 3.6, respectively. It indicates that the Ct difference of the standard curve of the amplification result using the optimal enzyme mixed solution is more uniform. It can be seen that the optimal enzyme mixed solution has better amplification effect.

[97] The above results show that the TaqMan real-time fluorescent quantitative RT-PCR detection method established in the present disclosure has better sensitivity and specificity than that of a counterpart reagent, and can effectively monitor the treatment effect.

[98] The above descriptions are merely preferred implementations of the present disclosure. It should be noted that a person of ordinary skill in the art may further make several improvements and modifications without departing from the principle of the present disclosure, but such improvements and modifications should be deemed as falling within the protection scope of the present disclosure.

[99] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[100] The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

Claims

WHAT IS CLAIMED IS:

1. A kit for reverse transcription-polymerase chain reaction (RT-PCR) detection of a human leukotriene receptor CYSLTR1 mRNA, comprising a primer probe set for RT-PCR detection of a human leukotriene receptor CYSLTR1 mRNA, a PCR reaction solution, an enzyme mixed solution, a CysLTR1 standard, a carboxy-X-rhodamine (ROX) reference dye and nuclease-free water; wherein the primer probe set comprises a primer CysLTR1-F, a primer CysLTR1-R and a probe Cl-Probe, wherein the primer CysLTR1-F has a nucleotide sequence shown in SEQ ID NO. 1, the primer CysLTR1-R has a nucleotide sequence shown in SEQ ID NO.2, and the probe C-Probe has a nucleotide sequence shown in SEQ ID NO.3the primer CysLTR1-F has a nucleotide sequence shown in SEQ ID NO. 1, the primer CysLTR1-R has a nucleotide sequence shown in SEQ ID NO.2, and the probe Cl-Probe has a nucleotide sequence shown in SEQ ID NO.3; a 5'-end of the probe C-Probe is labeled with a fluorescent reporter group, and a 3'-end of the probe Cl-Probe is labeled with a quenching group; the primer probe set further comprises a primer GAPDH-F, a primer GAPDH-R and a probe G-Probe of a reference gene, wherein the primer GAPDH-F has a nucleotide sequence shown in SEQ ID NO.4, the primer GAPDH-R has a nucleotide sequence shown in SEQ ID NO.5, and the probe G-Probe has a nucleotide sequence shown in SEQ ID NO. 6; a 5'-end of the probe G-Probe is labeled with a fluorescent reporter group, and a 3'-end of the probe G-Probe is labeled with a quenching group; and the fluorescent reporter group labeled on the probe G-Probe is different from the fluorescent reporter group labeled on the probe Cl-Probe; and the fluorescent reporter group comprises a 6-carboxyfluorescein (FAM) or a 2,7-dimethyl-4,5-dichloro-6-carboxyfluorescein (JOE), and the quenching group comprises a Black Hole Quencher-1 (BHQ1).

2. The kit according to claim 1, wherein the PCR reaction solution comprises a deoxy-ribonucleoside triphosphate (dNTP) mix, MgCl2 and a buffer.

3. The kit according to claim 1, wherein the enzyme mixed solution comprises a thermus aquaticus (Taq) enzyme, a reverse transcriptase, a ribonuclease (RNase) inhibitor and a Taq enzyme antibody.

4. A method for using the kit according to claim 1, 2 or 3, comprising the following steps: mixing the primer probe set, the PCR reaction solution, the enzyme mixed solution, the CysLTR1 standard or a CysLTR1 sample to be tested, the ROX reference dye and the nuclease-free water, and conducting fluorescence quantitative amplification.

5. The method according to claim 4, wherein based on 20 pL, a reaction system of the kit comprises: 2 pL of the primer probe set, 10 pL of the PCR reaction solution, 0.5 pL of the enzyme mixed solution, 0.1 L of the ROX reference dye, 5 L of the CysLTR standard or the CysLTR sample to be tested, and 2.4 L of the nuclease-free water; and the fluorescence quantitative amplification is conducted by: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 s, for cycles.