NL2030976A - Primer probe set and kit for rt-pcr detection of human leukotriene receptor cysltr1 mrna - Google Patents
Primer probe set and kit for rt-pcr detection of human leukotriene receptor cysltr1 mrna Download PDFInfo
- Publication number
- NL2030976A NL2030976A NL2030976A NL2030976A NL2030976A NL 2030976 A NL2030976 A NL 2030976A NL 2030976 A NL2030976 A NL 2030976A NL 2030976 A NL2030976 A NL 2030976A NL 2030976 A NL2030976 A NL 2030976A
- Authority
- NL
- Netherlands
- Prior art keywords
- probe
- primer
- cysltr1
- kit
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present disclosure relates to a primer probe set and a kit for reverse transcription—polymerase chain reaction (RT—PCR) detection of a human leukotriene receptor CYSLTRI mRNA, belonging to the technical field of biological detection. In the present disclosure, the primer probe set includes a primer CysLTRl—F, a primer CysLTRl—R and a probe Cl—Probe; where the primer CysLTRl—F has a nucleotide sequence shown in SEQ ID NO. l, the primer CysLTRl—R has a nucleotide sequence shown in SEQ ID NO.2, and the probe Cl—Probe has a nucleotide sequence shown in SEQ ID No.3. The primer probe set of TagMan real—time fluorescence quantitative one—step RT—PCR detection is established for a human CysLTRl, and the primer probe set provides a detection method with high accuracy, wide detection range and high sensitivity for the CysLTRl protein.
Description
PRIMER PROBE SET AND KIT FOR RT-PCR DETECTION OF HUMAN LEUKOTRIENE
RECEPTOR CYSLTRI MRNA
The present disclosure belongs to the technical field of bio- logical detection, and specifically relates to a primer probe set and a kit for reverse transcription-polymerase chain reaction (RT-
PCR) detection of a human leukotriene receptor CYSLTRI mRNA.
Leukotriene is an unsaturated eicosanoic acid with a conju- gated triene structure isolated from the metabolites of an arachi- donic acid in leukocytes. The leukotriene can be prepared by the arachidonic acid through catalyzation of a lipoxygenase. Although there is a low content of leukotriene in human body, the leukotri- ene show very high physiological activity and serves as a chemical mediator that triggers certain allergic reactions, inflammations and cardiovascular diseases. The leukotriene is important in in- flammations of the upper and lower respiratory tract. The leuko- triene is over 1,000 times stronger than histamine in inducing na- sal allergic reactions. The amount of leukotrienes increases sig- nificantly in both an immediate reaction stage and a late reaction stage in allergen-induced nasal allergic reactions. Cysteinyl leu- kotrienes (CysLTs) are inflammatory mediators and regulators in the pathophysiology of asthma and allergic rhinitis (AR), and are key therapeutic targets. The CysLTs can regulate the production of hematopoietic progenitor cells, the recruitment and survival of eosinophils in inflammatory tissues, the activity of cytokines and chemokines, the amount of exhaled NO, the contraction of smooth muscle and the proliferation of fibroblasts.
The biological function of CysLTs depends on the expression of leukotriene receptors on the cell surface. A CysLTs receptor includes a CysLTR1 and a CysLTR2, where the CysLTR1l is a G pro- tein-coupled receptor that is mainly expressed in the spleen, lung, smooth muscle and the like. After being activated by leuko-
trienes, the CysLTR1l mediates continuous contraction and prolifer- ation of smooth muscle cells, mucosal edema, eosinophil accumula- tion, and increased mucus secretion, thereby directly leading to the occurrence and development of airway inflammation in the asth- ma. The CysLTR1 plays a major role in the pathogenesis of asthma.
Approved CysLTl receptor antagonists (such as montelukast, zafir- lukast, and pranlukast) act on the CysLTRl to block the asthma- causing effect. During treatment, leukotriene receptor antagonists (LTRA) can competitively inhibit the binding of leukotrienes to their receptors in the body, and block the activity of CysLTs, thereby inhibiting inflammatory and allergic reactions. However, the curative effect of the LTRA has obvious individual differ- ences, and has a clear positive correlation with the expression level of a leukotriene receptor gene mRNA. By detecting the ex- pression level of CYSLTRI mRNA, whether the LTRA has blocked the activity of the CysLTRl can be determined. This has a certain therapeutic significance for whether the medicine is effective in treating allergic and inflammatory reactions caused by the CysLTR1 pathway.
At present, the detection of the content of CysLTR1 in the body fluids is still detected using an enzyme-linked immunosorbent assay (ELISA) kit. There is no commercial kit for detecting the
CYSLTR1 mRNA. The ELISA method has the problems of small detection range, low sensitivity and unsatisfactory accuracy during the de- tection.
The purpose of the present disclosure is to provide a primer probe set and a kit for RT-PCR detection of a human leukotriene receptor CYSLTRI mRNA. The primer probe set of TagMan real-time fluorescence quantitative one-step RT-PCR detection is established for a human CysLTR1, and the primer probe set provides a detection method with high accuracy, wide detection range and high sensitiv- ity for the CysLTR1 protein.
The present disclosure provides a primer probe set for RT-PCR detection of a human leukotriene receptor CYSLTRI mRNA, including a primer CysLTR1-F, a primer CysLTRI-R and a probe Cl-Probe, where the primer CysLTR1-F has a nucleotide sequence shown in SEQ ID NO. 1, the primer CysLTRI1-R has a nucleotide sequence shown in SEQ ID
NO.2, and the probe Cl-Probe has a nucleotide sequence shown in
SEQ ID NO.3.
Preferably, a 5'-end of the probe Cl-Probe may be labeled with a fluorescent reporter group, and a 3'-end of the probe Cl-
Probe may be labeled with a guenching group.
Preferably, the primer probe set may further include a primer
GAPDH-F, a primer GAPDH-R and a probe G-Probe of a reference gene, where the primer GAPDH-F may have a nucleotide sequence shown in
SEQ ID NO.4, the primer GAPDH-R may have a nucleotide sequence shown in SEQ ID NO.5, and the probe G-Probe may have a nucleotide sequence shown in SEQ ID NO.6.
Preferably, a 5'-end of the probe G-Probe may be labeled with a fluorescent reporter group, and a 3'-end of the probe G-Probe may be labeled with a quenching group; and the fluorescent report- er group labeled on the probe G-Probe may be different from the fluorescent reporter group labeled on the probe Cl-Probe.
Preferably, the fluorescent reporter group may include a 6- carboxyfluorescein (FAM) and a 2,7-dimethyl1-4,5-dichloro-6- carboxyfluorescein (JOE), and the guenching group may include a
Black Hole guencher-1 (BHQ1).
The present disclosure further provides a kit for RT-PCR de- tection of a human leukotriene receptor CYSLTRI mRNA, including the primer probe set, a PCR reaction solution, an enzyme mixed so- lution, a CysLTR1 standard, a carboxy-X-rhodamine (ROX) reference dye and nuclease-free water.
Preferably, the PCR reaction solution may include a deoxy- ribonucleoside triphosphate (dNTP) mix, MgCl: and a buffer.
Preferably, the enzyme mixed solution may include a thermus agquaticus (Taq) enzyme, a reverse transcriptase, a ribonuclease (RNase) inhibitor and a Taq enzyme antibody.
The present disclosure further provides a method for using the kit, including the following steps: mixing the primer probe set, the PCR reaction solution, the enzyme mixed solution, the
CysLTR1 standard or a CysLTR1 sample to be tested, the ROX refer- ence dye and the nuclease-free water, and conducting fluorescence quantitative amplification.
Preferably, based on 20 pL, a reaction system of the kit may include: 2 pL of the primer probe set, 10 pL of the PCR reaction solution, 0.5 pL of the enzyme mixed solution, 0.1 pL of the ROX reference dye, 5 pL of the CysLTR1 standard or the CysLTR1l sample to be tested, and 2.4 pL of the nuclease-free water; and the fluorescence quantitative amplification may be conducted by: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 s, for 40 cycles.
The present disclosure provides a primer probe set for RT-PCR detection of a human leukotriene receptor CYSLTRI mRNA. In the present disclosure, a one-step detection is conducted based on the primer probe set without separate reverse transcription, which greatly reduces the risk of causing aerosol pollution. Compared with immunological detection methods, the detection method using the primer probe set of the present disclosure has high sensitivi- ty, can detect low-concentration (10 copies/yuL}) clinical samples, can sensitively detect changes in CysLTR1 content, and has a de- tection range spanning at least 5 orders of magnitude. According- ly, the accuracy of the detection results is increased, such that the treatment effect can be dynamically monitored and evaluated in an earlier, more accurate, and faster manner.
FIG. 1 is a process diagram of a dilution operation provided by the present disclosure.
FIG. 2 is a standard curve of a TaqMan real-time fluorescence quantitative RT-PCR for CYSLTRI mRNA provided by the present dis- closure.
FIG. 3 is a result of a precision detection provided by the present disclosure. Herein, 1: 1.0x107 copies/pL, and 2: 1.0x10° copies/uL.
FIG. 4 is a result of an accuracy detection provided by the present disclosure.
FIG. 5 is a result of a sensitivity detection provided by the present disclosure.
FIG. 6 is a result of a clinical sample detection provided by the present disclosure. Herein, 1: patient GAPDH mRNA; 2: healthy control GAPDH mRNA; 3: patient CYSLTRI mRNA; and 4: healthy con- trol CYSLTRI mRNA.
FIG 7 is a low-precision amplification curve in the case of 5 an unreasonable primer design provided by the present disclosure.
FIG. 8 is an amplification result of an enzyme mixed solution (A) with the non-optimal ratio and an enzyme mixed solution (B) with the optimal ratio provided by the present disclosure.
The present disclosure provides a primer probe set for RT-PCR detection of a human leukotriene receptor CYSLTRI mRNA, including a primer CysLTR1-F, a primer CysLTRI-R and a probe Cl-Probe, where the primer CysLTR1-F has a nucleotide sequence shown in SEQ ID NO. 1: 5'- AACCTATCACAAGAAGTCAGC-3', the primer CysLTR1-R has a nucle- otide sequence shown in SEQ ID NO.2: 5'- CCAAAGAGCCAAATGCCTTT-3%, and the probe Cl-Probe has a nucleotide sequence shown in SEQ ID
NO.3: 5'-CACTGCCTCTCCGTGTGGTC-3".
In the present disclosure, a 5'-end of the probe Cl-Probe is labeled with a fluorescent reporter group, and a 3'-end of the probe Cl-Probe is labeled with a quenching group. The fluorescent reporter group preferably includes an FAM or a JOE, and the quenching group preferably includes a BHQ1. A 5'-end of the probe
Cl-Probe is labeled with an FAM fluorescent reporter group, and a 3'-end of the probe Cl-Probe is labeled with a BHQ1 quenching group.
In the present disclosure, the primer probe set further in- cludes a primer GAPDH-F, a primer GAPDH-R and a probe G-Probe of a reference gene, where the primer GAPDH-F may have a nucleotide se- quence shown in SEQ ID NO.4: 5'-GACAACAGCCTCAAGATCATC-3', the pri- mer GAPDH-R may have a nucleotide sequence shown in SEQ ID NO.5: 5'-CGCCACAGTTTCCCGGAG-3"', and the probe G-Probe may have a nucleo- tide sequence shown in SEQ ID NO.6: 5'-ACTCATGACCACAGTCCATGCCAT- 3'. A 5'-end of the probe G-Probe is labeled with a fluorescent reporter group, and a 3'-end of the probe G-Probe is labeled with a quenching group; and the fluorescent reporter group labeled on the probe G-Probe is preferably different from the fluorescent re-
porter group labeled on the probe Cl-Probe. The fluorescent re- porter group preferably includes the FAM or the JOE, and the quenching group preferably includes the BHQ1. In an example, a 5'- end of the probe G-Probe is labeled with a JOE fluorescent report- er group, and a 3'-end of the probe G-Probe is labeled with a BHQ1 quenching group.
The present disclosure further provides a kit for RT-PCR de- tection of a human leukotriene receptor CYSLTRI mRNA, including the primer probe set, a PCR reaction solution, an enzyme mixed so- lution, a CysLTR1 standard, an ROX reference dye and nuclease-free water.
In the present disclosure, the PCR reaction solution includes a deoxy-ribonucleoside triphosphate (dNTP) mix, MgCl, and a buffer; the dNTP mix includes a dATP, a dCTP, a dGTP and a dTTP; and the dNTP mix is preferably purchased from Thermo Fisher Scientific (product number: R0192), and has a working concentration of pref- erably 0.3~0.8 mM. The MgCl, has a concentration of preferably 5-12 mM during using; and the buffer is preferably a Tris-HCl buffer, more preferably a 20-50 mM Tris-HCl buffer with a pH of preferably 8.0.
In the present disclosure, the enzyme mixed solution includes a Taq enzyme, a reverse transcriptase, an RNase inhibitor and a
Tag enzyme antibody with a volume ratio of preferably 15:5:3:1 to obtain the optimal amplification effect. The Tag enzyme is a heat- resistant Tag DNA polymerase, deoxynucleotides in the dNTP are added to a 3-0H terminus one by one using the 3'55' polymerase ac- tivity of the Taq enzyme and using DNA as a template. Meanwhile, mismatched primer ends can be identified and eliminated using the 553! exonuclease activity of the Tag enzyme, which is related to the correction function during the replication, nucleotides can also be hydrolyzed from the 5'-end and mismatched nucleotides can also be excised through several nucleotides. In this way, the chain replacement is realized during the chain extension, and the replaced probe is cut off. The reverse transcriptase can reverse transcribe an mRNA into a cDNA for PCR reaction. The RNase inhibi- tor is used to suppress the activity of an exogenous RNase. The
Tag enzyme antibody is an anti-Taq antibody for hot-start PCR, in-
hibits DNA polymerase activity after binding to the Taq enzyme, and can effectively suppress the non-specific annealing of primers and the non-specific amplification caused by primer dimers under low temperature. The Taq enzyme antibody is denatured during the initial DNA denaturation of the PCR reaction, and the Tag enzyme recovers the activity to realize PCR amplification. The CysLTR1 standard is preferably a RNA standard of the CysLTR1 for preparing a quantitative curve.
The present disclosure further provides a method for using the kit, including the following steps: mixing the primer probe set, the PCR reaction solution, the enzyme mixed solution, the
CysLTRl standard or a CysLTR1l sample to be tested, the ROX refer- ence dye and the nuclease-free water, and conducting fluorescence quantitative amplification. In the present disclosure, the kit adopts a quantitative detection method of one-step RT-PCR technol- ogy, which can detect an expression level of the CYSLTRI mRNA in human blood.
In the present disclosure, based on 20 pL, a reaction system of the kit includes: 2 pL of the primer probe set, 10 pL of the
PCR reaction solution, 0.5 pL of the enzyme mixed solution, 0.1 pL of the ROX reference dye, 5 uL of the CysLTR1 standard or the Cys-
LTR1 sample to be tested, and 2.4 pul of the nuclease-free water.
The fluorescence quantitative amplification is preferably conduct- ed by: 42°C for 30 min (reverse transcription); 95°C for 1 min (pre-denaturation); 95°C for 5 s, and 60°C for 31 s, for 40 cy- cles.
In the present disclosure, the kit has a simple operation and short detection time. The present disclosure provides a kit prod- uct that can guide the medication and accurately quantify the ef- ficacy for CysLTR1l receptor antagonists. Cysteinyl leukotrienes (CysLTs) are inflammatory mediators and regulators in the patho- physiology of asthma and allergic rhinitis (AR), and are key ther- apeutic targets. During treatment, leukotriene receptor CysLTR1 antagonists can reduce allergic inflammations by blocking the ac- tivity of CysLTR1, and produce broad clinical effects. The expres- sion of the leukotriene receptor CYSLTRI mRNA is detected to be higher than the normal reference range, indicating that the treat-
ment on patients will be effective with a leukotriene receptor
CysLTR1 antagonist; and the level of CysLTR1l in the blood is de- tected to be lowered after treatment, indicating that the treat- ment is effective. If obvious allergic symptoms are shown, but the expression of leukotriene receptor CysLTR1l is very low; this indi- cates that the allergic symptoms are not caused by leukotriene pathway, and the treatment with leukotriene receptor CysLTR1 an- tagonist is invalid.
The primer probe set and the kit for RT-PCR detection of a human leukotriene receptor CYSLTRI mRNA according to the present disclosure will be further described in detail below with refer- ence to specific examples. The technical solutions of the present disclosure include, but are not limited to, the following exam- ples.
Unless otherwise specified, the experimental methods de- scribed in the following examples are all conventional methods.
The methods shall be conducted in accordance with the techniques or conditions described in the literature in the art or in accord- ance with the product specification. The materials and reagents and the like used in the following examples are all commercially available, unless otherwise specified.
Example 1 1. The reagents and equipment involved were as follows: 1.1 Reagents 1.1.1 A whole-blood total RNA kit (Hangzhou Simgen Biological
Reagent Development Co., Ltd., product number: 5201050). 1.1.2 A HiScribe T7 High Yield RNA Synthesis Kit (New England
Biolabs, product number: E20403). 1.2 Main instruments 1.2.1 An Applied Biosystems™ 7300 fluorescence quantitative
PCR instrument (Thermo Fisher Scientific, USA). 1.2.2 A -80°C low-temperature refrigerator (Thermo Fisher
Scientific, USA). 1.2.3 A high-speed and low-temperature table centrifuge (Ep- pendorf, Germany). 1.2.4 A Qubit 3 fluorometer (Thermo Fisher Scientific, USA). 2. Method
2.1 Design of primers and probes
Fluorescent quantitative primers and probes were designed us- ing a Primer 6.0 software according to the sequence of a CysLTR1 and a GAPDH; after a series of effect verification, primer pairs
CysLTR1-F, CysLTR1-R, GAPDH-F, and GAPDH-R and probes E-Probe, and
G-Probe of the CysLTR1l and the GAPDH were obtained (Table 1). The primers and probes were synthesized by Shanghai Sunny Biotechnolo- gy Co., Ltd.
Table 1 TagMan real-time fluorescence quantitative PCR of primers and probes
Name of primers Amplified
Use Primer sequence {5'-3'} (SEQ ID NO.) and fragment size probes
CysLTR1- iil Fluorescence AACCTATCACAAGAAGTCAGC (1)
F quantitative
CysLTR1- amplification | CCAAAGAGCCAAATGCCTTT (2) 126 bp
R of CYSLTRI (FAM) -CACTGCCTCTCCSTGTGSTC (3) -
Cl-Probe | cDNA fragment (BHO) amplification 70 bp of reference (JOE) ~ACTCATGACCACAGTCCATGCCAT (6) -
G-Probe gene GAPDH (BHQ1) fragment 2.2. Preparation of a standard
In-vitro transcription: a pGM-T ligation kit [TIANGEN Biotech (Beijing) Co., Ltd., product number: VT202-01] was used, a CysLTR1 plasmid DNA (constructed and synthesized by entrusting Nanjing
GenScript Biotech Co., Ltd.) was constructed using a pGM-T as a vector, and the CysLTR1 plasmid DNA was transcribed into an mRNA in vitro using a HiScribe T7 High Yield RNA Synthesis Kit (NEW
ENGLAND Biolabs, product number: E20408).
An initial copy number of RNA was calculated according to a copy number calculation formula: copy number=[6.02x10?*xRNA concen- tration (ng/uL)x107?]/[RNA length (bp) x340]. The CYSLTRI mRNA was diluted with nuclease-free water to 1.0x10'" copies/uL to obtain a
CYSLTRI mRNA standard.
2.3. Extraction and dilution of a whole-blood RNA: the whole- blood total RNA was extracted from ethylenediaminetetraacetic acid (EDTA) anticoagulated whole-blood samples with the whole-blood to- tal RNA kit, quantificated with the Qubit 3 fluorometer and dilut- ed with the nuclease-free water to 20 ng/ulL. 2.4 TagMan real-time fluorescent guantitative PCR
A 20 pL of system was prepared using the CYSLTRI mRNA stand- ard or the whole blood RNA as a template, the system was shown in
Table 2:
Table 2 Reaction system
CYSLTRI
Primer-
Nuclease- PCR reac- Enzyme mRNA
ROX refer- probe Total free wa- tion so- mixed Standard ence dye mixed volume ter lution solution or whole- solution blood RNA 2.4 ul 10 pL 0.5 uL 0.1 uL 2 ul 5 uL 20 ul
An amplification reaction program was shown in Table 3:
Table 3 Reaction program
Tempera- | Number of cy-
Stage | | Time { Other parameter settings i ture | cles 42°C | 1 1 i min JOE
Stage | | Reference fluorescence: ROX i 95°C ll min | 1 2 ; | Reaction system: 20 pL 95° 5 sec Fluorescence signal collec-
Stage eee tion: Stage 3, 60°C for 31 31 40 3 : 60 e Cc | sec sec 2.5 Generation of a standard curve
The CYSLTRI mRNA standard was diluted in a 10-fold gradient using 1.0x10%-1.0x10° copies/pL as a template, 3 replicates were conducted for each dilution, and TagMan real-time fluorescence quantitative RT-PCR detection was conducted to generate a standard curve. The dilution operation was shown in FIG. 1. A 50 uL/tube was taken as an example: for each dilution, 5 uL of a sample be- fore dilution was added to a new tube containing 45 pL of water. 2.6 Precision detection 1.0x107 copies/pL and 1.0x10* copies/pL of CYSLTRI mRNA stand-
ards were taken as a template, 10 replicates were conducted for each concentration; 10 times of TagMan real-time fluorescent quan- titative RT-PCR detections were conducted, the coefficient of var- iation of the logarithm of each concentration was calculated, re- spectively; and statistical analysis was conducted to analyze the precision of the detection method. 2.7 Accuracy detection
A 1.0x10° copies/pL of CYSLTRI mRNA standard was subjected to 30-fold dilution (2 pL 1.0x10° copies/uL of a CYSLTRI mRNA standard + 58 pL of nuclease-free water) as a template, for 3 replicates; 3 times of TagMan real-time fluorescence quantitative RT-PCR detec- tions were conducted, and the accuracy of the detection method was analyzed. 2.8 Sensitivity detection
A 10.0 copies/pL of CYSLTRI mRNA standard was taken as a tem- plate, for 25 replicates, 25 times of TagMan real-time fluores- cence quantitative RT-PCR detection were conducted to check wheth- er there were amplifications, and the sensitivity of the detection method was analyzed. 2.9 Clinical sample detection
Whole-blood samples of positive samples and healthy control were taken to extract and dilute whole-blood RNA according to the steps of 2.3; TagMan real-time fluorescent quantitative RT-PCR de- tection was conducted according to the steps of 2.4. 3. Experimental results 3.1 Standard curve
The CYSLTRI mRNA standard was diluted in a 10-fold gradient using 1.0x10%-1.0x10° copies/uL as a template, 3 replicates were conducted for each dilution, and TagMan real-time fluorescence quantitative RT-PCR detection was conducted to generate a standard curve. The standard curve of the TagMan real-time fluorescence quantitative RT-PCR of the CYSLTRI mRNA is shown in FIG. 2. A copy number logarithm was taken as an abscissa and a Ct value is taken as an ordinate, and a regression equation was obtained: y=- 3.398x+35.344 (R°=1.000), where the regression equation has
R°=1.000, and a linear range of 1.0x10°-1.0x10° copies/pL. It indi- cates that the copy number logarithm of the standard equation has a very high correlation with the Ct value. 3.2 Precision detection 1.0x10"7 copies/pL and 1.0x10° copies/nL of CYSLTRI mRNA stand- ards were taken as templates, 10 replicates were conducted for each concentration; 10 times of TagMan real-time fluorescent quan- titative RT-PCR detections were conducted, the coefficient of var- iation of the logarithm of each concentration was calculated, re- spectively; and statistical analysis was conducted. The results are shown in FIG. 3 and Table 4. The coefficient of variation of the logarithm of each concentration is 0.320% and 0.444% separate- ly, which are less than 5%, indicating that the TagMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has excellent precision.
Table 4 Precision detection result co
SD C.V number logarithm 3.3 Accuracy detection
A 1.0x10° copies/pL CYSLTRI mRNA standard was subjected to 30-time dilution (2 pL 1.0x10° copies/uL of a CYSLTRI mRNA standard + 58 pL of nuclease-free water) as a template, for 3 replicates; 3 times of TagMan real-time fluorescence quantitative RT-PCR detec- tions were conducted, and the absolute deviation of the logarithm of each concentration was calculated. The results are shown in
FIG. 4 and Table 5. The absolute deviation of the logarithm of each concentration is 0.002, 0.011, and 0.008, respectively, with- in the range of 20.5, indicating that the TagMan real-time fluo- rescent quantitative RT-PCR detection method established by the present disclosure has excellent accuracy.
Table 5 Accuracy detection result
Abso-
Results Theoretical copy | Theoretical
Cr (cop- Copy number number (cop- copy number ture
E zer ow em wy tion
3.4 Sensitivity detection
A 10.0 copies/pL of CYSLTRI mRNA standard was taken as a tem- plate, for 25 replicates, 25 times of TagMan real-time fluores- cence quantitative RT-PCR detection were conducted to check wheth- er there were amplifications. The results are shown in FIG. 5 and
Table 6. A total of 25 detection results are obtained, reaching 100%. This indicates that the TagMan real-time fluorescent quanti- tative RT-PCR detection method established by the present disclo- sure has very high sensitivity, and the minimum of detected copy number is less than 10 copies/uL.
Table 6 Ct value result of sensitivity detection 3.5 Clinical sample detection
A comparison result of the present disclosure and a certain domestic brand of cysteinyl leukotriene receptor 1 (CYSLTR1) kit of enzyme-linked immunosorbent assay (ELISA) are shown in FIG. 6 and Table 7.
Table 7 Comparison result
Product of the present dis-
CYSLTR1 kit of ELISA
Sample closure
SN type Results Results | positive/
Sample 1 1 before 1589.924 + 232.6 + treatment
Sample 1 2 after 87.802 52.4 treatment
Sample 2 EE 3 before 2432.674 + 353.8 + treatment 341.476 155.7 + after
Ee
Sample 3 before 1543.690 + 274,2 + treatment
Sample 3 after 96.472 80.7 treatment 7 3434.793 + 612.3 + sample 4 38.530 72.4 control 4 123.466 176.7 + control 5 67.019 49.9 control 6
In the present disclosure, the detection was conducted using the whole-blood RNA; and the certain domestic brand of CYSLTR1 kit of ELISA was detected using a serum.
Comparative Example 1 5 Results of amplification using other non-optimal primers and probes
The primers and probes in the system used in the present dis- closure were replaced with other non-optimal primers and probes.
An amplification system and a program were the same as those in 10 Example 1. The results are shown in FIG. 7 and Table 8. When non- optimal CysLTR1l primers and probes are used, such as:
CysLTR1-F: GTATCTTCTGCCACATGCC (SEQ ID NO. 7);
CysLTR1-R: TTGCCAAAGAAGCCTACAACA (SEQ ID NO. 8); and
Cl-Probe: (FAM)-CCGCAATCAAGTGTATTCCACC (SEQ ID NO. 9)-(BHQIL).
The coefficient of variation of the logarithm of the low- precision concentration exceeds 5%, reaching 8.813%.
Table 8 Results of amplification with non-optimal primers and probes
Mean of copy number loga- =
SD C.V number rithm ee ee
Comparative Example 2
Amplification result of non-optimal enzyme mixed solution
An amplification was conducted using a non-optimal ratio of enzyme mixed solution {the Tag enzyme, reverse transcriptase,
RNase inhibitor and Tag enzyme antibody had a mass ratio of 14:4:5:1) and an optimal ratio of enzyme mixed solution on the
CYSLTRI mRNA standard with the primers and probes, the amplifica- tion system, and the program the same as those in Example 1. 4 gradients 1.0x10°-1.0x10° copies/pL of a standard curve were ob- tained, and the result is shown in FIG. 8. An amplification result using the non-optimal ratio of enzyme mixed solution is shown in
FIG. 8A, and an amplification result using the optimal ratio of enzyme mixed solution is shown in FIG. 8B. In a comparison, a standard curve of the amplification result using the optimal en- zyme mixed solution has better repeatability, and has Ct differ- ences between adjacent concentrations of 3.3, 3.3, and 3.4, re- spectively; meanwhile, a standard curve of the amplification re- sult using the non-optimal enzyme mixed solution has Ct differ- ences between adjacent concentrations of 3.8, 3.1, and 3.6, re- spectively. It indicates that the Ct difference of the standard curve of the amplification result using the optimal enzyme mixed solution is more uniform. It can be seen that the optimal enzyme mixed solution has better amplification effect.
The above results show that the TagMan real-time fluorescent quantitative RT-PCR detection method established in the present disclosure has better sensitivity and specificity than that of a counterpart reagent, and can effectively monitor the treatment ef- fect.
The above descriptions are merely preferred implementations of the present disclosure. It should be noted that a person of or- dinary skill in the art may further make several improvements and modifications without departing from the principle of the present disclosure, but such improvements and modifications should be deemed as falling within the protection scope of the present dis- closure.
<110> Hangzhou Zheda Dixun Biological Gene Engineering Co., Ltd. <129> PRIMER PROBE SET AND KIT FOR RT-PCR DETECTION OF HUMAN <130> HKJP2021121071 <150> 202110890788.8 <151> 2021-08-04 <160> 9 <170> Patentln version 3.5 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer CysLTR1-F <400> 1 aacctatcac aagaagtcag c 21 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer CysLTR1-R
<400> 2 ccaaagagcc aaatgccttt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of C1-Probe <400> 3 cactgcctct ccgtgtggtc 20
<210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer GAPDH-F <400> 4 gacaacagcc tcaagatcat c 21 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer GAPDH-R
<400> 5 cgccacagtt tcccggag 18
<210> 6 <211> 24 <212> DNA <213> Artificial Sequence
<220> <223> DNA sequence of G-probe <400> 6 actcatgacc acagtccatg ccat 24 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Non-optimal CysLTR1 primer CysLTR1-F
<400> 7 gtatcttctg ccacatgcc 19 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220>
<223> Non-optimal CysLTR1 primer CysLTR1-R <400> 8 ttgccaaaga agcctacaac a 21
<210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of non-optimal probe C1-Probe <400> 9 ccgcaatcaa gtgtattcca cc 22
<110> Hangzhou Zheda Dixun Biological Gene Engineering Co., Ltd. <120> PRIMER PROBE SET AND KIT FOR RT-PCR DETECTION OF HUMAN <130> HKJIP2021121071 <150> 202110890788.8 <151> 2021-08-04 <160> 9 <170> PatentIn version 3.5 <21e> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer CysLTR1-F <400> 1 aacctatcac aagaagtcag c 21 <2105 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer CysLTR1-R <400> 2 ccaaagagcc aaatgccttt 20 <2105 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of C1-Probe <400> 3 cactgcctct ccgtgtggtc 20 <2105 4 <211> 21 <212> DNA
<213> Artificial Sequence
<220>
<223> Primer GAPDH-F
<400> 4 gacaacagcc tcaagatcat c 21 <210>5 5
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer GAPDH-R
<400> 5 cgccacagtt tcccggag 18 <210> 6
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA sequence of G-probe
<400> 6 actcatgacc acagtccatg ccat 24 <210> 7
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Non-optimal CysLTR1 primer CysLTR1-F
<400> 7 gtatcttctg ccacatgcc 19 <2105 8
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Non-optimal CysLTR1 primer CysLTR1-R
<400> 8 ttgccaaaga agcctacaac a 21 <210> 9
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA sequence of non-optimal probe Cl-Probe
<400> 9 ccgcaatcaa gtgtattcca cc 22
Claims (10)
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110890788.8A CN113564245A (en) | 2021-08-04 | 2021-08-04 | Primer probe set and kit for RT-PCR detection of human leukotriene receptor CysLTR1mRNA |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| NL2030976A true NL2030976A (en) | 2023-02-15 |
| NL2030976B1 NL2030976B1 (en) | 2023-03-14 |
Family
ID=78170341
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| NL2030976A NL2030976B1 (en) | 2021-08-04 | 2022-02-16 | Primer probe set and kit for rt-pcr detection of human leukotriene receptor cysltr1 mrna |
Country Status (4)
| Country | Link |
|---|---|
| CN (1) | CN113564245A (en) |
| AU (1) | AU2021106581A4 (en) |
| NL (1) | NL2030976B1 (en) |
| ZA (1) | ZA202200487B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2272977A1 (en) * | 2009-07-08 | 2011-01-12 | Universite Libre De Bruxelles | Diagnostic method and kit for the detection of a lymphocytic variant of hypereosinophilic syndrome |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6465212B1 (en) * | 1999-09-20 | 2002-10-15 | Schering Corporation | Leukotriene receptor |
| US7666596B2 (en) * | 2005-05-23 | 2010-02-23 | University Of Alberta | Tissue rejection |
| CN102121048A (en) * | 2010-01-11 | 2011-07-13 | 中山大学附属肿瘤医院 | POOL FQ-PCR (Fluorescence Quantitive Polymerase Chain Reaction) combined detection method of tumor drug resistance genes and kit thereof |
| CN110592290B (en) * | 2019-10-31 | 2022-10-04 | 上海市动物疫病预防控制中心 | Kit and method for detecting feline calicivirus |
| WO2023010328A1 (en) * | 2021-08-04 | 2023-02-09 | 杭州浙大迪迅生物基因工程有限公司 | Primer-probe set and kit for human leukotriene receptor cysltr1 mrna rt-pcr detection |
| CN113388679A (en) * | 2021-08-04 | 2021-09-14 | 杭州浙大迪迅生物基因工程有限公司 | Primer probe set and kit for RT-PCR detection of human leukotriene receptor CysLTR2mRNA |
-
2021
- 2021-08-04 CN CN202110890788.8A patent/CN113564245A/en active Pending
- 2021-08-23 AU AU2021106581A patent/AU2021106581A4/en active Active
-
2022
- 2022-01-11 ZA ZA2022/00487A patent/ZA202200487B/en unknown
- 2022-02-16 NL NL2030976A patent/NL2030976B1/en active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2272977A1 (en) * | 2009-07-08 | 2011-01-12 | Universite Libre De Bruxelles | Diagnostic method and kit for the detection of a lymphocytic variant of hypereosinophilic syndrome |
Non-Patent Citations (2)
| Title |
|---|
| SHIRASAKI H ET AL: "Agonist- and T"H2 cytokine-induced up-regulation of cysteinyl leukotriene receptor messenger RNA in human monocytes", ANNALS OF ALLERGY, ASTHMA, ELSEVIER, AMSTERDAM, NL, vol. 99, no. 4, 1 October 2007 (2007-10-01), pages 340 - 347, XP026959892, ISSN: 1081-1206, [retrieved on 20071001] * |
| WEI SONG ET AL: "Antagonism of cysteinyl leukotriene receptor 1 (cysLTR1) by montelukast suppresses cell senescence of chondrocytes", CYTOKINE, vol. 103, 1 March 2018 (2018-03-01), US, pages 83 - 89, XP055584474, ISSN: 1043-4666, DOI: 10.1016/j.cyto.2017.12.021 * |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2021106581A4 (en) | 2021-11-11 |
| NL2030976B1 (en) | 2023-03-14 |
| CN113564245A (en) | 2021-10-29 |
| ZA202200487B (en) | 2022-03-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107058623B (en) | High-sensitivity and specific blood HBV pgRNA fluorescent quantitative PCR detection system and detection method | |
| CN112538550B (en) | RT-RPA and CRISPR/Cas-based DHAV-1 and DHAV-3 detection system and application | |
| WO2023010326A1 (en) | PRIMER-PROBE SET AND KIT FOR HUMAN β-TRYPTASE MRNA RT-PCR DETECTION | |
| WO2023025259A1 (en) | Method and kit for detecting microrna | |
| CN110724764A (en) | Fluorescent quantitative PCR detection method for human coronavirus and respiratory syncytial virus and application thereof | |
| NL2030975B1 (en) | Primer probe set and kit for rt-pcr detection of human leukotriene receptor cysltr2 mrna | |
| EP4289968A1 (en) | Primer-probe set and kit for human leukotriene receptor cysltr1 mrna rt-pcr detection | |
| NL2030976B1 (en) | Primer probe set and kit for rt-pcr detection of human leukotriene receptor cysltr1 mrna | |
| EP4306655A1 (en) | Primer-probe set, kit and detection method for detecting human histamine receptor hrh1 mrna | |
| AU2021106592A4 (en) | Primer set for detection of expression of human eosinophil cationic protein (ecp) mrna and kit | |
| NL2030977B1 (en) | Reagent for detecting expression level of human histamine receptor hrh4 mrna, kit and use | |
| US20240150832A1 (en) | Reagent for detecting expression level of human histamine receptor hrh4 mrna, kit and detection method | |
| AU2021106574A4 (en) | Primer probe set for human histamine receptor hrh1 mrna detection, kit and use | |
| NL2030974B1 (en) | Primer probe set and kit for rt-pcr detection of human tryptase beta (tpsb) mrna | |
| WO2023010327A1 (en) | Primer probe set and test kit for rt-pcr detection of human leukotriene receptor cysltr2 mrna | |
| CN111621557B (en) | Kit for detecting osteoporosis susceptibility gene by cocktail and using method thereof | |
| CN109609661B (en) | Kidney yang deficiency exogenous mouse model lung tissue qPCR (quantitative polymerase chain reaction) reference gene combination and screening method thereof | |
| WO2023010325A1 (en) | Primer set for detecting expression of human eosinophil cationic protein mrna, kit, and detection method | |
| CN115725702A (en) | Fluorescent RT-PCR (reverse transcription-polymerase chain reaction) primer and probe for human endogenous RNA (ribonucleic acid) internal standard, kit and using method | |
| CN115478116A (en) | Kit for early warning of heavy and critical cases in novel coronavirus | |
| CN106554991A (en) | Can be used for the blood miR-134 detection kits of coronary artery calcification diagnosis | |
| CN115478117A (en) | Kit for early warning of medium-heavy and critical cases of novel coronavirus | |
| CN112899395A (en) | Novel real-time detection method for coronavirus nucleic acid extraction-free and kit thereof | |
| CN116640884A (en) | Reagent composition, kit and method for detecting GaII.6 type norovirus | |
| CN113122622A (en) | Kit for diagnosing asthenospermia through piR-31925 and application |