AU2021106592A4

AU2021106592A4 - Primer set for detection of expression of human eosinophil cationic protein (ecp) mrna and kit

Info

Publication number: AU2021106592A4
Application number: AU2021106592A
Authority: AU
Inventors: Lei Cheng; Xuehan JIANG; Yi Liu; Huahao SHEN; Jiaofeng Wang; Yifei Wang; Shandong Wu; Zhoujie Wu
Original assignee: Hangzhou Zheda Dixun Biological Gene Engineering Co Ltd
Current assignee: Hangzhou Zheda Dixun Biological Gene Engineering Co Ltd
Priority date: 2021-08-04
Filing date: 2021-08-23
Publication date: 2021-11-11
Anticipated expiration: 2029-08-23
Also published as: CN113373218A; NL2030973A; NL2030973B1; ZA202200493B

Abstract

OF THE DISCLOSURE The present disclosure provides a primer set for detection of an expression of a human eosinophil cationic protein (ECP) mRNA and a kit, and relates to the technical field of biological detection. In the present disclosure, the primer set includes an ECP-F, an ECP-R, a GAPDH-F and a GAPDH-R; where the ECP-F has a nucleotide sequence shown in SEQ ID NO. 1, the ECP-R has a nucleotide sequence shown in SEQ ID NO. 2, the GAPDH-F has a nucleotide sequence shown in SEQ ID NO. 3, and the GAPDH-R has a nucleotide sequence shown in SEQ ID NO. 4. The present disclosure further provides a kit including the primer set, and the kit can one-step quantitatively detect an expression level of the human ECP mRNA. The present disclosure provides a detection method with high accuracy, wide detection range and high sensitivity for the ECP protein.

Description

PRIMER SET FOR DETECTION OF EXPRESSION OF HUMAN EOSINOPHIL CATIONIC PROTEIN (ECP) MRNAAND KIT TECHNICAL FIELD

[01] The present disclosure belongs to the technical field of biological detection, and specifically relates to a primer set for detection of an expression of a human eosinophil cationic protein (ECP) mRNA and a kit.

BACKGROUNDART

[02] An eosinophil cationic protein (ECP) is a strongly-basic granulin released after eosinophil (EOS) activation; the ECP exists in the matrix part of EOS particles, accounting for 30% of the particles. The ECP is a specific marker after the EOS activation, and can reflect the EOS activation level, and the ECP also has a very strong cytotoxic effect. The ECP can be found in most body fluids of the human, such as serum, nasal secretions, bronchial irrigation fluid, saliva, and tears and the like.

[03] For inflammatory diseases related to eosinophil infiltration, the content of EOS granulin is more important than the total number of EOS infiltrations. The EOS granulin mainly includes: an ECP, an eosinophil major basic protein (EMBP), an eosinophil peroxidase (EPO) and an eosinophil-derived neurotoxin (EDN), where the ECP has an especially remarkable toxic effect. During inflammation, the EOS is activated and degranulates, causing mucosal damage, which in turn increases tissue hypersensitivity and causes chronic inflammation. Meanwhile, the EOS releases the ECP to cause an increase of ECP levels in peripheral blood and membrane mucus.

[04] The ECP is a very important airway active substance, and has various airway effects such as contraction of bronchial smooth muscle, destruction of alveolar surface active substances, lysis of cell membranes, and activation of inflammatory cells and the like. The ECP participates in the pathophysiological process of asthma, such as airway hyperresponsiveness and airway epithelial injury. Eosinophilic inflammation in patients with asthma leads to increased ECP levels in blood and other body fluids such as bronchoalveolar fluid and sputum. The ECP level objectively reflects the level of eosinophilic inflammation in asthma patients, and a high level of ECP indicates the inflammatory state of the asthma patients. ECP determination can be used to monitor asthma inflammation, guide hormone therapy of asthma, and find patients who do not comply with treatment. In addition, the ECP can also be regarded as a biochemical marker for allergic reactions. After contacting, inhaling or ingesting allergens, allergic people will undergo allergic asthma, and allergic dermatitis and the like, leading to an increase of the ECP level of allergic patients. The ECP is an effective marker for determining whether avoidance and treatment are successful or effective in immunotherapy and avoidance studies of asthma.

[05] At present, the content of ECP in the body fluids is still detected using an enzyme-linked immunosorbent assay (ELISA) kit. There is no commercial kit for detecting the ECP mRNA. The ELISA method has the problems of small detection range, low sensitivity and unsatisfactory accuracy during the detection. Therefore, it is very necessary to establish a detection method for an expression of the ECP mRNA with high accuracy, wide detection range and high sensitivity.

SUMMARY

[06] The purpose of the present disclosure is to provide a primer set for detection of an expression of a human ECP mRNA and a kit. An expression level of the ECP mRNA can be one-step quantitatively detected. The present disclosure provides a detection method with high accuracy, wide detection range and high sensitivity for the detection of ECP protein.

[07] In order to realize the above objective, the present disclosure provides the following technical solutions:

[08] The present disclosure provides a primer set for detection of an expression of a human ECP mRNA, including an ECP-F, an ECP-R, a GAPDH-F and a GAPDH-R; where

[09] the ECP-F has a nucleotide sequence shown in SEQ ID NO. 1, the ECP-R has a nucleotide sequence shown in SEQ ID NO. 2, the GAPDH-F has a nucleotide sequence shown in SEQ ID NO. 3, and the GAPDH-R has a nucleotide sequence shown in SEQ ID NO. 4.

[10] Preferably, the primer set may further include a probe E-Probe and a probe G-Probe; where

[11] the E-Probe has a nucleotide sequence shown in SEQ ID NO. 5, and the G-Probe has a nucleotide sequence shown in SEQ ID NO. 6.

[12] Preferably, 5'-ends of the probe E-Probe and the probe G-Probe may be both connected with a fluorescent group, and 3'-ends of the probe E-Probe and the probe G-Probe may be both connected with a quenching group.

[13] Preferably, the 5'-ends of the probes E-Probe and G-Probe may be connected with different fluorescent groups, and the 3'-ends of the probes E-Probe and G-Probe may be connected with a same quenching group.

[14] The present disclosure further provides a kit for one-step detection of an expression of a human ECP mRNA, including the primer set.

[15] Preferably, the kit may further include a PCR reaction solution, an enzyme mixed solution, a ROX reference dye and nuclease-free water; where

[16] the enzyme mixed solution may include a Taq enzyme, a reverse transcriptase, an RNase inhibitor and a Taq enzyme antibody with a mass ratio of 13:5:3:1.

[17] Preferably, the PCR reaction solution may include a dNTP mix, MgCl2 and a buffer.

[18] Preferably, the kit may further include a standard of the human ECP mRNA.

[19] The present disclosure provides a primer set for detection of an expression of a human ECP mRNA, and constructs a kit for one-step detection using the primer set. In the present disclosure, the one-step detection of the expression level of the human ECP mRNA is conducted using the primer set or the kit. Compared with immunological detection methods, the detection has higher sensitivity, can detect low-concentration clinical samples, can more sensitively detect changes in ECP content, and has a detection range spanning at least 6 orders of magnitude. Accordingly, the accuracy of the detection results is increased, and at least 80 people can be detected within 1 hour, such that the treatment effect can be dynamically monitored and evaluated in an earlier, more accurate, and faster manner. The primer set or the kit is used to detect level changes of the ECP mRNA in patients, and the detection can be used to monitor asthma and other allergic diseases or eosinophil infiltration inflammation, guide glucocorticoid therapy plan, and find patients who do not comply with treatment.

BRIEF DESCRIPTION OF THE DRAWINGS

[20] FIG. 1 is a standard curve of a TaqMan real-time fluorescent quantitative RT-PCR for ECP mRNA.

[21] FIG. 2 is a result of a precision detection, Herein, 1:1.x106 copies/L, and 2: 1.0x103 copies/pL.

[22] FIG. 3 is a result of accuracy detection.

[23] FIG. 4 is a result of sensitivity detection.

[24] FIG. 5 is a result of clinical sample detection. Herein, 1: positive sample 4 GAPDH mRNA; 2: healthy control 2 GAPDH mRNA; 3: positive sample 4 ECP mRNA; 4: healthy control 2 ECP mRNA; 5: blank control NTC-GAPDH mRNA; 6: blank control NTC-ECP mRNA.

[25] FIG. 6 is a low-precision amplification curve in the case of non-optimal primer and probe designs.

[26] FIG. 7 is an effect of an enzyme mixed solution on an amplification curve.

[27] FIG. 8 is a plasmid structure of a pGM-T vector.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[28] The present disclosure provides a primer set for detection of an expression of a human ECP mRNA, including an ECP-F, an ECP-R, a GAPDH-F and a GAPDH-R; where

[29] the ECP-F has a nucleotide sequence shown in SEQ ID NO. 1, the ECP-R has a nucleotide sequence shown in SEQ ID NO. 2, the GAPDH-F has a nucleotide sequence shown in SEQ ID NO. 3, and the GAPDH-R has a nucleotide sequence shown in SEQ ID NO. 4.

[30] In the present disclosure, the primer set preferably further includes a probe E-Probe and a probe G-Probe; where the E-Probe has a nucleotide sequence shown in SEQ ID NO. 5, and the G-Probe has a nucleotide sequence shown in SEQ ID NO. 6. 5'-ends of the probe E-Probe and the probe G-Probe are both preferably connected with a fluorescent group, and 3'-ends of the probe E-Probe and the probe G-Probe are both preferably connected with a quenching group; and the '-ends are separately connected with different fluorescent groups, and the 3'-ends are connected with a same quenching group. In an example, an 5'-end of the nucleotide sequence of the probe E-Probe is labeled with a 6-carboxyfluorescein (FAM) fluorescent reporter group, and a 3'-end of the nucleotide sequence of the probe E-Probe is labeled with a Black Hole Quencher-i (BHQ1) quenching group; and the 5'-end is labeled with a 2,7-dimethyl-4,5-dichloro-6-carboxyfluorescein (JOE) fluorescent reporter group, and the 3'-end is labeled with a BHQ1 quenching group.

[31] The present disclosure lists an information of the above primer set in Table 1.

[32] Table 1 Information of the primer set for TaqMan real-time fluorescent quantitative PCR Amplified SEQ ID Name Primer sequence (5'-3') fragment NO. ECP-F ACAGCTCAGAGACTGGGAAAC 1 ECP-R CCCATAAGCCCCAACAGAAG 80 bp 2 E-Probe (FAM)-TGGTTCCAAAACTGTTCACTTCCC-(BHQ1) 5 GAPDH-F GACAACAGCCTCAAGATCATC 3 GAPDH-R CGCCACAGTTTCCCGGAG 70 bp 4 G-Probe (JOE)-ACTCATGACCACAGTCCATGCCAT-(BHQ1) 6

[33] The present disclosure further provides a kit for one-step detection of an expression of a human ECP mRNA, including the primer set.

[34] In the present disclosure, the kit preferably further includes a PCR reaction solution, an enzyme mixed solution, a ROX reference dye and nuclease-free water; where an enzyme in the enzyme mixed solution includes a Taq enzyme, a reverse transcriptase, an RNase inhibitor and a Taq enzyme antibody with a mass ratio of preferably 13:5:3:1=13:5:3:1 to obtain an optimal amplification effect.

[35] In the present disclosure, the PCR reaction solution preferably includes a dNTP mix, MgCl2 and a buffer.

[36] In the present disclosure, the kit preferably further includes a standard of the human ECP mRNA. There is no special limitation on a preparation method of the standard of the human ECP mRNA. The ECP mRNA is preferably constructed and synthesized by entrusting Nanjing GenScript Biotech Co., Ltd., and is diluted to 1.OxI0 9 copies/pL using the nuclease-free water to obtain the ECP standard. The standard is preferably a standard of the ECP mRNA for preparing a quantitative curve.

[37] In the present disclosure, the upstream and downstream primers in the kit have a working concentration of preferably 0.5-1 [M; and the probe has a working concentration of preferably 1.5-2 [M.

[38] In the present disclosure, the Taq enzyme is a heat-resistant Taq DNA polymerase, deoxynucleotides in the dNTP are added to a 3-OH terminus one by one using the 3'--5' polymerase activity of the Taq enzyme and using DNA as a template. Meanwhile, mismatched primer ends can be identified and eliminated using the 5'--3' exonuclease activity of the Taq enzyme, which is related to the correction function during the replication; nucleotides can also be hydrolyzed from the 5'-end and mismatched nucleotides can also be excised through several nucleotides. In this way, the chain replacement is realized during the chain extension, and the replaced probe is cut off. The reverse transcriptase can reverse transcribe an mRNA into a cDNA for PCR reaction. The RNase inhibitor is used to suppress the activity of an exogenous RNase. The Taq enzyme antibody is an anti-Taq antibody for hot-start PCR, inhibits DNA polymerase activity after binding to the Taq enzyme, and can effectively suppress the non-specific annealing of primers and the non-specific amplification caused by primer dimers under low temperature. The Taq enzyme antibody is denatured during the initial DNA denaturation of the PCR reaction, and the Taq enzyme recovers the activity to realize PCR amplification.

[39] The present disclosure further provides a method for one-step detection of an expression level of the ECP mRNA, including the following steps: preparing a quantitative reverse transcription-polymerase chain reaction (qRT-PCR) reaction system using an extracted RNA and the ECP standard as templates separately, and conducting a qRT-PCR reaction using the ECP standard to obtain a quantitative curve, and measuring the expression level of the ECP.

[40] In the present disclosure, there is no special limitation on the extraction source of the RNA, and the RNA can be extracted preferably from whole-blood, serum, nasal secretions, bronchial irrigating fluid, saliva or tears. In an example, the detection is conducted preferably by extracting an RNA from whole-blood.

[41] In the present disclosure, the qRT-PCR reaction system, calculated in 20 L, preferably includes: 2.4 L of the nuclease-free water, 10 L of the PCR reaction solution, 0.5 L of the enzyme mixed solution, 0.1 L of the ROX reference dye, 2 L of a mixed solution of the primer set and the probe, and 5 L of the standard/whole-blood RNA.

[42] In the present disclosure, a qRT-PCR program preferably includes: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 s, 40 cycles.

[43] In the present disclosure, the quantitative curve uses a copy number logarithm as an abscissa (x) and a Ct value as an ordinate (y): y=-3.27x+35.533 (R2=0.999); and a linear range is 1.0x102 -1.0x10 7 copies/pL. The method of the present disclosure has better sensitivity than imported fluorescent enzyme immunoassay reagents and better specificity than domestic enzyme immunoassay reagents when detecting the ECP mRNA.

[44] The primer set for detection of an expression of a human ECP mRNA and the kit provided by the present disclosure are described in detail below with reference to the examples, but these examples should not be understood as limiting the claimed protection scope of the present disclosure.

[45] Unless otherwise specified, the testing materials used in the present disclosure are all conventionally-purchased:

[46] a whole-blood total RNA kit (Hangzhou Simgen Biological Reagent Development Co., Ltd., product number: 5201050);

[47] a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, product number: E2050S);

[48] an Applied Biosystems T M 7300 fluorescence quantitative PCR instrument (Thermo Fisher Scientific, USA);

[49] a -80°C low-temperature refrigerator (Thermo Fisher Scientific, USA);

[50] a high-speed and low-temperature table centrifuge (Eppendorf, Germany); and

[51] a Qubit 3 fluorometer (Thermo Fisher Scientific, USA).

[52] Example 1

[53] 1. Shanghai Sunny Biotechnology Co., Ltd. was entrusted to synthesize the primers and probes shown in Table 1.

[54] 2. Preparation of a standard

[55] In-vitro transcription: a pGM-T ligation kit [TIANGEN Biotech (Beijing)Co.,Ltd., product number: VT202-01] was used, a ECP plasmid DNA (constructed and synthesized by entrusting Nanjing GenScript Biotech Co., Ltd., FIG. 8) was constructed using a pGM-T as a vector, and the ECP plasmid DNA was transcribed into an mRNA in vitro using a HiScribe T7 High Yield RNA Synthesis Kit (NEW ENGLAND BioLabs, product number: E2040S).

[56] An initial copy number of RNA was calculated according to a copy number calculation formula: copy number=[6.02x1023xRNA concentration (ng/L)x10-9]/[RNA length (bp)x340]. The ECP mRNA was diluted with nuclease-free water to 1.OxIO9 copies/4L to obtain an ECP mRNA standard.

[57] 3. Extraction and dilution of whole-blood RNA

[58] Whole-blood total RNA was extracted from ethylenediaminetetraacetic acid (EDTA) anticoagulated whole-blood samples with the whole-blood total RNA kit, quantificated with the Qubit 3 fluorometer, and diluted with the nuclease-free water to 20 ng/L.

[59] 4. TaqMan real-time fluorescent quantitative PCR

[60] A 20 1 system was prepared using the standard/whole-blood RNA as a template with: 2.4 pL of nuclease-free water, 10 L of a PCR reaction solution, 0.5 L of an enzyme mixed solution, 0.1 L of a ROX reference dye, 2 L of a mixed solution of the primer set and the probe, and 5 L of a standard/whole-blood RNA.

[61] A qRT-PCR program includes: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for

31 s, 40 cycles; and a detection fluorescein was set up: FAM, JOE; a reference fluorescence was: ROX; a reaction system was: 20 L; and a fluorescence signal collection was: 60°C for 31 sec.

[62] 5. Generation of a standard curve

[63] The ECP mRNA standard was diluted in a 10-fold gradient using 1.0x107-1.0x102 copies/pL as a template, 2 replicates were conducted for each dilution, and TaqMan real-time fluorescent quantitative RT-PCR detection was conducted to generate a standard curve.

[64] The standard curve is shown in FIG. 1. A copy number logarithm is taken as an abscissa and a Ct value is taken as an ordinate, and a regression equation is obtained: y=-3.27x+35.533 (R 2=0.999), indicating the copy number logarithm of the standard equation has a very high correlation with the Ct value.

[65] 6. Precision detection

[66] 1.0x106 copies/pL and 1.0x103 copies/pL of ECP mRNA standards were taken as a template, 10 replicates were conducted for each concentration; 10 times of TaqMan real-time fluorescent quantitative RT-PCR detections were conducted, the coefficient of variation of the logarithm of each concentration was calculated, respectively; and statistical analysis was conducted to analyze the precision of the detection method.

[67] The results are shown in Table 2 and FIG. 2. The coefficient of variation of the logarithm of each concentration is 0.460% and 1. 575% separately, which are less than 5%, indicating that the TaqMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has excellent precision.

[68] Table 2 Precision detection result Theoretical copy number Mean of copy number logarithm SD C.V 1.0X106 5.950 0.027 0.460% 1.Ox103 2.952 0.046 1.575%

[69] 7. Accuracy detection

[70] A 1.0x105 copies/pL of ECP mRNA standard was taken as a template, for 3 replicates; 3 times of TaqMan real-time fluorescent quantitative RT-PCR detections were conducted, and the absolute deviation of the logarithm of each concentration was calculated. The results are shown in FIG. 3. The absolute deviation of the logarithm of each concentration is-0.130, -0.135, and -0.143, respectively, within the range of 0.5, indicating that the TaqMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has excellent accuracy.

[71] Table 3 Accuracy detection Theoretical Results Copy number Theoretical copy Absolute CT copy number (copies/ptL) logarithm number logarithm deviation (copies/ptL)

19.608 7.413x104 4.870 1.000x105 5.000 -0.130

19.624 7.328x104 4.865 -0.135

19.651 7.194x104 4.857 -0.143

[72] 8. Sensitivity detection

[73] A 10.0 copies/pL of ECP mRNA standard was taken as a template, for 25 replicates, 25 times of TaqMan real-time fluorescent quantitative RT-PCR detections were conducted to check whether there were amplifications, and the sensitivity of the detection method was analyzed.

[74] The results are shown in Table 4 and FIG. 4. A total of 25 detection results are obtained, reaching 100%. This indicates that the TaqMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has very high sensitivity, and the minimum number of detected copies is less than 10 copies/pL.

[75] Table 4 Ct value results of sensitivity detection 32.951 32.621 32.816 32.644 33.448

32.658 32.922 32.140 32.984 33.033

32.850 32.916 33.579 32.549 32.359

33.004 33.427 32.696 33.106 32.580

32.437 33.301 33.245 33.015 32.425

[76] 9. Clinical sample detection

[77] Whole-blood samples of positive samples and healthy controls were taken to extract and dilute whole-blood RNA according to 3, and the TaqMan real-time fluorescent quantitative RT-PCR detection was conducted according to 4.

[78] Compared with a domestic brand of human ribonuclease A3 (RNASE3/ECP) enzyme-linked immunosorbent assay (ELISA) kit and an ImmunCAPTM ECP reagent widely-used abroad, the results are shown in Table 5 and FIG. 5. The TaqMan real-time fluorescent quantitative RT-PCR detection method established in the present disclosure has better sensitivity than imported fluorescent enzyme immunoassay reagents and better specificity than domestic enzyme immunoassayreagents.

[791 Table 5 Comparison result of clinical sample detection ECP mRNA detection kit Human RNASE3/ECP ImmunoCAPTM ECP (fluorescent RT-PCR) ELISA kit SN Sample type positive/ Result Positive/ Result Positive/ Results (copies/ptL) negative (ng/mL) negative (ng/mL) negative

1 Positive sample 1 382.308 + 22.6 + 1985.9 +

2 Positive sample 2 602.864 + 53.8 + 1982.2 +

3 Positive sample 3 418.754 + 34.2 + 306.5 +

4 Positive sample 4 664.208 + 55.7 + 1107.1

+ Positive sample 5 817.915 + 52.4 + 653.8

+ 6 Positive sample 6 466.318 + 12.3 - 486.6

+ 7 Positive sample 7 453.216 + 10.7 - 399.2

+ 8 Healthy control 1 318.696 - 12.4 - 1222.5

+ 9 Healthy control 2 32.172 - 6.7 - 1719.0

+ Healthy control 3 210.273 - 9.9 - 884.7

+

[80] Comparative Examples 1 Results of amplification using other non-optimal primers and probes

[81] The primers and probes in the system used in the present disclosure in Example 5 were replaced with other non-optimal primers and probes. The result is shown in FIG. 6. The amplification result of the standard curve is poor, with an amplification efficiency of only 68.547%.

[82] Non-optimal ECP primers and probes were used as follows:

[83] ECP-F (SEQ ID NO.7): TGAACCCCAGAACAACCAG;

[84] ECP-R (SEQ ID NO.8): CAGTTTATTGCAGGGTTCACA; and

[85] Probe (SEQ ID NO.9): (FAM)-CCAAAATCAAGTGGGGCGAT-(BHQ1).

[86] Comparative Examples 2 Comparison of the effect of enzyme mixed solution

[87] Amplification was conducted on 2 cases of whole-blood RNA samples using a non-optimal ratio of enzyme mixed solution (the Taq enzyme, reverse transcriptase, RNase inhibitor and Taq enzyme antibody had a mass ratio of 11:6:4:1) and an optimal ratio of enzyme mixed solution. An amplification result using the non-optimal ratio of enzyme mixed solution is shown in FIG. 7A, and an amplification result using the optimal ratio of enzyme mixed solution is shown in FIG. 7B. It can be seen that the optimal enzyme mixed solution has better amplification effect.

[88] The above descriptions are merely preferred implementations of the present disclosure. It should be noted that a person of ordinary skill in the art may further make several improvements and modifications without departing from the principle of the present disclosure, but such improvements and modifications should be deemed as falling within the protection scope of the present disclosure.

[89] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[90] The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

Claims

WHAT IS CLAIMED IS:

1. A kit for one-step detection of an expression of a human eosinophil cationic protein (ECP) mRNA, comprising a primer set for detection of an expression of an ECP mRNA; the primer set comprises an ECP-F, an ECP-R, a GAPDH-F and a GAPDH-R; the ECP-F has a nucleotide sequence shown in SEQ ID NO. 1, the ECP-R has a nucleotide sequence shown in SEQ ID NO. 2, the GAPDH-F has a nucleotide sequence shown in SEQ ID NO. 3, and the GAPDH-R has a nucleotide sequence shown in SEQ ID NO. 4; the primer set further comprises a probe E-Probe and a probe G-Probe; the E-Probe has a nucleotide sequence shown in SEQ ID NO. 5, and the G-Probe has a nucleotide sequence shown in SEQ ID NO. 6; and 5'-ends of the probe E-Probe and the probe G-Probe are both connected with a fluorescent group, and 3'-ends of the probe E-Probe and the probe G-Probe are both connected with a quenching group.

2. The kit according to 1, further comprising a PCR reaction solution, an enzyme mixed solution, an carboxy-X-rhodamine (ROX) reference dye and nuclease-free water; wherein an enzyme in the enzyme mixed solution comprises a thermus aquaticus (Taq) enzyme, a reverse transcriptase, a ribonuclease (RNase) inhibitor and a Taq enzyme antibody with a mass ratio of 13:5:3:1.

3. The kit according to 2, wherein the PCR reaction solution comprises a deoxy-ribonucleoside triphosphate (dNTP) mix, MgCl2 and a buffer.

4. The kit according to claim 2 or 3, further comprising a standard of the human ECP mRNA.