AU2021106577A4 - Primer probe set and kit for rt-pcr detection of human tryptase beta (tpsb) mrna - Google Patents
Primer probe set and kit for rt-pcr detection of human tryptase beta (tpsb) mrna Download PDFInfo
- Publication number
- AU2021106577A4 AU2021106577A4 AU2021106577A AU2021106577A AU2021106577A4 AU 2021106577 A4 AU2021106577 A4 AU 2021106577A4 AU 2021106577 A AU2021106577 A AU 2021106577A AU 2021106577 A AU2021106577 A AU 2021106577A AU 2021106577 A4 AU2021106577 A4 AU 2021106577A4
- Authority
- AU
- Australia
- Prior art keywords
- probe
- tpsb
- primer
- seq
- nucleotide sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
OF THE DISCLOSURE
The present disclosure relates to a primer probe set and a kit for reverse
transcription-polymerase chain reaction (RT-PCR) detection of a human tryptase beta (TPSB)
mRNA, belonging to the technical field of biological detection. In the present disclosure, the primer
probe set includes a primer TPSB-F, a primer TPSB-R and a probe T-Probe, where the primer
TPSB-F has a nucleotide sequence shown in SEQ ID NO. 1, the primer TPSB-R has a nucleotide
sequence shown in SEQ ID NO.2, and the probe T-Probe has a nucleotide sequence shown in SEQ
ID NO.3. The primer probe set of TaqMan real-time fluorescent quantitative one-step RT-PCR
detection is established for a human TPSB, and the primer probe set provides a detection method
with high accuracy, wide detection range and high sensitivity for the TPSB protein.
Description
[01] The present disclosure belongs to the technical field of biological detection, and specifically relates to a primer probe set and a kit for reverse transcription-polymerase chain reaction (RT-PCR) detection of a human tryptase beta (TPSB) mRNA.
[02] Mast cells (MCs) are activated in allergic reactions to release inflammatory mediators including a tryptase. This process leads to the symptoms and signs of the allergic reactions. The tryptase has the functions of promoting airway repair, regulating the tension and responsiveness of airway smooth muscle cells (SMCs), and stimulating the activation of MCs and the like. At present, the tryptase is divided into three categories at cDNA and protein levels: a tryptase alpha, a tryptase beta, and a tryptase gamma, where the tryptase beta has the highest content. After an allergic reaction occurs, a transient increase of the tryptase beta (TPSB) level in blood circulation helps to identify and evaluate the extent of the allergic reaction. Samples for measuring the transient increase of TPSB level should be collected within 15 minutes to 3 hours after the allergic reaction occurs. The transient increase of the TPSB level in the blood indicates that medicines, insect venoms, or foods cause an allergic reaction, and a long-lasting and elevated TPSB level may indicate mastocytosis or hematological tumors. An increase in the TPSB level (or concentration) in nasal secretions indicates that patients with active allergic rhinitis or allergic rhinitis are undergoing an allergen challenge test.
[03] At present, the detection of the content of TPSB in the body fluids is still detected using an enzyme-linked immunosorbent assay (ELISA) kit. There is no commercial kit for detecting the TPSB mRNA. The ELISA method has the problems of small detection range, low sensitivity and unsatisfactory accuracy during the detection.
[04] The purpose of the present disclosure is to provide a primer probe set and a kit for RT-PCR detection of a human TPSB mRNA. The primer probe set of TaqMan real-time fluorescent quantitative one-step RT-PCR detection is established for a human TPSB, and the primer probe set provides a detection method with high accuracy, wide detection range and high sensitivity for the TPSB protein.
[05] The present disclosure provides a primer probe set for RT-PCR detection of a human TPSB mRNA, including a primer TPSB-F, a primer TPSB-R and a probe T-Probe, wherein the primer
TPSB-F has a nucleotide sequence shown in SEQ ID NO. 1, the primer TPSB-R has a nucleotide sequence shown in SEQ ID NO.2, and the probe T-Probe has a nucleotide sequence shown in SEQ ID NO.3.
[06] Preferably, a 5'-end of the probe T-Probe may be labeled with a fluorescent reporter group, and a 3'-end of the probe T-Probe may be labeled with a quenching group.
[07] Preferably, the primer probe set may further include a primer GAPDH-F, a primer GAPDH-R and a probe G-Probe of a reference gene, where the primer GAPDH-F may have a nucleotide sequence shown in SEQ ID NO.4, the primer GAPDH-R may have a nucleotide sequence shown in SEQ ID NO.5, and the probe G-Probe may have a nucleotide sequence shown in SEQ ID NO.6.
[08] Preferably, a 5'-end of the probe G-Probe may be labeled with a fluorescent reporter group, and a 3'-end of the probe G-Probe may be labeled with a quenching group; and the fluorescent reporter group labeled on the probe G-Probe may be different from the fluorescent reporter group labeled on the probe T-Probe.
[09] Preferably, the fluorescent reporter group may include a 6-carboxyfluorescein (FAM) or a 2,7-dimethyl-4,5-dichloro-6-carboxyfluorescein (JOE), and the quenching group may include a Black Hole Quencher-i (BHQ1).
[10] The present disclosure further provides a kit for RT-PCR detection of a human TPSB mRNA, including the primer probe set, a PCR reaction solution, an enzyme mixed solution, a TPSB standard, a carboxy-X-rhodamine (ROX) reference dye and nuclease-free water.
[11] Preferably, the PCR reaction solution may include a deoxy-ribonucleoside triphosphate (dNTP) mix, MgCl2 and a buffer.
[12] Preferably, the enzyme mixed solution may include a thermus aquaticus (Taq) enzyme, a reverse transcriptase, a ribonuclease (RNase) inhibitor and a Taq enzyme antibody.
[13] The present disclosure further provides a method for using the kit, including the following steps: mixing the primer probe set, the PCR reaction solution, the enzyme mixed solution, the TPSB standard or a TPSB sample to be tested, the ROX reference dye and the nuclease-free water, and conducting fluorescent quantitative amplification.
[14] Preferably, based on 20 pL, a reaction system of the kit may include: 2 pL of the primer probe set, 10 pL of the PCR reaction solution, 0.5 pL of the enzyme mixed solution, 0.1 L of the ROX reference dye, 5 L of the TPSB standard or the TPSB sample to be tested, and 2.4 L of the nuclease-free water; and the fluorescent quantitative amplification may be conducted by: 42°C for min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 s, for 40 cycles.
[15] The present disclosure provides a primer probe set for RT-PCR detection of a human TPSB mRNA. Compared with immunological detection methods, the primer probe set of the present disclosure has high sensitivity during detection, can detect low-concentration (10 copies/L) clinical samples, can more sensitively detect changes in TPSB content, and has a detection range spanning at least 6 orders of magnitude. Accordingly, the accuracy of the detection results is increased, such that the treatment effect can be dynamically monitored and evaluated in an earlier, more accurate, and faster manner.
[16] FIG. 1 is a process diagram of a dilution operation provided by the present disclosure.
[17] FIG. 2 is a standard curve of a TaqMan real-time fluorescent quantitative RT-PCR for TPSB mRNA provided by the present disclosure.
[18] FIG. 3 is a result of a precision detection provided by the present disclosure. Herein, 1: 1.0x106 copies/4L, and 2: 1.Ox103 copies/L.
[19] FIG. 4 is a result of an accuracy detection provided by the present disclosure.
[20] FIG. 5 is a result of a sensitivity detection provided by the present disclosure.
[21] FIG. 6 is a result of a clinical sample detection provided by the present disclosure. Herein, 1: positive sample 5 GAPDH mRNA; 2: healthy control 3 GAPDH mRNA; 3: positive sample 5 TPSB mRNA; 4: healthy control 3 TPSB mRNA; 5: blank control NTC-GAPDH mRNA; 6: blank control NTC-TPSB mRNA.
[22] FIG 7 is a low-precision amplification curve in the case of non-optimal primer and probe designs provided by the present disclosure.
[23] FIG. 8 is an amplification result of an enzyme mixed solution with the non-optimal ratio and an enzyme mixed solution with the optimal ratio provided by the present disclosure.
[24] The present disclosure provides a primer probe set for RT-PCR detection of a human TPSB mRNA, including a primer TPSB-F, a primer TPSB-R and a probe T-Probe, wherein the primer TPSB-F has a nucleotide sequence shown in SEQ ID NO. 1: 5'-CAGCGAGTGGGCATCGTT-3', the primer TPSB-R has a nucleotide sequence shown in SEQ ID NO.2: '-ATCCTTGACGTCCGGTCCC-3', and the probe T-Probe has a nucleotide sequence shown in SEQ ID NO.3: 5'-AGCCTGAGAGTCCGCGACCGAT-3'.
[25] In the present disclosure, a 5'-end of the probe T-Probe is labeled with a fluorescent reporter group, and a 3'-end of the probe T-Probe is labeled with a quenching group. The fluorescent reporter group preferably includes an FAM or a JOE, and the quenching group preferably includes a BHQ1. A 5'-end of the probe T-Probe is labeled with an FAM fluorescent reporter group, and a 3'-end of the probe T-Probe is labeled with a BHQ1 quenching group.
[26] In the present disclosure, the primer probe set further includes a primer GAPDH-F, a primer GAPDH-R and a probe G-Probe of a reference gene, where the primer GAPDH-F may have a nucleotide sequence shown in SEQ ID NO.4: 5'-GACAACAGCCTCAAGATCATC-3', the primer GAPDH-R may have a nucleotide sequence shown in SEQ ID NO.5: '-CGCCACAGTTTCCCGGAG-3', and the probe G-Probe may have a nucleotide sequence shown in SEQ ID NO.6: 5'-ACTCATGACCACAGTCCATGCCAT-3'. A 5'-end of the probe G-Probe is labeled with a fluorescent reporter group, and a 3'-end of the probe G-Probe is labeled with a quenching group; and the fluorescent reporter group labeled on the probe G-Probe is preferably different from the fluorescent reporter group labeled on the probe T-Probe. The fluorescent reporter group preferably includes an FAM or a JOE, and the quenching group preferably includes a BHQ1. In an example, a 5'-end of the probe G-Probe is labeled with a JOE fluorescent reporter group, and a 3'-end of the probe G-Probe is labeled with a BHQ1 quenching group.
[27] The present disclosure further provides a kit for RT-PCR detection of a human TPSB mRNA, including the primer probe set, a PCR reaction solution, an enzyme mixed solution, a TPSB standard, a ROX reference dye and nuclease-free water.
[28] In the present disclosure, the PCR reaction solution includes a deoxy-ribonucleoside triphosphate (dNTP) mix, MgCl2 and a buffer; the dNTP mix includes a dATP, a dCTP, a dGTP and a dTTP; and the dNTP mix is preferably purchased from Thermo Fisher Scientific (product number: R0192), and has a working concentration of preferably 0.1-1 mM. The MgCl2 has a concentration of preferably 5-20 mM during using; and the buffer is preferably a Tris-HC buffer, more preferably a 10-50 mM Tris-HCl buffer with a pH of preferably 8.0.
[29] In the present disclosure, the enzyme mixed solution includes a Taq enzyme, a reverse transcriptase, an RNase inhibitor and a Taq enzyme antibody with a volume ratio of preferably 14:5:5:1 to obtain the optimal amplification effect. The Taq enzyme is a heat-resistant Taq DNA polymerase, deoxynucleotides in the dNTP are added to a 3-OH terminus one by one using the 3'--5' polymerase activity of the Taq enzyme and using DNA as a template. Meanwhile, mismatched primer ends can be identified and eliminated using the 5'--3' exonuclease activity of the Taq enzyme, which is related to the correction function during the replication, nucleotides can also be hydrolyzed from the 5'-end and mismatched nucleotides can also be excised through several nucleotides. In this way, the chain replacement is realized during the chain extension, and the replaced probe is cut off. The reverse transcriptase can reverse transcribe an mRNA into a cDNA for PCR reaction. The RNase inhibitor is used to suppress the activity of an exogenous RNase. The Taq enzyme antibody is an anti-Taq antibody for hot-start PCR, inhibits DNA polymerase activity after binding to the Taq enzyme, and can effectively suppress the non-specific annealing of primers and the non-specific amplification caused by primer dimers under low temperature. The Taq enzyme antibody is denatured during the initial DNA denaturation of the PCR reaction, and the Taq enzyme recovers the activity to realize PCR amplification.
[30] In the present disclosure, the TPSB standard is preferably an mRNA standard of the TPSB for preparing a quantitative curve.
[31] The present disclosure further provides a method for using the kit, including the following steps: mixing the primer probe set, the PCR reaction solution, the enzyme mixed solution, the TPSB standard or a TPSB sample to be tested, the ROX reference dye and the nuclease-free water, and conducting fluorescent quantitative amplification. The kit adopts a quantitative detection method of one-step RT-PCR technology, which can detect an expression level of the TPSB mRNA in human blood, nasal secretions, bronchial irrigating fluid, saliva, and tear samples.
[32] In the present disclosure, based on 20 pL, a reaction system of the kit preferably includes: 2 pL of the primer probe set, 10 pL of the PCR reaction solution, 0.5 pL of the enzyme mixed solution, 0.1 L of the ROX reference dye, 5 L of the TPSB standard or the TPSB sample to be tested, and 2.4 L of the nuclease-free water. The fluorescent quantitative amplification is preferably conducted by: 42°C for 30 min (reverse transcription); 95°C for 1 min (pre-denaturation); °C for 5 s, and 60°C for 31 s, for 40 cycles.
[33] The primer probe set and the kit for RT-PCR detection of a human TPSB mRNA according to the present disclosure will be further described in detail below with reference to specific examples. The technical solutions of the present disclosure include, but are not limited to, the following examples.
[34] Unless otherwise specified, the experimental methods described in the following examples are all conventional methods. The methods shall be conducted in accordance with the techniques or conditions described in the literature in the art or in accordance with the product specification. The materials and reagents and the like used in the following examples are all commercially available, unless otherwise specified.
[35] Example 1
[36] 1. The reagents and equipment involved were as follows:
[37] 1.1 Reagents
[38] 1.1.1 A whole-blood total RNA kit (Hangzhou Simgen Biological Reagent Development Co., Ltd., product number: 5201050).
[39] 1.1.2 A HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, product number: E2050S).
[40] 1.2 Main instruments
[41] 1.2.1 An Applied Biosystems T M 7300 fluorescent quantitative PCR instrument (Thermo Fisher Scientific, USA).
[42] 1.2.2 A -80°C low-temperature refrigerator (Thermo Fisher Scientific, USA).
[43] 1.2.3 A high-speed and low-temperature table centrifuge (Eppendorf, Germany).
[44] 1.2.4 A Qubit 3 fluorometer (Thermo Fisher Scientific, USA).
[45] 2. Method
[46] 2.1 Design of primers and probes
[47] Fluorescent quantitative primers and probes were designed using a Primer 6.0 software according to the sequence of a TPSB and a GAPDH; after a series of effect verification, primer pairs TPSB-F, TPSB-R, GAPDH-F, GAPDH-R and probes T-Probe, G-Probe of the TPSB and the GAPDH were obtained (Table 1). Primers and probes were synthesized by Shanghai Sunny Biotechnology Co., Ltd.
[48] Table 1 TaqMan real-time fluorescent quantitative PCR of primers and probes Nameof Amplified primers and Use Primer sequence (5'->3') (SEQ ID NO.) fragment size probes TPSB-F CAGCGAGTGGGCATCGTT (1) Fluorescent quantitative TPSB-R ATCCTTGACGTCCGGTCCC (2) amplification of TPSB 168 bp (FAM)-AGCCTGAGAGTCCGCGACCGAT T-Probe cDNA fragment (3)-(BHQ1) GAPDH-F GACAACAGCCTCAAGATCATC (4) Fluorescent quantitative GAPDH-R CGCCACAGTTTCCCGGAG (5) amplification of reference 70 bp (JOE)-ACTCATGACCACAGTCCATGCCAT G-Probe gene GAPDH fragment (6)-(BHQ1)
[49] 2.2. Preparation of a standard
[50] In-vitro transcription: a pGM-T ligation kit [TIANGEN Biotech (Beijing) Co., Ltd., product number: VT202-01] was used, a TPSB plasmid DNA (constructed and synthesized by entrusting Nanjing GenScript Biotech Co., Ltd.) was constructed using a pGM-T as a vector, and the TPSB plasmid DNA was transcribed into an mRNA in vitro using a HiScribe T7 High Yield RNA Synthesis Kit (NEW ENGLAND BioLabs, product number: E2040S).
[51] An initial copy number of RNA was calculated according to a copy number calculation formula: copy number=[6.02x1023xRNA concentration (ng/4L)x10-9]/[RNA length (bp)x340]. The TPSB mRNA was diluted with nuclease-free water to 1.OxIO9 copies/4L to obtain a TPSB mRNA standard.
[52] 2.3. Extraction and dilution of whole-blood RNA: whole-blood total RNA was extracted from ethylenediaminetetraacetic acid (EDTA) anticoagulated whole-blood samples with the whole-blood total RNA kit, quantificated with the Qubit 3 fluorometer and diluted with the nuclease-free water to 20 ng/L.
[53] 2.4 TaqMan real-time fluorescent quantitative PCR
[54] A 20 pL system was prepared using the TPSB mRNA standard or a whole blood RNA as a template, and the system was shown in Table 2:
[551 Table 2 20 pL reaction system PCR Enzyme ROX TPSB mRNA Nuclease-free Primer-probe Total reaction mixed reference standard or water mixed solution volume solution solution dye whole-blood RNA 2.4 tL 10 pL 0.5 pL 0.1 pL 2 tL 5 tL 20 tL
[561 An amplification reaction program was shown in Table 3:
[57] Table 3 Amplification reaction program Stage Temperature Time Number of cycles Other parameter settings Stage 1 42 °C 30 min 1 Detection fluorescein: FAM, JOE Stage 2 95 °C 1 min 1 Reference fluorescence: ROX 95 °C 5 sec Reaction system: 20 pL Stage 3 40 60 °C 31 sec Fluorescence signal collection: Stage 3 60 0C for 31 sec
[58] 2.5 Generation of a standard curve
[59] The TPSB mRNA standard was diluted in a 10-fold gradient using1.0x107-1.0x102 copies/pL as a template, 2 replicates were conducted for each dilution, and TaqMan real-time fluorescent quantitative RT-PCR detection was conducted to generate a standard curve. The dilution operation was shown in FIG. 1. A specification of 50 pL/tube was taken as an example: for each dilution, 5 L of a sample before dilution was added to a new tube containing 45 L of water.
[60] 2.6 Precision detection
[61] 1.0x106 copies/pL and 1.0x103 copies/pL of TPSB mRNA standards were taken as a template, 10 replicates were conducted for each concentration; 10 times of TaqMan real-time fluorescent quantitative RT-PCR detections were conducted, the coefficient of variation of the logarithm of each concentration was calculated, respectively; and statistical analysis was conducted to analyze the precision of the detection method.
[62] 2.7 Accuracy detection
[63] A 1.0x105 copies/pL of TPSB mRNA standard was taken as a template, for 3 replicates; 3 times of TaqMan real-time fluorescent quantitative RT-PCR detections were conducted, and the absolute deviation of the logarithm of each concentration was calculated to analyze the accuracy of the detection method.
[64] 2.8 Sensitivity detection
[65] A 10.0 copies/pL of TPSB mRNA standard was taken as a template, for 25 replicates, 25 times of TaqMan real-time fluorescent quantitative RT-PCR detection were conducted to check whether there were amplifications, and the sensitivity of the detection method was analyzed.
[66] 2.9 Clinical sample detection
[67] Whole-blood samples of positive samples and healthy control were taken to extract and dilute whole-blood RNA according to the steps of 2.3, and TaqMan real-time fluorescent quantitative RT-PCR detection was conducted according to the steps of 2.4.
[68] 3. Experimental results
[69] 3.1 Standard curve
[70] The TPSB mRNA standard was diluted in a 10-fold gradient using .0x107-1.x102
copies/pL as a template, 2 replicates were conducted for each dilution, and TaqMan real-time fluorescent quantitative RT-PCR detection was conducted to generate a standard curve. The standard curve of the TaqMan real-time fluorescent quantitative RT-PCR of the TPSB mRNA is shown in FIG. 2. A copy number logarithm was taken as an abscissa and a Ct value is taken as an ordinate, and a regression equation was obtained: y=-3.46x+38.261 (R 2 =0.996), where the regression equation has R2 =0.996, and a linear range of1.0x10 2-1.0x10 7 copies/pL. It indicates that the copy number logarithm of the standard equation has a very high correlation with the Ct value.
[71] 3.2 Precision detection
[72] 1.Ox106 copies/pL and 1.Ox103 copies/pL of TPSB mRNA standards were taken as templates, 10 replicates were conducted for each concentration; 10 times of TaqMan real-time fluorescent quantitative RT-PCR detections were conducted, the coefficient of variation of the logarithm of each concentration was calculated, respectively; and statistical analysis was conducted. The results are shown in FIG. 3 and Table 4. The coefficient of variation of the logarithm of each concentration is 0.765% and 2.547% separately, which are less than 5%, indicating that the TaqMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has excellent precision.
[73] Table 4 Precision detection result Theoretical copy number Mean of copy number logarithm SD C.V 1.0X106 5.934 0.045 0.765% 1.Ox103 2.916 0.074 2.547%
[74] 3.3 Accuracy detection
[75] A 1.0x105 copies/pL of TPSB mRNA standard was taken as a template, for 3 replicates; 3 times of TaqMan real-time fluorescent quantitative RT-PCR detections were conducted, and the absolute deviation of the logarithm of each concentration was calculated. The results are shown in FIG. 4 and Table 5. The absolute deviation of the logarithm of each concentration is -0.115, -0.079, and -0.103, respectively, within the range of 0.5, indicating that the TaqMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has excellent accuracy.
[76] Table 5 Accuracy detection result Copy number Theoretical copy Theoretical copy Absolute CT Results (copies/pL) logarithm number(copies/pt) number logarithm deviation
21.359 7.674x104 4.885 -0.115
21.234 8.337x104 4.921 1.000x105 5.000 -0.079
21.317 7.889x104 4.897 -0.103
[77] 3.4 Sensitivity detection
[78] A 10.0 copies/pL of TPSB mRNA standard was taken as a template, for 25 replicates, 25 times of TaqMan real-time fluorescent quantitative RT-PCR detection were conducted to check whether there were amplifications. The results are shown in FIG. 5 and Table 6. A total of 25 detection results are obtained, reaching 100%. This indicates that the TaqMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has very high sensitivity, and the minimum of detected copy number is less than 10 copies/pL.
[79] Table 6 Ct value result of sensitivity detection 33.112 33.655 34.996 33.374 33.072
35.019 33.432 34.864 35.830 34.680
33.495 37.118 33.542 33.172 34.855
33.883 34.704 34.883 34.509 33.579
37.455 33.027 34.572 32.982 33.334
[80] 3.5 Clinical sample detection
[81] A comparison result of the present disclosure and an ImmunCAPTM TPSB reagent widely-used abroad are shown in FIG. 6 and Table 7: 182] Table 7 Comparison result TPSB mRNA detection kit (fluorescent RT-PCR) ImmunoCAP Tryptase assay kit SN Sample type Results (copies/ptL) positive/negative Result (pg/L) positive/negative
1 Positive sample 1 47.557 + 20.2 +
2 Positive sample 2 43.548 + 11.2
3 Positive sample 3 48.141 + 29.3 +
4 Positive sample 4 49.271 + 19.8 +
5 Positive sample 5 58.153 + 28.1 +
6 Positive sample 6 46.747 + 19.8 +
7 Healthy control 1 16.597 1.7
8 Healthy control 2 29.077 6.9
9 Healthy control 3 4.183 3.9
10 Healthy control 4 25.252 9.7
[83] In the present disclosure, the detection was conducted using the whole-blood RNA; and the ImmunCAPTMTPSB reagent was detected using a serum.
[84] The above results show that the TaqMan real-time fluorescent quantitative RT-PCR detection method established in the present disclosure has better specificity, and has better sensitivity than imported fluorometric enzyme immunoassay reagents. ) [85] Comparative Example 1
[86] Results of amplification using other non-optimal primers and probes
[87] The primers and probes in the system used in the present disclosure were replaced with other non-optimal primers and probes. An amplification system and a program were the same as those in Example 1. The results are shown in FIG. 7. When non-optimal TPSB primers and probes are used, such as:
[88] TPSB-F: TGCAGCGAGTGGGCATCGT (SEQ ID NO. 7);
[89] TPSB-R: TCTGGGCGGTGTAGAACTGT (SEQ ID NO. 8); and
[90] T-Probe: (FAM)-CACTTCTGCGGGGGCTCCCTC (SEQ ID NO.9)-(BHQ 1).
[91] The coefficient of variation of the logarithm of the low-precision concentration exceeds 5%, reaching 10.267%.
[92] Table 8 Result of the coefficient of variation of the logarithm of the low-precision concentration of non-optimal primers and probes Theoretical copy number Mean of copy number logarithm SD C.V 1.0x 103 2.504 0.257 10.267%
[93] Comparative Example 2
[94] Comparison of the effect of enzyme mixed solution
[95] An amplification was conducted using a non-optimal ratio of enzyme mixed solution (the Taq enzyme, reverse transcriptase, RNase inhibitor and Taq enzyme antibody had a mass ratio of 11:4:3:1) and an optimal ratio of enzyme mixed solution on 3 whole-blood RNA samples with the primers and probes, the amplification system, and the program the same as those in Example 1. The result is shown in FIG. 8. An amplification result using the non-optimal ratio of enzyme mixed solution is shown in FIG. 8A, and an amplification result using the optimal ratio of enzyme mixed solution is shown in FIG. 8B. The concentration of the enzyme mixed solution with different ratios will affect the amplification effect of the samples. A poor amplification effect will lead to a biased and inaccurate result of the obtained final concentration. Therefore, the enzyme mixed solution with optimal ratio should be adopted. In comparison, a Ct value of the amplification result of the enzyme mixed solution with the non-optimal ratio is relatively delayed by more than 3 cycles; and under the enzyme mixed solution with the optimal ratio, the same sample has more consistent repeated results and a smaller difference. It can be seen that the optimal enzyme mixed solution has better amplification effect.
[96] The above descriptions are merely preferred implementations of the present disclosure. It should be noted that a person of ordinary skill in the art may further make several improvements and modifications without departing from the principle of the present disclosure, but such improvements and modifications should be deemed as falling within the protection scope of the present disclosure.
[97] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
[98] The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.
Claims (5)
1. A kit for reverse transcription-polymerase chain reaction (RT-PCR) detection of a human tryptase beta (TPSB) mRNA, comprising a primer probe set for RT-PCR detection of a human TPSB mRNA, a PCR reaction solution, an enzyme mixed solution, a TPSB standard, a carboxy-X-rhodamine (ROX) reference dye and nuclease-free water; wherein the primer probe set comprises a primer TPSB-F, a primer TPSB-R and a probe T-Probe, wherein the primer TPSB-F has a nucleotide sequence shown in SEQ ID NO. 1, the primer TPSB-R has a nucleotide sequence shown in SEQ ID NO.2, and the probe T-Probe has a nucleotide sequence shown in SEQ ID NO.3; a 5'-end of the probe T-Probe is labeled with a fluorescent reporter group, and a 3'-end of the probe T-Probe is labeled with a quenching group; the primer probe set further comprises a primer GAPDH-F, a primer GAPDH-R and a probe G-Probe of a reference gene, wherein the primer GAPDH-F has a nucleotide sequence shown in SEQ ID NO.4, the primer GAPDH-R has a nucleotide sequence shown in SEQ ID NO.5, and the probe G-Probe has a nucleotide sequence shown in SEQ ID NO.6; a 5'-end of the probe G-Probe is labeled with a fluorescent reporter group, and a 3'-end of the probe G-Probe is labeled with a quenching group; and the fluorescent reporter group labeled on the probe G-Probe is different from the fluorescent reporter group labeled on the probe T-Probe; the fluorescent reporter group comprises a 6-carboxyfluorescein (FAM) or a 2,7-dimethyl-4,5-dichloro-6-carboxyfluorescein (JOE), and the quenching group comprises a Black Hole Quencher-i (BHQ1).
2. The kit according to claim 1, wherein the PCR reaction solution comprises a deoxy-ribonucleoside triphosphate (dNTP) mix, MgCl2 and a buffer.
3. The kit according to claim 1, wherein the enzyme mixed solution comprises a thermus aquaticus (Taq) enzyme, a reverse transcriptase, a ribonuclease (RNase) inhibitor and a Taq enzyme antibody.
4. A method for using the kit according to claim 1, 2 or 3, comprising the following steps: mixing the primer probe set, the PCR reaction solution, the enzyme mixed solution, the TPSB standard or a TPSB sample to be tested, the ROX reference dye and the nuclease-free water, and conducting fluorescent quantitative amplification.
5. The method according to claim 4, wherein based on 20 pL, a reaction system of the kit comprises: 2 pL of the primer probe set, 10 pL of the PCR reaction solution, 0.5 pL of the enzyme mixed solution, 0.1 L of the ROX reference dye, 5 L of the TPSB standard or the TPSB sample to be tested, and 2.4 L of the nuclease-free water; and the fluorescent quantitative amplification is conducted by: 42°C for 30 min; 95°C for 1 min; °C for 5 s, and 60°C for 31 s, for 40 cycles.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110890718.2 | 2021-08-04 | ||
| CN202110890718.2A CN113564233A (en) | 2021-08-04 | 2021-08-04 | Primer probe set and kit for human beta-tryptase mRNA RT-PCR detection |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| AU2021106577A4 true AU2021106577A4 (en) | 2021-11-11 |
Family
ID=78170334
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| AU2021106577A Active AU2021106577A4 (en) | 2021-08-04 | 2021-08-23 | Primer probe set and kit for rt-pcr detection of human tryptase beta (tpsb) mrna |
Country Status (4)
| Country | Link |
|---|---|
| CN (1) | CN113564233A (en) |
| AU (1) | AU2021106577A4 (en) |
| NL (1) | NL2030974B1 (en) |
| ZA (1) | ZA202200489B (en) |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6274366B1 (en) * | 1998-05-15 | 2001-08-14 | Promega Corporation | Enzymatically-active recombinant human β-tryptase and method of making same |
| US20120088246A1 (en) * | 2010-10-07 | 2012-04-12 | Samsung Techwin Co., Ltd. | Real time pcr detection of single nucleotide polymorphisms |
| CN110592290B (en) * | 2019-10-31 | 2022-10-04 | 上海市动物疫病预防控制中心 | Kit and method for detecting feline calicivirus |
| CN110699489B (en) * | 2019-11-12 | 2020-12-22 | 南宁众册生物科技有限公司 | Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene |
| CN112877469A (en) * | 2019-11-29 | 2021-06-01 | 中国疾病预防控制中心病毒病预防控制所 | Real-time PCR detection method of human H group rotavirus |
| CN110894534A (en) * | 2019-12-23 | 2020-03-20 | 郑州安图生物工程股份有限公司 | Primer, probe, kit and detection method for detecting mycoplasma genitalium |
| CN111304368A (en) * | 2020-03-19 | 2020-06-19 | 艾康生物技术(杭州)有限公司 | Method, oligonucleotide and kit for detecting novel coronavirus |
| WO2023010326A1 (en) * | 2021-08-04 | 2023-02-09 | 杭州浙大迪迅生物基因工程有限公司 | PRIMER-PROBE SET AND KIT FOR HUMAN β-TRYPTASE MRNA RT-PCR DETECTION |
-
2021
- 2021-08-04 CN CN202110890718.2A patent/CN113564233A/en active Pending
- 2021-08-23 AU AU2021106577A patent/AU2021106577A4/en active Active
-
2022
- 2022-01-11 ZA ZA2022/00489A patent/ZA202200489B/en unknown
- 2022-02-16 NL NL2030974A patent/NL2030974B1/en active
Also Published As
| Publication number | Publication date |
|---|---|
| ZA202200489B (en) | 2022-03-30 |
| CN113564233A (en) | 2021-10-29 |
| NL2030974B1 (en) | 2023-02-24 |
| NL2030974A (en) | 2023-02-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2022057060A1 (en) | Method and kit for multiple detection of respiratory virus nucleic acids | |
| WO2022007224A1 (en) | Method, composition and kit for fluorescent quantitative pcr, and use thereof | |
| CN103397107B (en) | Bovine viral diarrhea virus (BVDV) fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit | |
| WO2023025259A1 (en) | Method and kit for detecting microrna | |
| WO2023010326A1 (en) | PRIMER-PROBE SET AND KIT FOR HUMAN β-TRYPTASE MRNA RT-PCR DETECTION | |
| CN112695134A (en) | Novel coronavirus COVID-19 nucleic acid detection primer group, probe group, detection kit and detection method | |
| CN112662809A (en) | Nucleic acid composition for detecting novel coronavirus COVID-19 and application thereof | |
| AU2021106592A4 (en) | Primer set for detection of expression of human eosinophil cationic protein (ecp) mrna and kit | |
| AU2021106588A4 (en) | Primer probe set and kit for rt-pcr detection of human leukotriene receptor cysltr2 mrna | |
| AU2021106577A4 (en) | Primer probe set and kit for rt-pcr detection of human tryptase beta (tpsb) mrna | |
| CN112662808A (en) | Novel coronavirus COVID-19 nucleic acid detection kit and detection method thereof | |
| AU2021106586A4 (en) | Reagent for detecting expression level of human histamine receptor hrh4 mrna, kit and use | |
| EP4289968A1 (en) | Primer-probe set and kit for human leukotriene receptor cysltr1 mrna rt-pcr detection | |
| US20240158856A1 (en) | Primer probe set for human histamine receptor hrh1 mrna detection, kit and detection method | |
| US20240150832A1 (en) | Reagent for detecting expression level of human histamine receptor hrh4 mrna, kit and detection method | |
| CN114959081A (en) | Primer and probe for detecting mycoplasma gallisepticum by LAMP-Taqman and application of primer and probe | |
| AU2021106581A4 (en) | Primer probe set and kit for rt-pcr detection of human leukotriene receptor cysltr1 mrna | |
| CN114410842A (en) | Nucleic acid detection kit, primer probe set and detection method for four enteroviruses | |
| AU2021106574A4 (en) | Primer probe set for human histamine receptor hrh1 mrna detection, kit and use | |
| WO2023010325A1 (en) | Primer set for detecting expression of human eosinophil cationic protein mrna, kit, and detection method | |
| US20210214809A1 (en) | One-step detection kit for molecular diagnostics of sars-cov-2 virus | |
| CN116515840B (en) | Kit and detection method for detecting bovine viral diarrhea virus type 3 | |
| WO2023010327A1 (en) | Primer probe set and test kit for rt-pcr detection of human leukotriene receptor cysltr2 mrna | |
| KR102572368B1 (en) | Primer set for detection and identification of parainfluenza virus type 1 and type 3 and use thereof | |
| Seprianto et al. | Optimization of Da An Gene Kit for SARS-CoV-2 Detection in Real-Time RT-PCR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FGI | Letters patent sealed or granted (innovation patent) |