NL2030974A - Primer probe set and kit for rt-pcr detection of human tryptase beta (tpsb) mrna - Google Patents
Primer probe set and kit for rt-pcr detection of human tryptase beta (tpsb) mrna Download PDFInfo
- Publication number
- NL2030974A NL2030974A NL2030974A NL2030974A NL2030974A NL 2030974 A NL2030974 A NL 2030974A NL 2030974 A NL2030974 A NL 2030974A NL 2030974 A NL2030974 A NL 2030974A NL 2030974 A NL2030974 A NL 2030974A
- Authority
- NL
- Netherlands
- Prior art keywords
- probe
- tpsb
- primer
- seq
- kit
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present disclosure relates to a primer probe set and a kit for reverse transcription—polymerase chain reaction (RT—PCR) detection of a human tryptase beta (TPSB) mRNA, belonging to the technical field, of biological detection. In the present disclosure, the primer probe set includes a primer TPSB—F, a primer TPSB—R and a probe T—Probe, where the primer TPSB—F has a nucleotide sequence shown in SEQ ID NO. l, the primer TPSB—R has a nucleotide sequence shown in SEQ ID NO.2, and the probe T—Probe has a nucleotide sequence shown. in SEQ ID No.3. The primer‘ probe set of TagMan real—time fluorescent quantitative one—step RT—PCR detection is established for a human TPSB, and the primer probe set provides a detection method with high accuracy, wide detection range and high sensitivity for the TPSB protein.
Description
P1054 /NL
PRIMER PROBE SET AND KIT FOR RT-PCR DETECTION OF HUMAN TRYPTASE
BETA (TPSB) MRNA
The present disclosure belongs to the technical field of bio- logical detection, and specifically relates to a primer probe set and a kit for reverse transcription-polymerase chain reaction (RT-
PCR) detection of a human tryptase beta (TPSB) mRNA.
Mast cells (MCs) are activated in allergic reactions to re- lease inflammatory mediators including a tryptase. This process leads to the symptoms and signs of the allergic reactions. The tryptase has the functions of promoting airway repair, regulating the tension and responsiveness of airway smooth muscle cells (SMCs), and stimulating the activation of MCs and the like. At present, the tryptase is divided into three categories at cDNA and protein levels: a tryptase alpha, a tryptase beta, and a tryptase gamma, where the tryptase beta has the highest content. After an allergic reaction occurs, a transient increase of the tryptase be- ta (TPSB) level in blood circulation helps to identify and evalu- ate the extent of the allergic reaction. Samples for measuring the transient increase of TPSB level should be collected within 15 minutes to 3 hours after the allergic reaction occurs. The transi- ent increase of the TPSB level in the blood indicates that medi- cines, insect venoms, or foods cause an allergic reaction, and a long-lasting and elevated TPSB level may indicate mastocytosis or hematological tumors. An increase in the TPSB level (or concentra- tion) in nasal secretions indicates that patients with active al- lergic rhinitis or allergic rhinitis are undergeing an allergen challenge test.
At present, the detection of the content of TPSB in the body fluids is still detected using an enzyme-linked immunosorbent as- say (ELISA) kit. There is no commercial kit for detecting the TPSB mRNA. The ELISA method has the problems of small detection range,
low sensitivity and unsatisfactory accuracy during the detection.
The purpose of the present disclosure is to provide a primer probe set and a kit for RT-PCR detection of a human TPSB mRNA. The primer probe set of TagMan real-time fluorescent quantitative one- step RT-PCR detection is established for a human TPSB, and the primer probe set provides a detection method with high accuracy, wide detection range and high sensitivity for the TPSB protein.
The present disclosure provides a primer probe set for RT-PCR detection of a human TPSB mRNA, including a primer TPSB-F, a pri- mer TPSB-R and a probe T-Probe, wherein the primer TPSB-F has a nucleotide sequence shown in SEQ ID NO. 1, the primer TPSB-R has a nucleotide sequence shown in SEQ ID NO.2, and the probe T-Probe has a nucleotide sequence shown in SEQ ID NO.3.
Preferably, a 5'-end of the probe T-Probe may be labeled with a fluorescent reporter group, and a 3'-end of the probe T-Probe may be labeled with a quenching group.
Preferably, the primer probe set may further include a primer
GAPDH-F, a primer GAPDH-R and a probe G-Probe of a reference gene, where the primer GAPDH-F may have a nucleotide sequence shown in
SEQ ID NO.4, the primer GAPDH-R may have a nucleotide sequence shown in SEQ ID NO.5, and the probe G-Probe may have a nucleotide sequence shown in SEQ ID NO.6.
Preferably, a 5'-end of the probe G-Probe may be labeled with a fluorescent reporter group, and a 3'-end of the probe G-Probe may be labeled with a quenching group; and the fluorescent report- er group labeled on the probe G-Probe may be different from the fluorescent reporter group labeled on the probe T-Probe.
Preferably, the fluorescent reporter group may include a 6- carboxyfluorescein (FAM) or a 2,7-dimethyl-4,5-dichloro-6- carboxyfluorescein (JOE), and the guenching group may include a
Black Hole Quencher-1 (BHQ1).
The present disclosure further provides a kit for RT-PCR de- tection of a human TPSB mRNA, including the primer probe set, a
PCR reaction solution, an enzyme mixed solution, a TPSB standard, a carboxy-X-rhodamine (ROX) reference dye and nuclease-free water.
Preferably, the PCR reaction solution may include a deoxy- ribonucleoside triphosphate (dNTP) mix, MgCl. and a buffer.
Preferably, the enzyme mixed solution may include a thermus aquaticus (Tag) enzyme, a reverse transcriptase, a ribonuclease (RNase) inhibitor and a Tag enzyme antibody.
The present disclosure further provides a method for using the kit, including the following steps: mixing the primer probe set, the PCR reaction solution, the enzyme mixed solution, the
TPSB standard or a TPSB sample to be tested, the ROX reference dye and the nuclease-free water, and conducting fluorescent quantita- tive amplification.
Preferably, based on 20 pL, a reaction system of the kit may include: 2 pL of the primer probe set, 10 pL of the PCR reaction solution, 0.5 pL of the enzyme mixed solution, 0.1 pL of the ROX reference dye, 5 pL of the TPSB standard or the TPSB sample to be tested, and 2.4 uL of the nuclease-free water; and the fluorescent guantitative amplification may be conducted by: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 s, for 40 cycles.
The present disclosure provides a primer probe set for RT-PCR detection of a human TPSB mRNA. Compared with immunological detec- tion methods, the primer probe set of the present disclosure has high sensitivity during detection, can detect low-concentration {10 copies/uL) clinical samples, can more sensitively detect changes in TPSB content, and has a detection range spanning at least 6 orders of magnitude. Accordingly, the accuracy of the de- tection results is increased, such that the treatment effect can be dynamically monitored and evaluated in an earlier, more accu- rate, and faster manner.
FIG. 1 is a process diagram of a dilution operation provided by the present disclosure.
FIG. 2 is a standard curve of a TagMan real-time fluorescent quantitative RT-PCR for TPSB mRNA provided by the present disclo- sure.
FIG. 3 is a result of a precision detection provided by the present disclosure. Herein, 1: 1.0x10° copies/uL, and 2: 1.0x10?
copies/uL.
FIG. 4 is a result of an accuracy detection provided by the present disclosure.
FIG. 5 is a result of a sensitivity detection provided by the present disclosure.
FIG. 6 is a result of a clinical sample detection provided by the present disclosure. Herein, 1: positive sample 5 GAPDH mRNA; 2: healthy control 3 GAPDH mRNA; 3: positive sample 5 TPSB mRNA; 4: healthy control 3 TPSB mRNA; 5: blank control NTC-GAPDH mRNA; 6: blank control NTC-TPSB mRNA.
FIG 7 is a low-precision amplification curve in the case of non-optimal primer and probe designs provided by the present dis- closure.
FIG. 8 is an amplification result of an enzyme mixed solution with the non-optimal ratio and an enzyme mixed solution with the optimal ratio provided by the present disclosure.
The present disclosure provides a primer probe set for RT-PCR detection of a human TPSB mRNA, including a primer TPSB-F, a pri- mer TPSB-R and a probe T-Probe, wherein the primer TPSB-F has a nucleotide sequence shown in SEQ ID NO. 1: 5'-CAGCGAGTGGGCATCGTT- 3', the primer TPSB-R has a nucleotide sequence shown in SEQ ID
NO.2: 5'"-ATCCTTGACGTCCGGTCCC-3', and the probe T-Probe has a nu- cleotide sequence shown in SEQ ID NO.3: 5'-AGCCTGAGAGTCCGCGACCGAT- 3.
In the present disclosure, a 5'-end of the probe T-Probe is labeled with a fluorescent reporter group, and a 3'-end of the probe T-Probe is labeled with a quenching group. The fluorescent reporter group preferably includes an FAM or a JOE, and the quenching group preferably includes a BHQ1. A 5'-end of the probe
T-Probe is labeled with an FAM fluorescent reporter group, and a 3'-end of the probe T-Probe is labeled with a BHQ1 quenching group.
In the present disclosure, the primer probe set further in- cludes a primer GAPDH-F, a primer GAPDH-R and a probe G-Probe of a reference gene, where the primer GAPDH-F may have a nucleotide se-
quence shown in SEQ ID NO.4: 5'-GACAACAGCCTCAAGATCATC-3', the pri- mer GAPDH-R may have a nucleotide sequence shown in SEQ ID NO.5: 5'-CGCCACAGTTTCCCGGAG-3"', and the probe G-Probe may have a nucleo- tide sequence shown in SEQ ID NO.6: 5'-ACTCATGACCACAGTCCATGCCAT- 5 3'. A 5'-end of the probe G-Probe is labeled with a fluorescent reporter group, and a 3'-end of the probe G-Probe is labeled with a quenching group; and the fluorescent reporter group labeled on the probe G-Probe is preferably different from the fluorescent re- porter group labeled on the probe T-Probe. The fluorescent report- er group preferably includes an FAM or a JOE, and the quenching group preferably includes a BHQ1. In an example, a 5'-end of the probe G-Probe is labeled with a JOE fluorescent reporter group, and a 3'-end of the probe G-Probe is labeled with a BHQ1 quenching group.
The present disclosure further provides a kit for RT-PCR de- tection of a human TPSB mRNA, including the primer probe set, a
PCR reaction solution, an enzyme mixed solution, a TPSB standard, a ROX reference dye and nuclease-free water.
In the present disclosure, the PCR reaction solution includes a deoxy-ribonucleoside triphosphate (dNTP) mix, MgCl, and a buffer; the dNTP mix includes a dATP, a dCTP, a dGTP and a dTTP; and the dNTP mix is preferably purchased from Thermo Fisher Scientific {product number: R0192), and has a working concentration of pref- erably 0.1-1 mM. The MgCl, has a concentration of preferably 5-20 mM during using; and the buffer is preferably a Tris-HCl buffer, more preferably a 10-50 mM Tris-HCl buffer with a pH of preferably 8.0.
In the present disclosure, the enzyme mixed solution includes a Taq enzyme, a reverse transcriptase, an RNase inhibitor and a
Tag enzyme antibody with a volume ratio of preferably 14:5:5:1 to obtain the optimal amplification effect. The Taq enzyme is a heat- resistant Tag DNA polymerase, deoxynucleotides in the dNTP are added to a 3-0H terminus one by one using the 3'35' polymerase ac- tivity of the Taq enzyme and using DNA as a template. Meanwhile, mismatched primer ends can be identified and eliminated using the 53! exonuclease activity of the Tag enzyme, which is related to the correction function during the replication, nucleotides can also be hydrolyzed from the 5'-end and mismatched nucleotides can also be excised through several nucleotides. In this way, the chain replacement is realized during the chain extension, and the replaced probe is cut off. The reverse transcriptase can reverse transcribe an mRNA into a cDNA for PCR reaction. The RNase inhibi- tor is used to suppress the activity of an exogenous RNase. The
Tag enzyme antibody is an anti-Tagq antibody for hot-start PCR, in- hibits DNA polymerase activity after binding to the Tag enzyme, and can effectively suppress the non-specific annealing of primers and the non-specific amplification caused by primer dimers under low temperature. The Taq enzyme antibody is denatured during the initial DNA denaturation of the PCR reaction, and the Tag enzyme recovers the activity to realize PCR amplification.
In the present disclosure, the TPSB standard is preferably an mRNA standard of the TPSB for preparing a quantitative curve.
The present disclosure further provides a method for using the kit, including the following steps: mixing the primer probe set, the PCR reaction solution, the enzyme mixed solution, the
TPSB standard or a TPSB sample to be tested, the ROX reference dye and the nuclease-free water, and conducting fluorescent quantita- tive amplification. The kit adopts a quantitative detection method of one-step RT-PCR technology, which can detect an expression lev- el of the TPSB mRNA in human blood, nasal secretions, bronchial irrigating fluid, saliva, and tear samples.
In the present disclosure, based on 20 pL, a reaction system of the kit preferably includes: 2 pL of the primer probe set, 10 pL of the PCR reaction solution, 0.5 pL of the enzyme mixed solu- tion, 0.1 pL of the ROX reference dye, 5 pL of the TPSB standard or the TPSB sample to be tested, and 2.4 |L of the nuclease-free water. The fluorescent quantitative amplification is preferably conducted by: 42°C for 30 min (reverse transcription); 95°C for 1 min (pre-denaturation}; 95°C for 5 s, and 60°C for 31 s, for 40 cycles.
The primer probe set and the kit for RT-PCR detection of a human TPSB mRNA according to the present disclosure will be fur- ther described in detail below with reference to specific exam- ples. The technical solutions of the present disclosure include,
but are not limited to, the following examples.
Unless otherwise specified, the experimental methods de- scribed in the following examples are all conventional methods.
The methods shall be conducted in accordance with the techniques or conditions described in the literature in the art or in accord- ance with the product specification. The materials and reagents and the like used in the following examples are all commercially available, unless otherwise specified.
Example 1 1. The reagents and equipment involved were as follows: 1.1 Reagents 1.1.1 A whole-blood total RNA kit (Hangzhou Simgen Biological
Reagent Development Co., Ltd., product number: 5201050). 1.1.2 A HiScribe T7 High Yield RNA Synthesis Kit (New England
Biolabs, product number: E20508). 1.2 Main instruments 1.2.1 An Applied Biosystems™ 7300 fluorescent quantitative
PCR instrument (Thermo Fisher Scientific, USA). 1.2.2 A -80°C low-temperature refrigerator (Thermo Fisher
Scientific, USA). 1.2.3 A high-speed and low-temperature table centrifuge (Ep- pendorf, Germany). 1.2.4 A Qubit 3 fluorometer (Thermo Fisher Scientific, USA). 2. Method 2.1 Design of primers and probes
Fluorescent quantitative primers and probes were designed us- ing a Primer 6.0 software according to the sequence of a TPSB and a GAPDH; after a series of effect verification, primer pairs TPSB-
F, TPSB-R, GAPDH-F, GAPDH-R and probes T-Probe, G-Probe of the
TPSB and the GAPDH were obtained (Table 1). Primers and probes were synthesized by Shanghai Sunny Biotechnology Co., Ltd.
Table 1 TagMan real-time fluorescent quantitative PCR of pri- mers and probes
Name of pri- Amplified mers and Use Primer sequence (5'>3'} (SEQ ID NO.) | fragment probes size
Fluorescent quantitative hn ATCCTTGACGTCCGGTCCC (2) amplification of TPSB cDNA 168 bp {FAM)-AGCCTGAGAGTCCGCGACCGAT
T-Probe fragment i
Fluorescent quantitative amplification of reference {JOE)- 70 bp
G-Probe gene GAPDH fragment ACTCATGACCACAGTCCATGCCAT (6)- {BHQ1) 2.2. Preparation of a standard
In-vitro transcription: a pGM-T ligation kit [TIANGEN Biotech (Beijing) Co., Ltd., product number: VT202-01] was used, a TPSB plasmid DNA (constructed and synthesized by entrusting Nanjing
GenScript Biotech Co., Ltd.) was constructed using a pGM-T as a vector, and the TPSB plasmid DNA was transcribed into an mRNA in vitro using a HiScribe T7 High Yield RNA Synthesis Kit (NEW ENG-
LAND BioLabs, product number: E2040S).
An initial copy number of RNA was calculated according to a copy number calculation formula: copy number=[6.02x10°°xRNA concen- tration (ng/pL)x107°]1/ [RNA length (bp)x340]. The TPSB mRNA was di- luted with nuclease-free water to 1.0x10° copies/uL to obtain a
TPSB mRNA standard. 2.3. Extraction and dilution of whole-blood RNA: whole-blood total RNA was extracted from ethylenediaminetetraacetic acid (EDTA) anticoagulated whole-blood samples with the whole-blood to- tal RNA kit, quantificated with the Qubit 3 fluorometer and dilut- ed with the nuclease-free water to 20 ng/uL. 2.4 TagMan real-time fluorescent quantitative PCR
A 20 pL system was prepared using the TPSB mRNA standard or a whole blood RNA as a template, and the system was shown in Table 2:
Table 2 20 pL reaction system
PCR re- Enzyme ROXref- Primer- TPSB mRNA
Nuclease- Total action mixed erence probe mixed standard or free water volume solution solution dye solution whole-blood RNA 24uL 10ul 05pL Olp 2pt Sul 20ub
An amplification reaction program was shown in Table 3:
Table 3 Amplification reaction program se Number of
Stage | Temperature | Time i Other parameter settings : cycles
Stagel | 42°C | 1 min Reference fluorescence: ROX
Stage 2 | 95 °C | 1min 11 Reaction system: 20 uL
TTET Fluorescence signal collection: Stage 3 60°C for
Stage3 . 40 60°C 31sec 31 sec 2.5 Generation of a standard curve
The TPSB mRNA standard was diluted in a 10-fold gradient us- ing 1.0x107-1.0x10° copies/pL as a template, 2 replicates were con- ducted for each dilution, and TagMan real-time fluorescent quanti- tative RT-PCR detection was conducted to generate a standard curve. The dilution operation was shown in FIG. 1. A specification of 50 pL/tube was taken as an example: for each dilution, 5 pL of a sample before dilution was added to a new tube containing 45 pL of water. 2.6 Precision detection 1.0x10° copies/nL and 1.0x10° copies/nL of TPSB mRNA standards were taken as a template, 10 replicates were conducted for each concentration; 10 times of TagMan real-time fluorescent quantita- tive RT-PCR detections were conducted, the coefficient of varia- tion of the logarithm of each concentration was calculated, re- spectively; and statistical analysis was conducted to analyze the precision of the detection method. 2.7 Accuracy detection
A 1.0x10° copies/uL of TPSB mRNA standard was taken as a tem- plate, for 3 replicates; 3 times of TagMan real-time fluorescent quantitative RT-PCR detections were conducted, and the absolute deviation of the logarithm of each concentration was calculated to analyze the accuracy of the detection method.
2.8 Sensitivity detection
A 10.0 copies/pL of TPSB mRNA standard was taken as a tem- plate, for 25 replicates, 25 times of TagMan real-time fluorescent quantitative RT-PCR detection were conducted to check whether there were amplifications, and the sensitivity of the detection method was analyzed. 2.9 Clinical sample detection
Whole-blood samples of positive samples and healthy control were taken to extract and dilute whole-blood RNA according to the steps of 2.3, and TagMan real-time fluorescent quantitative RT-PCR detection was conducted according to the steps of 2.4. 3. Experimental results 3.1 Standard curve
The TPSB mRNA standard was diluted in a 10-fold gradient us- ing 1.0x107-1.0x10° copies/pL as a template, 2 replicates were con- ducted for each dilution, and TagMan real-time fluorescent quanti- tative RT-PCR detection was conducted to generate a standard curve. The standard curve of the TaqMan real-time fluorescent quantitative RT-PCR of the TPSB mRNA is shown in FIG. 2. A copy number logarithm was taken as an abscissa and a Ct value is taken as an ordinate, and a regression equation was obtained: y=- 3.46x+38.261 (R?=0.996), where the regression equation has
Rè2=0.996, and a linear range of 1.0x10°-1.0x10" copies/pL. It indi- cates that the copy number logarithm of the standard equation has a very high correlation with the Ct value. 3.2 Precision detection 1.0x10° copies/uL and 1.0x10° copies/uL of TPSB mRNA standards were taken as templates, 10 replicates were conducted for each concentration; 10 times of TagMan real-time fluorescent quantita- tive RT-PCR detections were conducted, the coefficient of varia- tion of the logarithm of each concentration was calculated, re- spectively; and statistical analysis was conducted. The results are shown in FIG. 3 and Table 4. The coefficient of variation of the logarithm of each concentration is 0.765% and 2.547% separate- ly, which are less than 5%, indicating that the TagMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has excellent precision.
Table 4 Precision detection result
SD C.V number logarithm 3.3 Accuracy detection
A 1.0x10° copies/uL of TPSB mRNA standard was taken as a tem- plate, for 3 replicates; 3 times of TagMan real-time fluorescent quantitative RT-PCR detections were conducted, and the absolute deviation of the logarithm of each concentration was calculated.
The results are shown in FIG. 4 and Table 5. The absolute devia- tion of the logarithm of each concentration is -0.115, -0.079, and -0.103, respectively, within the range of +0.5, indicating that the TagMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has excellent accura- cy.
Table 5 Accuracy detection result - Een Ea
Results Absolute
Cy ber loga- | copy number | copy number (copies/L) deviation rithm {copies/uL) | logarithm 8.337x10° 1.000x10° 5.000 3.4 Sensitivity detection
A 10.0 copies/pL of TPSB mRNA standard was taken as a tem- plate, for 25 replicates, 25 times of TagMan real-time fluorescent quantitative RT-PCR detection were conducted to check whether there were amplifications. The results are shown in FIG. 5 and Ta- ble 6. A total of 25 detection results are obtained, reaching 100%. This indicates that the TaqMan real-time fluorescent quanti- tative RT-PCR detection method established by the present disclo- sure has very high sensitivity, and the minimum of detected copy number is less than 10 copies/uL.
Table 6 Ct value result of sensitivity detection 33.112 | 33.655 | 34.996 | 33.374 | 33.072 35.019 | 33.432 | 34.864 | 35.830 | 34.680 33.495 | 37.118 | 33.542 | 33.172 | 34.855 33.883 | 34.704 | 34.883 | 34.509 | 33.579 37.455 | 33.027 | 34.572 | 32.982 | 33.334 3.5 Clinical sample detection
A comparison result of the present disclosure and an Immun-
CAP" TPSB reagent widely-used abroad are shown in FIG. 6 and Table 7:
Table 7 Comparison result
TPSB mRNA detection kit (fluorescent RT-PCR} | ImmunoCAP Tryptase assay kit
SN | Sample type
Results {copies/uL} Result (ug/L) | positive/negative
Positive 1 47.557 + 20.2 + sample 1
Positive 43.548 + 11.2 - sample 2
Positive 48.141 + 29.3 + sample 3
Positive 49.271 + 19.8 + sample 4
Positive 58.153 + 28.1 + sample 5
Positive 6 46.747 + 19.8 + sample 6
Healthy con- 7 16.597 1.7 trol 1
Healthy con- 29.077 troi 2
Healthy con- 9 4.183 3.9 trol 3
Healthy con- 25.252 9.7 trol 4
In the present disclosure, the detection was conducted using the whole-blood RNA; and the ImmunCAP™ TPSB reagent was detected using a serum. 10 The above results show that the TagMan real-time fluorescent quantitative RT-PCR detection method established in the present disclosure has better specificity, and has better sensitivity than imported fluorometric enzyme immuncassay reagents.
Comparative Example 1
Results of amplification using other non-optimal primers and probes
The primers and probes in the system used in the present dis- closure were replaced with other non-optimal primers and probes.
An amplification system and a program were the same as those in
Example 1. The results are shown in FIG. 7. When non-optimal TPSB primers and probes are used, such as:
TPSB-F: TGCAGCGAGTGGGCATCGT (SEQ ID NO. 7);
TPSB-R: TCTGGGCGGTGTAGAACTGT (SEQ ID NO. 8); and
T-Probe: (FAM)-CACTTCTGCGGGGGCTCCCTC (SEQ ID NO.9)-(BHQ1).
The coefficient of variation of the logarithm of the low- precision concentration exceeds 5%, reaching 10.267%.
Table 8 Result of the coefficient of variation of the loga- rithm of the low-precision concentration of non-optimal primers and probes
SD C.V number rithm ee
Comparative Example 2
Comparison of the effect of enzyme mixed solution
An amplification was conducted using a non-optimal ratio of enzyme mixed solution (the Tag enzyme, reverse transcriptase,
RNase inhibitor and Tag enzyme antibody had a mass ratio of 11:4:3:1) and an optimal ratio of enzyme mixed solution on 3 whole-blood RNA samples with the primers and probes, the amplifi- cation system, and the program the same as those in Example 1. The result is shown in FIG. 8. An amplification result using the non- optimal ratio of enzyme mixed solution is shown in FIG. 8A, and an amplification result using the optimal ratio of enzyme mixed solu- tion is shown in FIG. 8B. The concentration of the enzyme mixed solution with different ratios will affect the amplification ef- fect of the samples. A poor amplification effect will lead to a biased and inaccurate result of the obtained final concentration.
Therefore, the enzyme mixed solution with optimal ratio should be adopted. In comparison, a Ct value of the amplification result of the enzyme mixed solution with the non-optimal ratio is relatively delayed by more than 3 cycles; and under the enzyme mixed solution with the optimal ratio, the same sample has more consistent re- peated results and a smaller difference. It can be seen that the optimal enzyme mixed solution has better amplification effect.
The above descriptions are merely preferred implementations of the present disclosure. It should be noted that a person of or- dinary skill in the art may further make several improvements and modifications without departing from the principle of the present disclosure, but such improvements and modifications should be deemed as falling within the protection scope of the present dis- closure.
<110> Hangzhou Zheda Dixun Biological Gene Engineering Co., Ltd <120> PRIMER PROBE SET AND KIT FOR RT-PCR DETECTION OF HUMAN TRYPTASE <130> HKJP2021121069 <150> 202110890718.2 <151> 2021-08-04 <160> 9 <170> Patentin version 3.5 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer TPSB-F <400> 1 cagcgagigg gcatcgtt 18 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer TPSB-R
<400> 2 atccttgacg tccggtccc 19
<210> 3 <211> 22 <212> DNA <213> Artificial Sequence
<220> <223> DNA segunce of T-Probe <400> 3 agcctgagag tccgcgaccg at 22 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer GAPDH-F
<400> 4 gacaacagcc tcaagatcat C 21 <210> 5 <211> 18 <212> DNA <213> Artificial Seguence
<220> <223> Primer GAPDH-R <400> 5 cgccacagtt tcccggag 18 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of G-Probe
<400> 6 actcatgacc acagtccatg ccat 24 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Non-optimal TPSB primer TPSB-F <400> 7 tgcagcgagt gggcatcgt 19
<210> 8 <211> 20 <212> DNA
<213> Artificial Sequence <220> <223> Non-optimal TPSB primer TPSB-R
<400> 8 tctgggcggt gtagaactgt 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of non-optimal TPSB probe T-Probe <400> 9 cacttctgcg ggggcteect C 21
<110> Hangzhou Zheda Dixun Biological Gene Engineering Co., Ltd <120> PRIMER PROBE SET AND KIT FOR RT-PCR DETECTION OF HUMAN TRYPTASE <130> HKJIP2021121069 <150> 202110890718.2 <151> 2021-08-04 <160> 9 <170> PatentIn version 3.5 <21e> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer TPSB-F <400> 1 cagcgagtgg gcatcgtt 18 <2105 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer TPSB-R <400> 2 atccttgacg tccggtccc 19 <2105 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> DNA sequnce of T-Probe <400> 3 agcctgagag tccgcgaccg at 22 <2105 4 <211> 21 <212> DNA
<213> Artificial Sequence
<220>
<223> Primer GAPDH-F
<400> 4 gacaacagcc tcaagatcat c 21 <210>5 5
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer GAPDH-R
<400> 5 cgccacagtt tcccggag 18 <210> 6
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA sequence of G-Probe
<400> 6 actcatgacc acagtccatg ccat 24 <210> 7
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Non-optimal TPSB primer TPSB-F
<400> 7 tgcagcgagt gggcatcgt 19 <2105 8
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Non-optimal TPSB primer TPSB-R
<400> 8 tctgggcggt gtagaactgt 20 <216> 9
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA sequence of non-optimal TPSB probe T-Probe
<400> 9 cacttctgcg ggggctccct c 21
Claims (10)
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110890718.2A CN113564233A (en) | 2021-08-04 | 2021-08-04 | Primer probe set and kit for human beta-tryptase mRNA RT-PCR detection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| NL2030974A true NL2030974A (en) | 2023-02-15 |
| NL2030974B1 NL2030974B1 (en) | 2023-02-24 |
Family
ID=78170334
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| NL2030974A NL2030974B1 (en) | 2021-08-04 | 2022-02-16 | Primer probe set and kit for rt-pcr detection of human tryptase beta (tpsb) mrna |
Country Status (4)
| Country | Link |
|---|---|
| CN (1) | CN113564233A (en) |
| AU (1) | AU2021106577A4 (en) |
| NL (1) | NL2030974B1 (en) |
| ZA (1) | ZA202200489B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111304368A (en) * | 2020-03-19 | 2020-06-19 | 艾康生物技术(杭州)有限公司 | Method, oligonucleotide and kit for detecting novel coronavirus |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6274366B1 (en) * | 1998-05-15 | 2001-08-14 | Promega Corporation | Enzymatically-active recombinant human β-tryptase and method of making same |
| US20120088246A1 (en) * | 2010-10-07 | 2012-04-12 | Samsung Techwin Co., Ltd. | Real time pcr detection of single nucleotide polymorphisms |
| CN110592290B (en) * | 2019-10-31 | 2022-10-04 | 上海市动物疫病预防控制中心 | Kit and method for detecting feline calicivirus |
| CN110699489B (en) * | 2019-11-12 | 2020-12-22 | 南宁众册生物科技有限公司 | Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene |
| CN112877469A (en) * | 2019-11-29 | 2021-06-01 | 中国疾病预防控制中心病毒病预防控制所 | Real-time PCR detection method of human H group rotavirus |
| CN110894534A (en) * | 2019-12-23 | 2020-03-20 | 郑州安图生物工程股份有限公司 | Primer, probe, kit and detection method for detecting mycoplasma genitalium |
| WO2023010326A1 (en) * | 2021-08-04 | 2023-02-09 | 杭州浙大迪迅生物基因工程有限公司 | PRIMER-PROBE SET AND KIT FOR HUMAN β-TRYPTASE MRNA RT-PCR DETECTION |
-
2021
- 2021-08-04 CN CN202110890718.2A patent/CN113564233A/en active Pending
- 2021-08-23 AU AU2021106577A patent/AU2021106577A4/en active Active
-
2022
- 2022-01-11 ZA ZA2022/00489A patent/ZA202200489B/en unknown
- 2022-02-16 NL NL2030974A patent/NL2030974B1/en active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111304368A (en) * | 2020-03-19 | 2020-06-19 | 艾康生物技术(杭州)有限公司 | Method, oligonucleotide and kit for detecting novel coronavirus |
Non-Patent Citations (3)
| Title |
|---|
| LYONS JONATHAN J ET AL: "Elevated basal serum tryptase identifies a multisystem disorder associated with increased TPSAB1 copy number", NATURE GENETICS, vol. 48, no. 12, 17 October 2016 (2016-10-17), New York, pages 1564 - 1569, XP055982013, ISSN: 1061-4036, Retrieved from the Internet <URL:http://www.nature.com/articles/ng.3696> DOI: 10.1038/ng.3696 * |
| MAANINKA KATARIINA ET AL: "Human mast cell neutral proteases generate modified LDL particles with increased proteoglycan binding", ATHEROSCLEROSIS, ELSEVIER, AMSTERDAM, NL, vol. 275, 13 April 2018 (2018-04-13), pages 390 - 399, XP085465996, ISSN: 0021-9150, DOI: 10.1016/J.ATHEROSCLEROSIS.2018.04.016 * |
| STAUDACHER ANNA G ET AL: "Decreased nasal polyp eosinophils but increased mast cells in a patient with aspirin-exacerbated respiratory disease treated with reslizumab", ANNALS OF ALLERGY, ASTHMA, ELSEVIER, AMSTERDAM, NL, vol. 125, no. 4, 4 July 2020 (2020-07-04), pages 490, XP086271220, ISSN: 1081-1206, [retrieved on 20200704], DOI: 10.1016/J.ANAI.2020.06.043 * |
Also Published As
| Publication number | Publication date |
|---|---|
| NL2030974B1 (en) | 2023-02-24 |
| ZA202200489B (en) | 2022-03-30 |
| CN113564233A (en) | 2021-10-29 |
| AU2021106577A4 (en) | 2021-11-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2016188144A1 (en) | Str locus fluorescent labeling multiplex amplification kit having enhanced identification capability and use thereof | |
| CN112063756B (en) | Method and kit for multiple detection of respiratory virus nucleic acid | |
| CN112266986B (en) | Virus nucleic acid extraction or preservation reagent, primer probe combination, virus amplification reagent, kit and application thereof | |
| WO2022007224A1 (en) | Method, composition and kit for fluorescent quantitative pcr, and use thereof | |
| WO2018227918A1 (en) | Rt-qpcr method for direct quantitative detection of circulating mirna | |
| WO2023025259A1 (en) | Method and kit for detecting microrna | |
| WO2023010326A1 (en) | PRIMER-PROBE SET AND KIT FOR HUMAN β-TRYPTASE MRNA RT-PCR DETECTION | |
| CN112063764A (en) | Multiplex real-time fluorescent RT-PCR primer probe composition and kit for novel coronavirus nucleic acid detection | |
| CN111676278A (en) | Primer and probe for detecting novel coronavirus N gene, kit and method thereof | |
| NL2030973B1 (en) | Primer set for detection of expression of human eosinophil cationic protein (ecp) mrna and kit | |
| NL2030974B1 (en) | Primer probe set and kit for rt-pcr detection of human tryptase beta (tpsb) mrna | |
| NL2030975B1 (en) | Primer probe set and kit for rt-pcr detection of human leukotriene receptor cysltr2 mrna | |
| CN112522445A (en) | Primer-probe combination, kit and method for detecting novel coronavirus | |
| CN111676315A (en) | Primer and probe for detecting novel coronavirus ORF1ab gene, kit and method thereof | |
| WO2023010328A1 (en) | Primer-probe set and kit for human leukotriene receptor cysltr1 mrna rt-pcr detection | |
| AU2021106586A4 (en) | Reagent for detecting expression level of human histamine receptor hrh4 mrna, kit and use | |
| US20240158856A1 (en) | Primer probe set for human histamine receptor hrh1 mrna detection, kit and detection method | |
| CN113278736B (en) | Reagents and methods for qualitative detection of bovine herpesvirus type I | |
| CN112501349B (en) | Primer probe composition and kit for synchronously detecting 8 children digestive tract infection fungi and parasite-related pathogens | |
| NL2030976B1 (en) | Primer probe set and kit for rt-pcr detection of human leukotriene receptor cysltr1 mrna | |
| CN112226535A (en) | Novel coronavirus nucleic acid rapid detection method based on real-time fluorescence RT-PCR | |
| AU2021106574A4 (en) | Primer probe set for human histamine receptor hrh1 mrna detection, kit and use | |
| WO2023010325A1 (en) | Primer set for detecting expression of human eosinophil cationic protein mrna, kit, and detection method | |
| US20210214809A1 (en) | One-step detection kit for molecular diagnostics of sars-cov-2 virus | |
| WO2023010327A1 (en) | Primer probe set and test kit for rt-pcr detection of human leukotriene receptor cysltr2 mrna |