CN113278736B - Reagents and methods for qualitative detection of bovine herpesvirus type I - Google Patents
Reagents and methods for qualitative detection of bovine herpesvirus type I Download PDFInfo
- Publication number
- CN113278736B CN113278736B CN202110593326.XA CN202110593326A CN113278736B CN 113278736 B CN113278736 B CN 113278736B CN 202110593326 A CN202110593326 A CN 202110593326A CN 113278736 B CN113278736 B CN 113278736B
- Authority
- CN
- China
- Prior art keywords
- reaction
- bohv1
- sample
- kit
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention provides a LAMP primer group for specifically detecting bovine herpesvirus type I (BoHV 1), a kit comprising the primer group for detecting BoHV1 virus by LAMP amplification technology, and a method for detecting BoHV1 by LAMP amplification technology using the primer group or the kit. According to the invention, rapid detection can be completed within 40-60 minutes after sampling, the efficiency of BoHV1 detection is greatly improved, and the detection result can be judged by naked eye observation.
Description
Technical Field
The invention relates to the field of bovine herpesvirus detection, in particular to a primer group, a kit and a method for qualitatively detecting bovine herpesvirus I nucleic acid.
Background
Bovine herpes virus type I (BoHV 1) can cause domestic cattle and bison to develop Infectious Bovine Rhinotracheitis (IBR), the virus is distributed around the world, animal epidemic diseases listed as legal report by the world animal health Organization (OIE) are listed as type II animal epidemic diseases in the "one-, two-and three-animal epidemic disease seed directory" published by the Ministry of agriculture of the people's republic of China bulletin No. 1125, namely, serious economic losses can be caused, and measures such as strict control, putting out and the like need to be taken to prevent the spread epidemic diseases. Thus, a rapid and convenient detection of BoHV1 would effectively prevent the transmission of BoHV 1.
The current method for detecting BoHV1 nucleic acid is usually a real-time fluorescence quantitative PCR method, which is a traditional method for detecting BoHV1, but the method needs an expensive fluorescence quantitative PCR instrument, requires a professional to perform a complicated operation process, and the time for on-machine detection is at least 1 hour.
Therefore, there is a need for a qualitative detection technique for BoHV1 nucleic acid that is efficient, inexpensive and specific, is capable of rapidly performing on-site detection within 40 to 60 minutes after sampling, and can determine the detection result by visual inspection, independent of expensive PCR equipment, thereby enabling rapid detection of BoHV1 in relatively simple places such as pastures, basic-level inspection centers, and the like.
Disclosure of Invention
The purpose of the present invention is to provide a qualitative detection technique that is highly efficient, inexpensive, and specific for BoHV1 nucleic acids. According to the invention, a visual dye and a loop-mediated isothermal amplification (LAMP) technology are fused, gC gene specific loci of BoHV1 are used as target genes, a group of specific LAMP primers are designed and screened after a large number of reference sequences are analyzed and compared, the specific LAMP primers are amplified by the LAMP technology, and BLAST software is adopted for comparison. The result shows that the primer sequence is identical with the corresponding sequence of the BoHV1 virus in the database, and has no obvious cross with other virus sequences, so that the nucleic acid qualitative detection specific to the BoHV1 is realized, and the invention is completed.
Thus, in a first aspect, the present invention provides a primer set for detecting bovine herpes virus type I by an LAMP amplification reaction, the primer set comprising:
BoHV1-F3：CAGCTTGAGCTTCTCCACG(SEQ ID NO:1)；
BoHV1-B3：CTGGGCGTACATCTCGGA(SEQ ID NO:2)；
BoHV1-FIP：GCCAAAACCGCTTTCAGAAGCA-CATGTCCAGGGAAACCACG(SEQ ID NO:3)；
BoHV1-BIP：GCGTCGAAGACGCGGAAGA-CTCACGGCCGTCTACGA(SEQ ID NO:4)。
in a second aspect, the present invention provides a kit for detecting bovine herpes virus type I by an LAMP amplification reaction, the kit comprising:
-comprising a primer set according to the first aspect.
In a third aspect, the present invention provides a method for detecting bovine herpes virus type I by a LAMP amplification reaction comprising the steps of:
(1) Obtaining DNA from a sample to be tested;
(2) Performing a LAMP amplification reaction using the primer set according to the first aspect or the kit according to the second aspect, with the DNA as a template;
(3) And judging the result of the LAMP amplification reaction.
The invention has the advantages that: the invention provides a high-efficiency, simple and low-cost qualitative detection technology for BoHV 1. More specifically, the detection method is a totally-enclosed reaction, no subsequent treatment is needed, pollution is avoided, and the reliability of a detection result is ensured; the method provided by the invention is rapid in detection and simple in operation, and can rapidly complete on-site detection within 40-60 minutes after sampling, so that the detection time is greatly shortened; in addition, the detection of the BoHV1 by the method does not depend on expensive PCR equipment, and the detection result can be judged by naked eye observation, so that the instrument cost is saved, and the method can be widely popularized and applied to places with relatively simple experimental conditions such as pastures, basic-level inspection centers and the like.
Drawings
The technical solutions and benefits of the present invention will become apparent to those skilled in the art having the benefit of the following detailed description and the accompanying drawings.
FIG. 1 shows LAMP detection results obtained using the primer set of the present invention and hydroxynaphthol blue (HNB) as a reaction visualization indicator according to one specific embodiment of the present invention.
FIG. 2 shows the results of LAMP detection obtained by optimizing the LAMP reaction system using the primer group of the present invention according to one embodiment of the present invention.
FIG. 3 shows the results of LAMP detection using 4 specific primers (F3, B3, FIP and BIP) according to the present invention according to one embodiment of the present invention, wherein FIG. 3A is the result after 40 minutes of LAMP amplification reaction, and FIG. 3B is the result after 60 minutes of LAMP amplification reaction, wherein +indicates positive and-indicates negative.
FIG. 4 shows the LAMP detection results obtained using 6 specific primers (F3, B3, FIP, BIP, LF and LB) of the present invention according to one embodiment of the present invention, wherein +indicates positive, -indicates negative.
FIG. 5 shows the results of a specific test for LAMP detection using the primer set according to the invention according to one embodiment of the invention.
FIG. 6 shows the results of a sensitivity test for LAMP detection using the primer set according to the invention according to one embodiment of the invention.
FIG. 7 shows a sensitivity comparison of bovine herpes virus type I detection by fluorescent quantitative PCR and LAMP method of the invention.
Detailed Description
The present invention will be described in detail below. It is to be understood that the following description is intended to illustrate the invention by way of example only, and is not intended to limit the scope of the invention as defined by the appended claims. And, it is understood by those skilled in the art that modifications may be made to the technical scheme of the present invention without departing from the spirit and gist of the present invention. The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated.
As mentioned above, there is a need in the art for a highly efficient, inexpensive and specific qualitative detection technique for BoHV1 nucleic acids. After analyzing and comparing a large number of reference sequences, the inventor designs and screens a group of specific LAMP primer groups by taking gC gene specific loci of BoHV1 as target genes, and amplifies the specific LAMP primer groups by an LAMP detection technology, thereby realizing qualitative and rapid detection of bovine herpesvirus I-type nucleic acid, and completing the invention.
As known to those skilled in the art, the LAMP detection technique is a new nucleic acid isothermal amplification technique newly established in the last decade, and has been widely used in detection studies of pathogenic bacteria such as viruses, bacteria, parasites, etc. The LAMP technology adopts 4 primers which specifically identify 6 sites on a target sequence and DNA polymerase with strand displacement activity, and performs nucleic acid amplification under isothermal conditions, and has the advantages of strong specificity, high sensitivity, simple and quick operation, low cost and the like.
Thus, in a first aspect, the present invention provides a primer set for detecting bovine herpes virus type I (BoHV 1) by an LAMP amplification reaction, the primer set comprising:
BoHV1-F3：CAGCTTGAGCTTCTCCACG(SEQ ID NO:1)；
BoHV1-B3：CTGGGCGTACATCTCGGA(SEQ ID NO:2)；
BoHV1-FIP：GCCAAAACCGCTTTCAGAAGCA-CATGTCCAGGGAAACCACG(SEQ ID NO:3)；
BoHV1-BIP：GCGTCGAAGACGCGGAAGA-CTCACGGCCGTCTACGA(SEQ ID NO:4)。
the primer sequence of the present invention can be synthesized by methods well known to those skilled in the art, and is not particularly limited.
In a specific embodiment, the primer set further comprises:
BoHV1-LF：GAGCAAGGTGAAGATTAACGG(SEQ ID NO:5)；
BoHV1-LB：TTAGCTTCCCGTAGCCGTC(SEQ ID NO:6)。
those skilled in the art know that in the LAMP technique, the amplification efficiency of the LAMP reaction can be further improved by adding a pair of loop primers additionally. Those skilled in the art are also aware that, although both the loop primer and the inner primer act on the loop structure, the amplification mechanism of the loop primer and the loop structure formed by the LAMP is not the same due to the difference in hybridization position between them, thereby greatly improving the amplification efficiency of the LAMP reaction.
In a specific embodiment, when only SEQ ID NOS: 1-4 are used, and loop primers are not used, the LAMP reaction time for BoHV1 detection takes about 60 minutes.
In another embodiment, the LAMP reaction time for detection of BoHV1 only takes about 40 minutes when adding loop primers.
In a second aspect, the present invention provides a kit for detecting bovine herpes virus type I by an LAMP amplification reaction, the kit comprising:
-comprising a primer set according to the first aspect.
In a specific embodiment, wherein the kit further comprises:
-magnesium ions;
-deoxyribonucleoside triphosphates (dntps) comprising: deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxythymidine triphosphate (dTTP) and deoxycytidine triphosphate (dCTP);
-strand-displacing DNA polymerase;
-a strand displacement DNA polymerase buffer.
In one embodiment, the magnesium ions are through MgCl 2 Or MgSO 4 Providing.
In a more specific embodiment, the strand displacing DNA polymerase is Bst DNA polymerase, which is obtained by expression purification of the DNA polymerase gene of Bacillus stearothermophilus (Bacillus stearothermophilus) from which a 5 '. Fwdarw.3' exonuclease (exo) gene fragment has been removed in E.coli, retaining 5 '. Fwdarw.3' DNA polymerase activity. Accordingly, the strand displacement type DNA polymerase buffer is Bst DNA polymerase buffer composed of 20mM Tris-HCl (pH 8.about.25℃), 10mM KCl, 10mM (NH) 4 ) 2 SO 4 、2mM MgSO 4 0.1% Triton X-100.
In another specific embodiment, the kit further comprises a reaction visualization indicator. In the present invention, the term "reaction visualization indicator" means an indicator that visualizes an amplification reaction existing in a reaction system. In further specific embodiments, the reaction visualization indicator may be hydroxynaphthol blue, picoGreen, SYBR Green I, or calcein, but is not limited thereto.
Among the reaction visual indicators listed above, there are two more widely used: hydroxynaphthol blue (HNB) and calcein. HNB was first reported in 2009 as a visual indicator of LAMP reaction, and its principle is: in the nucleic acid synthesis process of LAMP amplification reaction, a large amount of pyrophosphate ions on dNTPs are dissociated, and the pyrophosphate ions can react with Mg in a reaction system 2+ Specifically bind to make Mg in reaction system 2+ Concentration decreaseThereby leading to HNB-Mg 2+ The complex is reduced, so that the positive reaction appears blue under natural light, and the negative reaction appears purple; calcein was first reported as a visual indicator of LAMP reaction in 2008, and it is mainly identified by the results under 365nm blue light excitation, and there is a certain difference between negative and positive results under natural light, but it is not obvious. The principle is as follows: mn is firstly added into calcein 2+ ，Mn 2 + Green fluorescence quenching of calcein. When LAMP amplification reaction occurs, the byproduct pyrophosphate ions generated and Mn 2+ Bind and release calcein and release the quenched state. The final result is that under the excitation of 365nm blue light, the positive reaction emits strong green fluorescence, and the negative reaction emits weaker green fluorescence; under natural light, the positive reaction is light green, and the negative reaction is light orange.
In a preferred embodiment, the reaction visual indicator is hydroxynaphthol blue.
In a third aspect, the present invention provides a method for detecting bovine herpes virus type I by a LAMP amplification reaction comprising the steps of:
(1) Obtaining DNA from a sample to be tested;
(2) Performing a LAMP amplification reaction using the primer set according to the first aspect or the kit according to the second aspect, with the DNA as a template;
(3) And judging the LAMP amplification reaction result.
In a specific embodiment, the sample to be tested is blood, a nasal swab sample or a pharyngeal swab sample, a focal tissue sample, but is not limited thereto.
In yet another specific embodiment, in said step (1), said DNA is obtained by directly extracting from said test sample, or by extracting RNA from said test sample and then reverse transcribing said RNA into DNA. Obtaining DNA from a sample to be tested, extracting RNA, and reverse transcribing the RNA into DNA may be performed by means of conventional techniques in the art.
In yet another specific embodiment, the conditions of the LAMP amplification reaction are constant at 60℃to 67℃with a magnesium ion concentration of 4mM to 8mM and a dNTP concentration of 1.0mM to 1.5mM.
In a further preferred embodiment, the conditions of the LAMP amplification reaction are isothermal 63 ℃. The isothermal reaction step may be carried out in devices well known to the person skilled in the art, such as incubators, metal (water) baths.
In yet another preferred embodiment, the conditions of the LAMP amplification reaction are a magnesium ion concentration of 6mM and a dNTP concentration of 1.2mM.
In yet another specific embodiment, the reaction time of the LAMP amplification reaction is 40 to 60 minutes.
In yet another preferred embodiment, the reaction time of the LAMP amplification reaction is 45 minutes.
In a specific embodiment, the determination is made by visual inspection. In this case, a reaction visual indicator, for example, hydroxynaphthol blue, picoGreen, SYBR Green I, or calcein may be added to the reaction system, but is not limited thereto.
In a preferred embodiment, hydroxy naphthol blue is added into the reaction system, and when the color of the reaction system changes from purple to sky blue at the end of the reaction, the presence of bovine herpesvirus I in the sample to be tested is judged; and when the reaction is finished, the color of the reaction system still keeps purple, and judging that the bovine herpesvirus I type virus does not exist in the sample to be detected.
In a further preferred embodiment, calcein is added to the reaction system, and the color of the reaction system is light orange at the end of the reaction, so that the sample to be tested is judged to be free of bovine herpes virus type I; and when the reaction is finished, the color of the reaction system is light green, and the presence of the bovine herpesvirus I in the sample to be detected is judged. It will be appreciated that the color change of calcein requires the presence of Mn in the reaction system 2+ Therefore, when calcein is used, an appropriate amount of Mn should be added to the reaction system 2+ 。
In one embodiment, the judging is carried out by a turbidity measuring device, when the turbidity of the reaction system is obviously changed at the end of the reaction, the bovine herpesvirus type 1 is judged to exist in the sample to be tested, when the turbidity of the reaction system is not obviously changed at the end of the reaction, the bovine herpesvirus type 1 is judged to not exist in the sample to be tested. In the present invention, by "significant change" is meant a statistical change in turbidity compared to the control.
The primer group, the kit and the detection method realize simple, convenient and rapid detection of the bovine herpesvirus I type virus nucleic acid, and improve the sensitivity and the specificity of the detection. The method of the invention does not depend on expensive PCR equipment, can rapidly complete on-site detection within 40 to 60 minutes after nucleic acid sampling, and can judge the detection result by naked eye observation, thereby rapidly detecting the bovine herpesvirus I in places with relatively simple experimental conditions such as pastures, basic-level inspection centers and the like needing frequent nucleic acid detection of the bovine herpesvirus I. At the same time, the method of the invention achieves cost effectiveness, since the use of expensive equipment and complicated manual operations is avoided.
Examples
Hereinafter, the present invention is described in more detail in connection with exemplary embodiments. However, the exemplary embodiments disclosed herein are for illustrative purposes only and should not be considered as limiting the scope of the invention. The reagents used in the present invention, for example, conventional reagents used in LAMP detection such as Bst DNA polymerase, bst DNA polymerase buffer, sterile TE buffer, hydroxynaphthol blue, dNTPs, mgSO 4 Blocking solutions, etc. are commercially available.
Example 1: primer design
The inventor designs and screens a group of specific LAMP primer groups by taking gC gene specific loci of BoHV1 as target genes, wherein the sequences of the primer groups are as follows:
BoHV1-F3：CAGCTTGAGCTTCTCCACG(SEQ ID NO:1)；
BoHV1-B3：CTGGGCGTACATCTCGGA(SEQ ID NO:2)；
BoHV1-FIP：GCCAAAACCGCTTTCAGAAGCACATGTCCAGGGAAACCACG(SEQ ID NO:3)；
BoHV1-BIP：GCGTCGAAGACGCGGAAGACTCACGGCCGTCTACGA(SEQ ID NO:4)。
in addition, the present inventors have additionally introduced a pair of loop primers based on the above sequences to increase amplification efficiency, which are:
BoHV1-LF：GAGCAAGGTGAAGATTAACGG(SEQ ID NO:5)；
BoHV1-LB：TTAGCTTCCCGTAGCCGTC(SEQ ID NO:6)。
by using BLAST software for comparison, the inventors found that the above 6 primer sequences were identical to the sequences corresponding to BoHV-1 virus in the database and did not significantly cross other viral sequences.
Example 2: boHV1 detection
This example provides exemplary specific steps for performing a BoHV1 test on a sample to be tested.
First, a viral DNA extraction kit (purchased from the astronomical biochemistry technology (beijing) limited) was used to extract DNA.
Then, the reaction reagent is formulated. The stock solution concentrations of the reagents used for the LAMP amplification reaction are shown in Table 1. In the case that the number of samples to be tested is N, referring to Table 1, the amounts of each component (N samples to be tested+1 negative controls+1 positive controls, one more reaction is performed to ensure the accuracy of the split charging volume of the reaction solution) are calculated according to the number of N+3, each reaction reagent is added into a 1.5mL PCR centrifuge tube, vortex mixing or cover-up and cover-up upside down mixing is performed for 10-20 times, centrifugation is performed for 30 seconds, each PCR tube is split charged with 23 μL, and 1 drop of sealing solution (about 20 μL) is added into each tube.
Table 1 1: reaction reagent stock solution for LAMP amplification reaction
Then, 2. Mu.L of template of the sample to be detected is sequentially added into each PCR tube, and the sequence is negative control (the template can be also not added), the reaction liquid system of the sample to be detected and positive control. The tube was capped and centrifuged for 30 seconds, and the amplification reaction was immediately performed. The LAMP amplification reaction of the present invention uses a polymerase chain reaction nucleic acid amplification apparatus or a metal (or water) bath to perform a constant temperature reaction at 60℃to 67℃for 40 to 60 minutes.
After the reaction was completed, visual observation was performed or observation was performed using a turbidity meter. The color of the reaction solution was observed in a well-lighted environment, and white paper was suggested as a background. In the specific embodiment, HNB is adopted as a reaction visual indicator, and if the color of the solution is still purple, the sample to be detected is judged to be negative to bovine herpesvirus I type virus nucleic acid; if the color of the solution changes to sky blue, the sample to be tested is judged to be positive for bovine herpesvirus I nucleic acid, as shown in FIG. 1.
Example 3: optimization of LAMP reaction System
Typically, the LAMP amplification reaction is thermostated at 60℃to 67℃and the reaction time is 40 to 60 minutes. The present inventors found that the preferred reaction temperature for LAMP detection using the primer set of the present invention was 63℃and the preferred reaction time was 45 minutes.
On this basis, the present inventors have also found that dNTPs and Mg in the reaction in addition to the reaction temperature and reaction time 2+ The concentration of (2) plays an important role in the detection effect as well. In order to obtain the best detection effect, the invention aims at different dNTPs and Mg 2+ The concentrations were tested in a series of tests, as detailed in table 2 below. In addition, 6 specific primers were used in this example.
Table 2 2: dNTP and Mg in optimization test 2+ Concentration of
| Experiment number | MgSO 4 | dNTP |
| 1 | 4mM | 1.1 |
| 2 | 5mM | 1.1 |
| 3 | 6mM | 1.1 |
| 4 | 7mM | 1.1 |
| 5 | 4mM | 1.2 |
| 6 | 5mM | 1.2 |
| 7 | 6mM | 1.2 |
| 8 | 7mM | 1.2 |
| 9 | 4mM | 1.3 |
| 10 | 5mM | 1.3 |
| 11 | 6mM | 1.3 |
| 12 | 7mM | 1.3 |
| 13 | 4mM | 1.4 |
| 14 | 5mM | 1.4 |
| 15 | 6mM | 1.4 |
| 16 | 7mM | 1.4mM |
The results of the assay are shown in FIG. 2, wherein the concentrations of BoHV1 positive plasmid in test tubes numbered BoHV-1-BoHV-7 were 1.02×10, respectively 6 Copy/. Mu.l, 1.02 x 10 5 Copy/. Mu.l, 1.02 x 10 4 Copy/. Mu.l, 1.02 x 10 3 Copy/. Mu.l, 1.02 x 10 2 Copy/. Mu.l, 1.02 x 10 1 Copy/. Mu.l, 1.02 x 10 0 Copy/. Mu.l, test tube numbered NC was negative control. From the viewpoints of color contrast and optimal amplification efficiency, the optimal reaction conditions are finally obtained: mg of 2+ Concentration: 6mM; dNTP concentration: 1.2mM.
Example 4: boHV1 detection without Loop primers
In this example, only four primers, namely BoHV1-F3, boHV1-B3, boHV1-FIP and BoHV1-BIP, were used to carry out the LAMP detection of BoHV1 on samples to be tested at different concentrations, and specific steps and amounts of each reagent used are described in example 2, wherein the volumes corresponding to the primers BoHV1-LF and BoHV1-LB were made up with sterile distilled water.
The final results of this example are shown in FIGS. 3A-3B, wherein FIG. 3A is the result after 40 minutes of the LAMP amplification reaction, and FIG. 3B is the result after 60 minutes of the LAMP amplification reaction. Plasmid concentrations in the reaction solution system were 4.56X10 respectively 4 Copy/. Mu.L, 4.56X10 3 Copy/. Mu.L, 4.56X10 2 Copy/. Mu.L, 4.56X10 1 Copy/. Mu.L and 4.56 x 10 0 Copy/. Mu.L, corresponding in turn to test tubes numbered 1-5 in FIGS. 3A-3B, test tubes numbered 6-8 were negative controls.
The detection results are as follows: when the reaction time of LAMP detection using only 4 primers (F3, B3, FIP and BIP) was 40 minutes, the test tube with only the number of 1-3 showed a color change, i.e., the detection limit reached 4.56X10 2 Copy/. Mu.L. When the reaction time is prolonged to 60 minutes, the test tube numbered 1-4 has color change, i.e. the detection limit reaches 4.56X10 1 Copy/. Mu.L.
Example 5: boHV1 detection using loop primers
In this example, boHV1-F3, boHV1-B3, boHV1-FIP, boHV1-BIP, boHV1-LF and BoHV1-LB primer sets were used to perform LAMP detection of BoHV1 for different plasmid concentrations, see example 2 for specific procedures and amounts of each reagent used.
The results after 40 minutes of reaction are shown in FIG. 4, and the plasmid concentrations in the test tubes numbered 1-5 in FIG. 4 are 4.56X10 in order 4 Copy/. Mu.L, 4.56X10 3 Copy/. Mu.L, 4.56X10 2 Copy/. Mu.L, 4.56X10 1 Copy/. Mu.L and 4.56 x 10 0 Copy/. Mu.L, test tubes numbered 6-8 were negative controls.
The detection results are as follows: when LAMP detection using 6 primers was carried out for 40 minutes, the test tubes numbered 1-4 were subjected to a color change reaction, i.e., the detection limit reached 4.56X10 1 Copy/. Mu.L. Compared to LAMP detection using only 4 primers (FIG. 3A), LAMP detection using only 4 primers amplified for 40 minutes had sensitivity (4.56X10 2 Copy/. Mu.L) than using 6 primersThe sensitivity of LAMP detection is one order of magnitude lower at the same reaction time. However, when the reaction time of the detection using only 4 primers was prolonged to 60 minutes, the detection limit thereof also reached 4.56X10 1 Copy/. Mu.L, consistent with detection sensitivity using 6 primers. That is, the amplification rate of LAMP detection using 6 primers was significantly higher than that using only 4 primers. From this, it was found that the LAMP detection using 6 primers at the same time was more efficient, and the detection time was greatly shortened.
Example 6: specificity of primer set
In order to examine the specificity of the primer set of the present invention, in this example, LAMP detection was performed using 6 specific primer sets of the present invention for 12 viruses whose sequences are similar to the BoHV-1 sequence, and the specific procedure for the detection was as in example 2. As shown in FIG. 5, test tubes numbered 1-12 were bovine DNA, negative airway secretions, negative nasal swabs, negative oral swabs, bovine rotavirus, bovine coronavirus, bovine respiratory syncytial virus, foot and mouth disease virus type A, foot and mouth disease virus type O, viral diarrhea virus, bovine leukemia virus, and bovine parainfluenza virus, respectively, and Positive Control (PC) and Negative Control (NC) test tubes containing BoHV-1.
As can be seen from FIG. 5, the solutions in the test tubes numbered 1-12 and the Negative Control (NC) test tubes did not appear purple after 60 minutes of reaction, were negative, and the solution in the Positive Control (PC) test tube was sky blue only, i.e., positive. As can be seen from the above, the primer set of the present invention can specifically amplify only the BoHV-1 sequence, and shows specificity against the BoHV-1 virus.
Example 7: sensitivity detection of primer sets
In this example, the sensitivity of the primer set was detected from two levels.
First, LAMP detection was performed using the 6 specific primer sets of the present invention for different virus concentrations, and the specific procedure for the detection was as in example 2. As shown in FIG. 6, the test tubes numbered 1-7 each contained a concentration of 4.56X10 6 Copy/. Mu.L, 4.56X10 5 Copy/. Mu.L, 4.56X10 4 Copy/. Mu.L, 4.56×10 3 Copy/. Mu.L, 4.56X10 2 Copy/. Mu.L, 4.56X10 1 Copy/. Mu.L and 4.56X10 0 Copy/. Mu.L plasmid samples, tubes labeled NC were negative controls. It was found that only the test tube numbered 7 and the Negative Control (NC) test tube appeared purple in color, i.e., negative. That is, the detection limit of LAMP detection using the primer of the present invention can be up to 4.56X10 1 Copy/. Mu.L.
Next, the present inventors also compared the sensitivity of the LAMP detection method of the present invention with that of the fluorescent quantitative PCR method, and the results of the fluorescent quantitative PCR are shown in FIG. 7. As shown in FIG. 7, the numbers 3 to 7 are respectively the concentrations of the components of 4.56X10 4 Copy/. Mu.L, 4.56X10 3 Copy/. Mu.L, 4.56X10 2 Copy/. Mu.L, 4.56X10 1 Copy/. Mu.L and 4.56X10 0 Copy/. Mu.L plasmid samples. As can be seen from the figure, the sensitivity of the fluorescent quantitative PCR method was 4.56×10 0 Copy/. Mu.L. As can be seen, the sensitivity of the LAMP detection method of the invention is an order of magnitude lower than that of the fluorescent quantitative PCR method. Although the fluorescent quantitative PCR method is adopted to obtain higher sensitivity, compared with the PCR method, the LAMP detection has the advantages of greatly reducing the instrument cost, being more convenient for result observation, being capable of being rapidly finished in a place with relatively simple experimental conditions and having higher practicability.
In this specification, whenever reference is made to "an exemplary embodiment," "a preferred embodiment," "one embodiment," etc., it is intended that a particular feature, structure, or characteristic described in connection with the embodiment be included in at least one embodiment of the invention. The appearances of such phrases in various places in the specification are not necessarily all referring to the same embodiment. Furthermore, when a particular feature, structure, or characteristic is described in connection with any embodiment/embodiment, it is submitted that it is within the purview of one skilled in the art to effect such feature, structure, or characteristic in connection with other ones of the embodiments.
The embodiments of the present invention are described above in detail. However, aspects of the present invention are not limited to the above-described embodiments. Various modifications and substitutions may be applied to the above-described embodiments without departing from the scope of the present invention.
Sequence listing
<120> reagents and methods for qualitative detection of bovine herpesvirus type I
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> bovine herpes virus type I (Bovine herpesvirus 1)
<400> 1
cagcttgagc ttctccacg 19
<210> 2
<211> 18
<212> DNA
<213> bovine herpes virus type I (Bovine herpesvirus 1)
<400> 2
<210> 3
<211> 41
<212> DNA
<213> bovine herpes virus type I (Bovine herpesvirus 1)
<400> 3
gccaaaaccg ctttcagaag cacatgtcca gggaaaccac g 41
<210> 4
<211> 36
<212> DNA
<213> bovine herpes virus type I (Bovine herpesvirus 1)
<400> 4
gcgtcgaaga cgcggaagac tcacggccgt ctacga 36
<210> 5
<211> 21
<212> DNA
<213> bovine herpes virus type I (Bovine herpesvirus 1)
<400> 5
gagcaaggtg aagattaacg g 21
<210> 6
<211> 19
<212> DNA
<213> bovine herpes virus type I (Bovine herpesvirus 1)
<400> 6
ttagcttccc gtagccgtc 19
Claims (16)
1. A primer set for detecting bovine herpes virus type 1 (BoHV 1) by an LAMP amplification reaction, the primer set comprising:
BoHV1-F3：CAGCTTGAGCTTCTCCACG (SEQ ID NO:1)；
BoHV1-B3：CTGGGCGTACATCTCGGA (SEQ ID NO:2)；
BoHV1-FIP：GCCAAAACCGCTTTCAGAAGCA-CATGTCCAGGGAAACCACG (SEQ ID NO:3)；
BoHV1-BIP：GCGTCGAAGACGCGGAAGA-CTCACGGCCGTCTACGA (SEQ ID NO:4)；
BoHV1-LF：GAGCAAGGTGAAGATTAACGG (SEQ ID NO:5)；
BoHV1-LB：TTAGCTTCCCGTAGCCGTC (SEQ ID NO:6)。
2. a kit for detecting bovine herpes virus type 1 by a LAMP amplification reaction, the kit comprising:
-comprising the primer set of claim 1.
3. The kit of claim 2, wherein the kit further comprises:
-magnesium ions;
-deoxyribonucleoside triphosphates (dntps) comprising: deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxythymidine triphosphate (dTTP) and deoxycytidine triphosphate (dCTP);
-strand-displacing DNA polymerase;
-a strand displacement DNA polymerase buffer.
4. A kit according to claim 3, wherein the strand displacement DNA polymerase is Bst DNA polymerase.
5. The kit of claim 3 or 4, wherein the kit further comprises:
-a reaction visual indicator.
6. The kit of claim 5, wherein the reaction visualization indicator is hydroxynaphthol blue, picoGreen, SYBR Green I, or calcein.
7. The kit of claim 6, wherein the reaction visual indicator is hydroxynaphthol blue.
8. Use of the primer set of claim 1 for the preparation of a detection reagent for detecting bovine herpes virus type I, the detection comprising the steps of:
(1) Obtaining DNA from a sample to be tested;
(2) Performing a LAMP amplification reaction using the primer set of claim 1 with the DNA as a template;
(3) And judging the result of the LAMP amplification reaction.
9. The use according to claim 8, wherein the sample to be tested is blood, a nasal swab sample or a pharyngeal swab sample, a focal tissue sample.
10. The use according to claim 8 or 9, wherein in step (1), the DNA is obtained by directly extracting from the sample to be tested, or by extracting RNA from the sample to be tested and then reverse transcribing the RNA into DNA.
11. The use of claim 8 or 9, wherein the conditions of the LAMP amplification reaction are thermostatted 60 ℃ to 67 ℃; magnesium ion concentration is 4mM to 8mM; dNTP concentration was 1.0mM to 1.5mM.
12. The use of claim 11, wherein the LAMP amplification reaction is carried out at a constant temperature of 63 ℃, a magnesium ion concentration of 6mM and a dntp concentration of 1.2mM.
13. Use according to claim 8 or 9, wherein the determination is made by visual inspection, at which time a reaction visual indicator is added to the reaction system.
14. The use of claim 13, wherein the reaction visualization indicator is hydroxynaphthol blue, picoGreen, SYBR Green I, or calcein.
15. The use according to claim 13, wherein the visual indicator of the reaction is hydroxynaphthol blue, and the presence of bovine herpesvirus type i in the sample is judged if the color of the reaction system changes from purple to sky blue at the end of the reaction, and the absence of bovine herpesvirus type i in the sample is judged if the color of the reaction system remains purple at the end of the reaction.
16. The use according to claim 8 or 9, wherein the determination is made by means of a turbidity measuring device that the turbidity of the reaction system is significantly changed at the end of the reaction, and that the bovine herpesvirus type 1 is present in the sample to be tested, and that the turbidity of the reaction system is not significantly changed at the end of the reaction, and that the bovine herpesvirus type 1 is not present in the sample to be tested.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110593326.XA CN113278736B (en) | 2021-05-28 | 2021-05-28 | Reagents and methods for qualitative detection of bovine herpesvirus type I |
| PCT/CN2021/133569 WO2022247186A1 (en) | 2021-05-28 | 2021-11-26 | Reagent and method for qualitative detection of bovine herpesvirus type i |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110593326.XA CN113278736B (en) | 2021-05-28 | 2021-05-28 | Reagents and methods for qualitative detection of bovine herpesvirus type I |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113278736A CN113278736A (en) | 2021-08-20 |
| CN113278736B true CN113278736B (en) | 2023-05-05 |
Family
ID=77282445
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110593326.XA Active CN113278736B (en) | 2021-05-28 | 2021-05-28 | Reagents and methods for qualitative detection of bovine herpesvirus type I |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN113278736B (en) |
| WO (1) | WO2022247186A1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113278736B (en) * | 2021-05-28 | 2023-05-05 | 深圳市爱医生物科技有限公司 | Reagents and methods for qualitative detection of bovine herpesvirus type I |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105132590A (en) * | 2015-10-15 | 2015-12-09 | 上海市农业科学院 | LAMP visual detection method of infectious bovine rhinotracheitis viruses |
| CN106701961A (en) * | 2017-01-16 | 2017-05-24 | 南阳师范学院 | Reverse transcription loop-mediated isothermal amplification primer, kit and detection method for visually detecting Hobi-like pest virus |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3087202B1 (en) * | 2013-12-23 | 2020-10-14 | The University Of Queensland | Nucleic acid detection method and kit |
| CN104726614A (en) * | 2015-03-31 | 2015-06-24 | 河南牧业经济学院 | Detection primer, kit and detection method of infectious bovine rhinotracheitis virus |
| CN104862419B (en) * | 2015-06-01 | 2018-05-01 | 山东省农业科学院奶牛研究中心 | A kind of primer, probe and kit for detecting infectious bovine rhinotrachetis virus |
| CN104928260B (en) * | 2015-06-01 | 2018-10-23 | 山东师范大学 | A kind of infectious bovine rhinotrachetis virus IBRV-JN03 separation strains and its application |
| CN105506188B (en) * | 2016-02-23 | 2019-09-20 | 深圳市易瑞生物技术股份有限公司 | For detecting the fluorescence RT-PCR primer and fluorescence probe, kit and detection method of Asian type zika virus |
| CN106191309A (en) * | 2016-07-19 | 2016-12-07 | 广西壮族自治区兽医研究所 | A kind of primer combination simultaneously differentiating 8 kinds of cattle disease substances and GeXP detection method |
| CN113136459A (en) * | 2021-05-07 | 2021-07-20 | 华中农业大学 | LAMP primer for detecting IBRV virus and method thereof |
| CN113278736B (en) * | 2021-05-28 | 2023-05-05 | 深圳市爱医生物科技有限公司 | Reagents and methods for qualitative detection of bovine herpesvirus type I |
-
2021
- 2021-05-28 CN CN202110593326.XA patent/CN113278736B/en active Active
- 2021-11-26 WO PCT/CN2021/133569 patent/WO2022247186A1/en unknown
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105132590A (en) * | 2015-10-15 | 2015-12-09 | 上海市农业科学院 | LAMP visual detection method of infectious bovine rhinotracheitis viruses |
| CN106701961A (en) * | 2017-01-16 | 2017-05-24 | 南阳师范学院 | Reverse transcription loop-mediated isothermal amplification primer, kit and detection method for visually detecting Hobi-like pest virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113278736A (en) | 2021-08-20 |
| WO2022247186A1 (en) | 2022-12-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111321249A (en) | Loop-mediated isothermal amplification detection primer group, kit and method for SARS-CoV-2 | |
| CN111394431B (en) | Method for detecting nucleic acid by using double real-time fluorescent isothermal amplification technology | |
| CN105219772B (en) | One group of nucleotide sequence and the application in detection of Salmonella and shigella dysenteriae detection | |
| WO2017202895A1 (en) | Compositions and methods for detection of mycoplasma genitalium | |
| US20230125553A1 (en) | METHOD FOR DETECTING CORONAVIRUS (SARS-CoV-2) | |
| CN113930547B (en) | RT-RAA fluorescence detection primer pair, kit and detection method for porcine epidemic diarrhea virus N gene | |
| CN113278736B (en) | Reagents and methods for qualitative detection of bovine herpesvirus type I | |
| KR20190041237A (en) | Oligonucleotide set for detection of dengue virus and uses thereof | |
| CN110878381A (en) | Primer composition, kit and method for detecting mycoplasma bovis and infectious bovine rhinotracheitis virus | |
| CN110894534A (en) | Primer, probe, kit and detection method for detecting mycoplasma genitalium | |
| CN110982940A (en) | Composition and kit for detecting nucleic acid of measles virus, rubella virus and mumps virus based on melting curve | |
| CN112501358B (en) | Primer probe combination and kit for detecting 9 children digestive tract pathogens | |
| EP2597162A1 (en) | Nucleic acid detection | |
| CN112522430A (en) | Primer probe composition and kit for synchronously detecting 29 pathogens related to digestive tract infection of children | |
| CN111676315A (en) | Primer and probe for detecting novel coronavirus ORF1ab gene, kit and method thereof | |
| JP2012143185A (en) | Comprehensive detection method for foot-and-mouth disease virus | |
| US20230416824A1 (en) | Systems for the detection of targeted gene variations and viral genomes and methods of producing and using same | |
| CN112501349B (en) | Primer probe composition and kit for synchronously detecting 8 children digestive tract infection fungi and parasite-related pathogens | |
| CN115820927A (en) | Monkey pox virus fluorescence PCR detection kit and primer probe combination thereof | |
| CN114807435A (en) | Kit for detecting respiratory syncytial virus and application thereof | |
| KR20190041314A (en) | Oligonucleotide set for detection of chikungunya virus and uses thereof | |
| EP3885455A1 (en) | Method and kit for the detection of sars-cov-2 virus in a sample based on reverse transcription loop-mediated isothermal amplification (rt-lamp) | |
| KR102076343B1 (en) | Composition for detecting adenovirus type 55 using Real-time LAMP and uses thereof | |
| CN115989323A (en) | Method for detecting SARS-CoV-2 infection | |
| CN112899385A (en) | Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20220816 Address after: 4th Floor, Building B2, Taohuayuan Zhichuang Town, Tiegang Community, Xixiang Street, Baoan District, Shenzhen City, Guangdong Province, 518102 Applicant after: Shenzhen Love Doctor Biotechnology Co., Ltd. Address before: 518101 101 (whole building), Liuxian lourui biological building, Xingdong community, Xin'an street, Bao'an District, Shenzhen City, Guangdong Province Applicant before: SHENZHEN BIOEASY BIOTECHNOLOGY Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |