NL2030973A

NL2030973A - Primer set for detection of expression of human eosinophil cationic protein (ecp) mrna and kit

Info

Publication number: NL2030973A
Application number: NL2030973A
Authority: NL
Inventors: Wu Shandong; Jiang Xuehan; Wang Yifei; Liu Yi; Shen Huahao; Wang Jiaofeng; Cheng Lei; Wu Zhoujie
Original assignee: Hangzhou Zheda Dixun Biological Gene Eng Co Ltd
Priority date: 2021-08-04
Filing date: 2022-02-16
Publication date: 2023-02-15
Also published as: NL2030973B1; AU2021106592A4; ZA202200493B; CN113373218A

Abstract

The present disclosure provides a primer set for detection of an expression of a human eosinophil cationic protein (ECP) mRNA and a kit, and relates to the technical field of biological detection. In the present disclosure, the primer set includes an ECP—F, an ECP—R, a GAPDH—F and a GAPDH—R; where the ECP—F has a nucleotide sequence shown in SEQ ID NO. l, the ECP—R has a nucleotide sequence shown in SEQ ID NO. 2, the GAPDH—E‘ has a nucleotide sequence shown in SEQ ID NO. 3, and the GAPDH—R has a nucleotide sequence shown. in SEQ ID NO. 4. The present disclosure further provides a kit including the primer set, and the kit can one—step quantitatively detect an expression level of the human ECP mRNA. The present disclosure provides a detection method with high accuracy, wide detection range and high sensitivity for the ECP protein.

Description

PRIMER SET FOR DETECTION OF EXPRESSION OF HUMAN EOSINOPHIL

CATIONIC PROTEIN (ECP) MRNA AND KIT

TECHNICAL FIELD

The present disclosure belongs to the technical field of bio- logical detection, and specifically relates to a primer set for detection of an expression of a human eosinophil cationic protein (ECP) mRNA and a kit.

BACKGROUND ART

An eosinophil cationic protein (ECP) is a strongly-basic granulin released after eosinophil (EOS) activation; the ECP ex- ists in the matrix part of EOS particles, accounting for 30% of the particles. The ECP is a specific marker after the EOS activa- tion, and can reflect the EOS activation level, and the ECP also has a very strong cytotoxic effect. The ECP can be found in most body fluids of the human, such as serum, nasal secretions, bron- chial irrigation fluid, saliva, and tears and the like.

For inflammatory diseases related to eosinophil infiltration, the content of EOS granulin is more important than the total num- ber of EOS infiltrations. The EOS granulin mainly includes: an

ECP, an eosinophil major basic protein (EMBP), an eosinophil pe- roxidase (EPO) and an eosinophil-derived neurotoxin (EDN), where the ECP has an especially remarkable toxic effect. During inflam- mation, the EOS is activated and degranulates, causing mucosal damage, which in turn increases tissue hypersensitivity and causes chronic inflammation. Meanwhile, the EOS releases the ECP to cause an increase of ECP levels in peripheral blood and membrane mucus.

The ECP is a very important airway active substance, and has various airway effects such as contraction of bronchial smooth muscle, destruction of alveclar surface active substances, lysis of cell membranes, and activation of inflammatory cells and the like. The ECP participates in the pathophysiological process of asthma, such as airway hyperresponsiveness and airway epithelial injury. Eosinophilic inflammation in patients with asthma leads to increased ECP levels in blood and other body fluids such as bron- choalveolar fluid and sputum. The ECP level objectively reflects the level of eosinophilic inflammation in asthma patients, and a high level of ECP indicates the inflammatory state of the asthma patients. ECP determination can be used to monitor asthma inflam- mation, guide hormone therapy of asthma, and find patients who do not comply with treatment. In addition, the ECP can also be re- garded as a biochemical marker for allergic reactions. After con- tacting, inhaling or ingesting allergens, allergic people will un- dergo allergic asthma, and allergic dermatitis and the like, lead- ing to an increase of the ECP level of allergic patients. The ECP is an effective marker for determining whether avoidance and treatment are successful or effective in immunotherapy and avoid- ance studies of asthma.

At present, the content of ECP in the body fluids is still detected using an enzyme-linked immunosorbent assay (ELISA) kit.

There is no commercial kit for detecting the ECP mRNA. The ELISA method has the problems of small detection range, low sensitivity and unsatisfactory accuracy during the detection. Therefore, it is very necessary to establish a detection method for an expression of the ECP mRNA with high accuracy, wide detection range and high sensitivity.

SUMMARY

The purpose of the present disclosure is to provide a primer set for detection of an expression of a human ECP mRNA and a kit.

An expression level of the ECP mRNA can be one-step quantitatively detected. The present disclosure provides a detection method with high accuracy, wide detection range and high sensitivity for the detection of ECP protein.

In order to realize the above objective, the present disclo- sure provides the following technical solutions:

The present disclosure provides a primer set for detection of an expression of a human ECP mRNA, including an ECP-F, an ECP-R, a

GAPDH-F and a GAPDH-R; where the ECP-F has a nucleotide sequence shown in SEQ ID NO. 1, the ECP-R has a nucleotide sequence shown in SEQ ID NO. 2, the

GAPDH-F has a nucleotide sequence shown in SEQ ID NO. 3, and the

GAPDH-R has a nucleotide sequence shown in SEQ ID NO. 4.

Preferably, the primer set may further include a probe E-

Probe and a probe G-Probe; where the E-Probe has a nucleotide sequence shown in SEQ ID NO. 5, and the G-Probe has a nucleotide sequence shown in SEQ ID NO. 6.

Preferably, 5'-ends of the probe E-Probe and the probe G-

Probe may be both connected with a fluorescent group, and 3'-ends of the probe E-Probe and the probe G-Probe may be both connected with a quenching group.

Preferably, the 5'-ends of the probes E-Probe and G-Probe may be connected with different fluorescent groups, and the 3'-ends of the probes E-Probe and G-Probe may be connected with a same quenching group.

The present disclosure further provides a kit for one-step detection of an expression of a human ECP mRNA, including the pri- mer set.

Preferably, the kit may further include a PCR reaction solu- tion, an enzyme mixed solution, a ROX reference dye and nuclease- free water; where the enzyme mixed solution may include a Tag enzyme, a reverse transcriptase, an RNase inhibitor and a Taq enzyme antibody with a mass ratio of 13:5:3:1.

Preferably, the PCR reaction solution may include a dNTP mix,

MgCl; and a buffer.

Preferably, the kit may further include a standard of the hu- man ECP mRNA.

The present disclosure provides a primer set for detection of an expression of a human ECP mRNA, and constructs a kit for one- step detection using the primer set. In the present disclosure, the one-step detection of the expression level of the human ECP mRNA is conducted using the primer set or the kit. Compared with immunological detection methods, the detection has higher sensi- tivity, can detect low-concentration clinical samples, can more sensitively detect changes in ECP content, and has a detection range spanning at least 6 orders of magnitude. Accordingly, the accuracy of the detection results is increased, and at least 80 people can be detected within 1 hour, such that the treatment ef- fect can be dynamically monitored and evaluated in an earlier, more accurate, and faster manner. The primer set or the kit is used to detect level changes of the ECP mRNA in patients, and the detection can be used to monitor asthma and other allergic diseas- es or eosinophil infiltration inflammation, guide glucocorticoid therapy plan, and find patients who do not comply with treatment.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a standard curve of a TagMan real-time fluorescent quantitative RT-PCR for ECP mRNA.

FIG. 2 is a result of a precision detection, Herein, 1: 1.0x10° copies/uL, and 2: 1.0x10° copies/uL.

FIG. 3 is a result of accuracy detection.

FIG. 4 is a result of sensitivity detection.

FIG. 5 is a result of clinical sample detection. Herein, 1: positive sample 4 GAPDH mRNA; 2: healthy control 2 GAPDH mRNA; 3: positive sample 4 ECP mRNA; 4: healthy control 2 ECP mRNA; 5: blank control NTC-GAPDH mRNA; 6: blank control NTC-ECP mRNA.

FIG. 6 is a low-precision amplification curve in the case of non-optimal primer and probe designs.

FIG. 7 is an effect of an enzyme mixed solution on an ampli- fication curve.

FIG. 8 is a plasmid structure of a pGM-T vector.

DETAILED DESCRIPTION OF THE EMBODIMENTS

GAPDH-F has a nucleotide sequence shown in SEQ ID NO. 3, and the

GAPDH-R has a nucleotide sequence shown in SEQ ID NO. 4.

In the present disclosure, the primer set preferably further includes a probe E-Probe and a probe G-Probe; where the E-Probe has a nucleotide sequence shown in SEQ ID NO. 5, and the G-Probe has a nucleotide sequence shown in SEQ ID NO. 6. 5'-ends of the probe E-Probe and the probe G-Probe are both preferably connected with a fluorescent group, and 3'-ends of the probe E-Probe and the probe G-Probe are both preferably connected with a quenching group; and the 5'-ends are separately connected with different 5 fluorescent groups, and the 3'-ends are connected with a same quenching group. In an example, an 5'-end of the nucleotide se- quence of the probe E-Probe is labeled with a 6-carboxyfluorescein (FAM) fluorescent reporter group, and a 3'-end of the nucleotide sequence of the probe E-Probe is labeled with a Black Hole Quench- er-1 (BHQ1l) quenching group; and the 5'-end is labeled with a 2,7- dimethy1-4,5-dichloro-6-carboxyfluorescein (JOE) fluorescent re- porter group, and the 3'-end is labeled with a BHQ1 quenching group.

The present disclosure lists an information of the above pri- mer set in Table 1.

Table 1 Information of the primer set for TagMan real-time fluorescent quantitative PCR pe preeesen fe

Name Primer sequence {5'-3') fragment NO.

CGCCACAGTTTCCCGGAG 70 bp 4

ET

In the present disclosure, the kit preferably further in- cludes a PCR reaction solution, an enzyme mixed solution, a ROX reference dye and nuclease-free water; where an enzyme in the en- zyme mixed solution includes a Tag enzyme, a reverse transcrip- tase, an RNase inhibitor and a Tag enzyme antibody with a mass ra- tio of preferably 13:5:3:1=13:5:3:1 to obtain an optimal amplifi- cation effect.

In the present disclosure, the PCR reaction solution prefera- bly includes a dNTP mix, MgCl, and a buffer.

In the present disclosure, the kit preferably further in- cludes a standard of the human ECP mRNA. There is no special limi- tation on a preparation method of the standard of the human ECP mRNA. The ECP mRNA is preferably constructed and synthesized by entrusting Nanjing GenScript Biotech Co., Ltd., and is diluted to 1.0x10° copies/pL using the nuclease-free water to obtain the ECP standard. The standard is preferably a standard of the ECP mRNA for preparing a quantitative curve.

In the present disclosure, the upstream and downstream pri- mers in the kit have a working concentration of preferably 0.5-1 uM; and the probe has a working concentration of preferably 1.5-2

UM.

In the present disclosure, the Tag enzyme is a heat-resistant

Tag DNA polymerase, deoxynucleotides in the dNTP are added to a 3-

OH terminus one by one using the 3'-5' polymerase activity of the

Taq enzyme and using DNA as a template. Meanwhile, mismatched pri- mer ends can be identified and eliminated using the 5133! exonu- clease activity of the Tag enzyme, which is related to the correc- tion function during the replication; nucleotides can also be hy- drolyzed from the 5'-end and mismatched nucleotides can also be excised through several nucleotides. In this way, the chain re- placement is realized during the chain extension, and the replaced probe is cut off. The reverse transcriptase can reverse transcribe an mRNA into a cDNA for PCR reaction. The RNase inhibitor is used to suppress the activity of an exogenous RNase. The Tag enzyme an- tibody is an anti-Tag antibody for hot-start PCR, inhibits DNA polymerase activity after binding to the Tag enzyme, and can ef- fectively suppress the non-specific annealing of primers and the non-specific amplification caused by primer dimers under low tem- perature. The Tag enzyme antibody is denatured during the initial

DNA denaturation of the PCR reaction, and the Tag enzyme recovers the activity to realize PCR amplification.

The present disclosure further provides a method for one-step detection of an expression level of the ECP mRNA, including the following steps: preparing a quantitative reverse transcription- polymerase chain reaction (gRT-PCR) reaction system using an ex- tracted RNA and the ECP standard as templates separately, and con-

ducting a gRT-PCR reaction using the ECP standard to obtain a quantitative curve, and measuring the expression level of the ECP.

In the present disclosure, there is no special limitation on the extraction source of the RNA, and the RNA can be extracted preferably from whole-blood, serum, nasal secretions, bronchial irrigating fluid, saliva or tears. In an example, the detection is conducted preferably by extracting an RNA from whole-blood.

In the present disclosure, the qRT-PCR reaction system, cal- culated in 20 uL, preferably includes: 2.4 uL of the nuclease-free water, 10 pL of the PCR reaction solution, 0.5 pL of the enzyme mixed solution, 0.1 pL of the ROX reference dye, 2 pL of a mixed solution of the primer set and the probe, and 5 pL of the stand- ard/whole-blood RNA.

In the present disclosure, a qRT-PCR program preferably in- cludes: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 s, 40 cycles.

In the present disclosure, the quantitative curve uses a copy number logarithm as an abscissa (x) and a Ct value as an ordinate (v): y=-3.27x+35.533 (R°=0.999); and a linear range is 1.0x10°- 1.0x10’ copies/pL. The method of the present disclosure has better sensitivity than imported fluorescent enzyme immunoassay reagents and better specificity than domestic enzyme immunoassay reagents when detecting the ECP mRNA.

The primer set for detection of an expression of a human ECP mRNA and the kit provided by the present disclosure are described in detail below with reference to the examples, but these examples should not be understood as limiting the claimed protection scope of the present disclosure.

Unless otherwise specified, the testing materials used in the present disclosure are all conventionally-purchased: a whole-blood total RNA kit (Hangzhou Simgen Biological Rea- gent Development Co., Ltd., product number: 5201050}; a HiScribe T7 High Yield RNA Synthesis Kit (New England Bi- olabs, product number: E20505); an Applied Biosystems™ 7300 fluorescence quantitative PCR in- strument (Thermo Fisher Scientific, USA); a -80°C low-temperature refrigerator (Thermo Fisher Scien-

tific, USA); a high-speed and low-temperature table centrifuge (Eppendorf,

Germany); and a Qubit 3 fluorometer (Thermo Fisher Scientific, USA).

Example 1 1. Shanghai Sunny Biotechnology Co., Ltd. was entrusted to synthesize the primers and probes shown in Table 1. 2. Preparation of a standard

In-vitro transcription: a pGM-T ligation kit [TIANGEN Biotech (Beijing)Co.,Ltd., product number: VT202-01] was used, a ECP plas- mid DNA (constructed and synthesized by entrusting Nanjing

GenScript Biotech Co., Ltd., FIG. 8) was constructed using a pGM-T as a vector, and the ECP plasmid DNA was transcribed into an mRNA in vitro using a HiScribe T7 High Yield RNA Synthesis Kit (NEW

ENGLAND BioLabs, product number: E20405).

An initial copy number of RNA was calculated according to a copy number calculation formula: copy number=[6.02x10%xRNA concen- tration (ng/uL)x10°]/[RNA length (bp)x340]. The ECP mRNA was di- luted with nuclease-free water to 1.0x10° copies/uL to obtain an

ECP mRNA standard. 3. Extraction and dilution of whole-blood RNA

Whole-blood total RNA was extracted from ethylenediaminetet- raacetic acid (EDTA) anticoagulated whole-blood samples with the whole-blood total RNA kit, guantificated with the Qubit 3 fluorom- eter, and diluted with the nuclease-free water to 20 ng/uL. 4. TagMan real-time fluorescent quantitative PCR

A 20 pl system was prepared using the standard/whole-blood

RNA as a template with: 2.4 pL of nuclease-free water, 10 pL of a

PCR reaction solution, 0.5 uL of an enzyme mixed solution, 0.1 pL of a ROX reference dye, 2 pL of a mixed solution of the primer set and the probe, and 5 pL of a standard/whole-blood RNA.

A gRT-PCR program includes: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 s, 40 cycles; and a detection fluo- rescein was set up: FAM, JOE; a reference fluorescence was: ROX; a reaction system was: 20 pL; and a fluorescence signal collection was: 60°C for 31 sec. 5. Generation of a standard curve

The ECP mRNA standard was diluted in a 10-fold gradient using 1.0x107-1.0%10° copies/uL as a template, 2 replicates were conduct- ed for each dilution, and TagMan real-time fluorescent quantita- tive RT-PCR detection was conducted to generate a standard curve.

The standard curve is shown in FIG. 1. A copy number loga- rithm is taken as an abscissa and a Ct value is taken as an ordi- nate, and a regression equation is obtained: y=-3.27x+35.533 (R®=0.999), indicating the copy number logarithm of the standard equation has a very high correlation with the Ct value. 6. Precision detection 1.0x10° copies/nL and 1.0x10° copies/nL of ECP mRNA standards were taken as a template, 10 replicates were conducted for each concentration; 10 times of TagMan real-time fluorescent quantita- tive RT-PCR detections were conducted, the coefficient of varia- tion of the logarithm of each concentration was calculated, re- spectively; and statistical analysis was conducted to analyze the precision of the detection method.

The results are shown in Table 2 and FIG. 2. The coefficient of variation of the logarithm of each concentration is 0.460% and 1.575% separately, which are less than 5%, indicating that the

TagMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has excellent precision.

Table 2 Precision detection result

SD C.V number logarithm 7. Accuracy detection

A 1.0x10° copies/pL of ECP mRNA standard was taken as a tem- plate, for 3 replicates; 3 times of TagMan real-time fluorescent quantitative RT-PCR detections were conducted, and the absolute deviation of the logarithm of each concentration was calculated.

The results are shown in FIG. 3. The absolute deviation of the logarithm of each concentration is-0.130, -0.135, and -0.143, re- spectively, within the range of +0.5, indicating that the TagMan real-time fluorescent quantitative RT-PCR detection method estab- lished by the present disclosure has excellent accuracy.

Table 3 Accuracy detection orn EE =

Copy number Theoretical copy Absolute

Cr Results {(copies/ul) copy number logarithm number logarithm deviation {copies/pl} 4.865 1.000x10° | 5.000 8. Sensitivity detection

A 10.0 copies/uL of ECP mRNA standard was taken as a tem- plate, for 25 replicates, 25 times of TaqMan real-time fluorescent quantitative RT-PCR detections were conducted to check whether there were amplifications, and the sensitivity of the detection method was analyzed.

The results are shown in Table 4 and FIG. 4. A total of 25 detection results are obtained, reaching 100%. This indicates that the TagMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has very high sensi- tivity, and the minimum number of detected copies is less than 10 copies/pL.

Table 4 Ct value results of sensitivity detection 9. Clinical sample detection

Whole-blood samples of positive samples and healthy controls were taken to extract and dilute whole-blood RNA according to 3, and the TagMan real-time fluorescent quantitative RT-PCR detection was conducted according to 4.

Compared with a domestic brand of human ribonuclease A3 (RNASE3/ECP) enzyme-linked immunosorbent assay (ELISA) kit and an

ImmunCAP™ ECP reagent widely-used abroad, the results are shown in

Table 5 and FIG. 5. The TagMan real-time fluorescent quantitative

RT-PCR detection method established in the present disclosure has better sensitivity than imported fluorescent enzyme immunoassay reagents and better specificity than domestic enzyme immunoassay reagents.

Table 5 Comparison result of clinical sample detection

ImmunoCAP ECP cent RT-PCR) ELISA kit

SN | Sample type posi- Posi- Posi-

Result Result

Results {copies/ulL) tive/neg tive/nega tive/neg — EEE : : ames | |e 6 | Positive sample 6 466.318 + 12.3 | ees | + air ae sews © aor | wm a

Comparative Examples 1 Results of amplification using other non-optimal primers and probes

The primers and probes in the system used in the present dis- closure in Example 5 were replaced with other non-optimal primers and probes. The result is shown in FIG. 6. The amplification re- sult of the standard curve is poor, with an amplification effi- ciency of only 68.547%.

Non-optimal ECP primers and probes were used as follows:

ECP-F (SEQ ID NO.7): TGAACCCCAGAACAACCAG;

ECP-R (SEQ ID NO.8): CAGTTTATTGCAGGGTTCACA; and

Probe (SEQ ID NO0.9): (FAM) -CCAAAATCAAGTGGGGCGAT- (BHQ1).

Comparative Examples 2 Comparison of the effect of enzyme mixed solution

Amplification was conducted on 2 cases of whole-blood RNA samples using a non-optimal ratio of enzyme mixed solution (the

Tag enzyme, reverse transcriptase, RNase inhibitor and Tag enzyme antibody had a mass ratio of 11:6:4:1) and an optimal ratio of en-

zyme mixed solution. An amplification result using the non-optimal ratio of enzyme mixed solution is shown in FIG. 7A, and an ampli- fication result using the optimal ratio of enzyme mixed solution is shown in FIG. 7B. It can be seen that the optimal enzyme mixed solution has better amplification effect.

The above descriptions are merely preferred implementations of the present disclosure. It should be noted that a person of or- dinary skill in the art may further make several improvements and modifications without departing from the principle of the present disclosure, but such improvements and modifications should be deemed as falling within the protection scope of the present dis- closure.

SEQUENCE LISTING

<110> Hangzhou Zheda Dixzun Biological Gene Engineering Co., Ltd. <120> PRIMER SET FOR DETECTION OF EXPRESSION OF HUMAN EOSINOPHIL <130> HKJP2021121068 <150> 2021108%91409.7 <151> 2021-08-04 <160> 9 <170> PatentIn version 3.5 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer ECP-F <400> 1 acagctcaga gactgggaaa c 21 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer ECP-R <400> 2 cccataagcc ccaacagaag 20 <210> 3 40 <211> 21

<212> DNA <213> Artificial Sequence <220> <223> Primer GAPDH-F <400> 3 gacaacagcc tcaagatcat c 21

<210> 4 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Primer GAPDH-R <400> 4 cgccacagtt tcccggag 18 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of E-Probe

<400> 5 tggttccaaa actgttcact tcce 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence 40 <220>

<223> DNA sequence of G-Probe <400> 6 actcatgacc acagtccatg ccat 24

<210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Non-optimal ECP primer ECP-F <400> 7 tgaaccccag aacaaccag 19 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Non-optimal ECP primer ECP-R <400> 8 cagtttattg cagggttcac a 21

<210> 9 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> DNA sequence of Non-optimal ECP probe <400> 9 40 ccaaaatcaa gtggggcgat 20

SEQUENCE LISTING

<110> Hangzhou Zheda Dixun Biological Gene Engineering Co., Ltd. <120> PRIMER SET FOR DETECTION OF EXPRESSION OF HUMAN EOSINOPHIL <130> HKJIP2021121068 <150> 202110891409.7 <151> 2021-08-04 <160> 9 <170> PatentIn version 3.5 <21e> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer ECP-F <400> 1 acagctcaga gactgggaaa c 21 <2105 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer ECP-R <400> 2 cccataagcc ccaacagaag 20 <2105 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer GAPDH-F <400> 3 gacaacagcc tcaagatcat c 21 <2105 4 <211> 18 <212> DNA

<213> Artificial Sequence

<220>

<223> Primer GAPDH-R

<400> 4 cgccacagtt tcccggag 18 <210>5 5

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> DNA sequence of E-Probe

<400> 5 tggttccaaa actgttcact tccc 24 <210> 6

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> DNA sequence of G-Probe

<400> 6 actcatgacc acagtccatg ccat 24 <210> 7

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Non-optimal ECP primer ECP-F

<400> 7 tgaaccccag aacaaccag 19 <2105 8

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Non-optimal ECP primer ECP-R

<400> 8 cagtttattg cagggttcac a 21 <210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> DNA sequence of Non-optimal ECP probe

<400> 9 ccaaaatcaa gtggggcgat 20

Claims

CONCLUSIONS

A primer set for detecting an expression of a human eosinophilic cationic protein (ECP) mRNA comprising an ECP-F, an ECP-R, a GAPDH-F and a GAPDH-R; wherein the ECP-F has a nucleotide sequence shown in SEQ ID

NO. 1, the ECP-R has a nucleotide sequence shown in SEQ ID NO. 2, the GAPDH-F has a nucleotide sequence shown in SEQ ID NO. 3, and the GAPDH-R has a nucleotide sequence shown in SEQ ID NO. 4.

A primer set according to claim 1, further comprising a probe E-Probe and a probe G-Probe; wherein the E-Probe has a nucleotide sequence shown in SEQ ID NO. 5, and the G-Probe has a nucleotide sequence shown in SEQ ID NO. 6.

The primer set according to claim 2, wherein 5' ends of the probe E-Probe and the probe G-Probe are both linked with a fluorescent group, and 3' ends of the probe E-Probe and the probe G-Probe both are connected to a gunch group.

A primer set according to claim 2 or 3, wherein the 5' ends of the probes E-Probe and G-Probe are connected to different fluorescent groups, and the 3' ends of the probes E-Probe and G-Probe are linked to the same quench group.

A kit for the one-step detection of an expression of a human ECP mRNA comprising the primer set according to any one of claims 1-

4.

The kit of claim 5, further comprising a PCR reaction solution, a mixed enzyme solution, a carboxy-X-rhodamine (ROX) reference dye and nuclease-free water; wherein an enzyme in the mixed enzyme solution is a thermus aquaticus (Taq) enzyme, a reverse transcriptase, a ribonuclease (RNase)

inhibitor and a Tag enzyme antibody with a mass ratio of 13:5:3:1.

The kit of claim 6, wherein the PCR reaction solution is a mixture of deoxy ribonucleoside triphosphate (dNTP) mixture, MgCl. and includes a buffer.

The kit according to claim 5 or 6, further comprising a standard of the human ECP mRNA.