NL2030978B1 - Primer probe set for human histamine receptor hrh1 mrna detection, kit and use - Google Patents
Primer probe set for human histamine receptor hrh1 mrna detection, kit and use Download PDFInfo
- Publication number
- NL2030978B1 NL2030978B1 NL2030978A NL2030978A NL2030978B1 NL 2030978 B1 NL2030978 B1 NL 2030978B1 NL 2030978 A NL2030978 A NL 2030978A NL 2030978 A NL2030978 A NL 2030978A NL 2030978 B1 NL2030978 B1 NL 2030978B1
- Authority
- NL
- Netherlands
- Prior art keywords
- probe
- hrh1
- primer
- gapdh
- kit
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present disclosure provides a primer probe set for human histamine receptor HRH] mRNA detection, a kit and use, and relates to the technical field, of biological detection. In the present disclosure, the primer probe set includes a HRHl—F, a HRHl—R and a probe Hl—Probe; where the HRHl—F has a nucleotide sequence shown in SEQ ID NO. l, the HRHl—R has a nucleotide sequence shown in SEQ ID NO. 2, and the probe Hl—Probe has a nucleotide sequence shown in SEQ ID NO. 3. The present disclosure provides a kit including the primer probe set and a detection method. An expression level of the HRH] mRNA can be detected using an RNA one—step method. The present disclosure provides a detection method with high accuracy, wide detection range and high sensitivity for detection of HRHl proteins.
Description
PRIMER PROBE SET FOR HUMAN HISTAMINE RECEPTOR HRHI MRNA DETECTION,
KIT AND USE
The present disclosure belongs to the technical field of bio- logical detection, and specifically relates to a primer probe set for human histamine receptor HRHI mRNA detection, a kit and use.
Histamine is an active amine compound widely present in ani- mals and plants. The histamine is formed by the decarboxylation of histidine and is usually stored in mast cells of tissues. Hista- mine is an important chemical conductive substance in the body, and can affect many cellular reactions, including allergies, in- flammatory reactions, gastric acid secretion, etc. When the body is stimulated to trigger an antigen-antibody reaction, the cell membrane permeability of mast cells is changed to release the his- tamine, and the histamine interacts with a histamine receptor to produce pathophysiological effects. The synthesis of a histamine mainly occurs in mast cells, basophils, lungs, skin and gastroin- testinal mucosa, and is consistent with the tissues that store the histamine. Histamine, like other transmitters, binds to specific receptors on target cells, thereby changing the biological activi- ty of cells and exerting wide physiological or pathological ef- fects. The inflammatory effect of histamine, namely the effect of histamine on the immune homeostasis in the body depends on the ex- pression and activity of currently-known 4 histamine receptors.
The 4 histamine receptors are named in the order of discovery as follows: a histamine 1 (Hl) receptor, a histamine 2 (H2) receptor, a histamine 3 (H3) receptor, and a histamine 4 (H4) receptor; where, the Hl receptor is very important in mediating the occur- rence of allergic inflammations, including promoting the matura- tion of dendritic cells and regulating the balance between T help- er 1 (Thl) cells/T helper 2 (Th2) cells. The Hl receptor is a mem- ber of the rhodopsin-like family of G protein-coupled receptors
(GPCR). The Hl receptor is mainly expressed in endothelium, smooth muscle, vascular endothelial cells, heart and central nervous sys- tem, and regulate vasodilation and bronchoconstriction. The Hl re- ceptor is a main therapeutic target for allergy. When histamine acts on the Hl receptor, the intracellular cyclic guanosine mono- phosphate (C-GMP) increases, showing increased heart rate, vaso- constriction, bronchoconstriction, small intestinal smooth muscle contraction, and increased microvascular permeability. Generally, the activated and non-activated forms of the Hl receptor are in an equilibrium state. In allergic diseases, a large amount of immuno- globulins E (IgE) stimulate the mast cells and basophils to re- lease histamine to activate the histamine receptors, leading to symptoms of allergic diseases. The expression level of histamine receptor mRNA in allergic patients is higher than that in healthy people.
Hl antihistamines are widely used in the treatment of aller- gic diseases such as seasonal and perennial allergic rhinitis, ur- ticaria and atopic dermatitis. The Hl antihistamines exert the an- tihistamine effect mainly by inversely agonizing an inactive form of the Hl receptor. Hl antihistamines can not only down-regulate the expression level of Hl receptor mRNA induced by histamine, but also down-regulate the basal expression level of Hl receptor and reduce its inherent activity without histamine stimulation.
Most patients with allergic diseases use symptomatic treat- ment based on the experience of doctors and use antihistamines to relieve allergic symptoms. However, antihistamine therapy is not effective for all patients, and cannot quantify the therapeutic effect. There are no relevant studies or records on this at pre- sent.
In view of this, the present disclosure provides a primer probe set for human histamine receptor HRHI mRNA detection, a kit and use. An expression level of the HRHI mRNA can be one-step quantitatively detected. The present disclosure provides a detec- tion method with high accuracy, wide detection range and high sen- sitivity for the detection of HRH1 proteins.
In order to realize the above objective, the present disclo- sure provides the following technical solutions:
The present disclosure provides a primer probe set for human histamine receptor HRHI mRNA detection, including a HRHI-F, a
HRH1-R and a probe Hl-Probe; where the HRH1-F has a nucleotide sequence shown in SEQ ID NO. 1, the HRH1-R has a nucleotide sequence shown in SEQ ID NO. 2, and the probe Hl-Probe has a nucleotide sequence shown in SEQ ID NO. 3.
Preferably, the primer probe set may further include a primer pair and a probe of a reference gene GAPDH, where the primer pair of the GAPDH may include a GAPDH-F and a GAPDH-R, and the probe of the GAPDH may include a G-Probe; and the GAPDH-F may have a nucleotide sequence shown in SEQ ID
NO. 4, the GAPDH-R may have a nucleotide sequence shown in SEQ ID
NC. 5, and the G-Probe may have a nucleotide sequence shown in SEQ
ID NO. ID NO. 6.
Preferably, 5'-ends of the probes Hl-Probe and G-Probe may be each labeled with different fluorescent labeling groups, and 3'- ends of the probes Hl-Probe and G-Probe may be each labeled with a same quenching group or different guenching groups.
Preferably, the fluorescent labeling group may include a 6- carboxyfluorescein (FAM) or a 2,7-dimethyl-4,5-dichloro-6- carboxyfluorescein (JOE), and the quenching group may include a
Black Hole Quencher-1 (BHQ1).
The present disclosure further provides a kit for one-step detection of an expression level of a human histamine receptor
HRHI mRNA, including a mixed solution of the primer probe set, a
PCR reaction solution, an enzyme mixed solution, a human histamine receptor HRH1 standard, an carboxy-X-rhodamine (ROX)reference dye and nuclease-free water.
Preferably, the HRH1-F, the HRH1-R, the probe Hl-Probe, the
GAPDH-F, the GAPDH-R and the G-Probe in the mixed solution of the primer probe set may have a concentration of 1 nM, 1 nM, 1.5 nM, 2 nM, 2 nM and 3 nM, respectively.
Preferably, the PCR reaction solution may include a deoxy- ribonucleoside triphosphate (dNTP) mix, MgCl, and a buffer; and the enzyme mixed solution may include a thermus aquaticus (Tag) enzyme, a reverse transcriptase, a ribonuclease (RNase) in- hibitor and a Tag enzyme antibody with a mass ratio of 15:6:3:1.
The present disclosure further provides a method for one-step detection of an expression level of the human histamine receptor
HRHI1 mRNA based on the kit, including the following steps: prepar- ing a reaction system with the kit by using the human histamine receptor HRH1 standard as a template, conducting a quantitative real-time polymerase chain reaction (gRT-PCR), and constructing a standard curve using a logarithm of a copy number as an abscissa and a Ct value as an ordinate; preparing the same reaction system using an RNA extracted from a sample as a template, conducting the same RT-PCR, and measuring the expression level of the human histamine receptor
HRHI mRNA using the standard curve.
Preferably, the reaction system, calculated in 20 pL, may in- clude: 2.4 pL of the nuclease-free water, 10 uL of the PCR reac- tion solution, 0.5 pL of the enzyme mixed solution, 0.5 pL of the
ROX reference dye, 2 uL of the mixed solution of the primer probe set and 5 UL of the template.
Preferably, a RT-PCR program may include: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 sg, 40 cycles.
Preferably, the standard curve may be y=-3.177x+34.178,
R°=0.996.
The present disclosure further provides use of the primer probe set or the kit as a basis for the preparation of a medicine for treating immune diseases or as a tool for dynamically monitor- ing therapeutic effects.
The present disclosure provides a primer probe set for human histamine receptor HRHI mRNA detection, and a kit including the primer probe set, which can detect the expression level of the hu- man histamine receptor HRHI mRNA by an RNA one-step method. On the one hand, whether the patient's allergic symptoms are caused by the histamine pathway can be determined (allergy symptoms caused by a non-histamine pathway do not express histamine receptors) and the dosage can be guided (a higher Hl receptor expression requires a higher dose of Hl antihistamines). On the other hand, the treat-
ment effect of Hl antihistamines can be dynamically monitored, thereby providing a detection method with high accuracy, wide de- tection range and high sensitivity for the detection of HRH1 pro- teins. 5 In the present disclosure, the primer probes constitute a kit, and one-step detection is conducted based on the kit without separate reverse transcription, which greatly reduces the risk of causing aerosol pollution. Compared with immunological detection methods, the detection method of the present disclosure has high sensitivity, can detect low-concentration clinical samples, can sensitively detect changes in HRH1 content, and has a detection range spanning at least 6 orders of magnitude. Accordingly, the accuracy of the detection results is increased, and at least 80 people can be detected within 1 hour, such that the treatment ef- fect can be dynamically monitored and evaluated in an earlier, more accurate, and faster manner.
FIG. 1 is a standard curve of TagMan real-time fluorescence quantitative RT-PCR for HRHI mRNA.
FIG. 2 is a result of precision detection, where 1: 1.0x10’ copies/uL, and 2: 1.0x10% copies/pL.
FIG. 3 is a result of accuracy detection.
FIG. 4 is a result of sensitivity detection.
FIG. 5 is a result of clinical sample detection, where 1:
Case 1 GAPDH mRNA before treatment; 2: Case 1 GAPDH mRNA after treatment; 3: Case 1 HRHI mRNA before treatment; 4: Case 1 HRHI mRNA after treatment.
FIG. 6 is a low-precision amplification curve in the case of non-optimal primer and probe designs.
FIG. 7 is an effect of enzyme mixed solution on amplifica- tion.
FIG. 8 is a plasmid map of pGM-T vector.
The present disclosure provides a primer probe set for human histamine receptor HRHI mRNA detection, including a HRHI-F, a
HRH1-R and a probe Hl-Probe; where the HRH1-F has a nucleotide sequence shown in SEQ ID NO. 1, the HRH1-R has a nucleotide sequence shown in SEQ ID NO. 2, and the probe H1-Probe has a nucleotide sequence shown in SEQ ID NO. 3.
In the present disclosure, the primer probe set preferably further includes a primer pair and a probe of a reference gene
GAPDH, the primer pair of the GAPDH preferably includes a GAPDH-F and a GAPDH-R, and the probe of the GAPDH preferably includes a G-
Probe; the GAPDH-F preferably has a nucleotide sequence shown in
SEQ ID NO. 4, the GAPDH-R preferably has a nucleotide sequence shown in SEQ ID NO. 5, and the G-Probe preferably has a nucleotide sequence shown in SEQ ID NO. 6. In the present disclosure, 5'-ends of the probes Hl-Probe and G-Probe are each labeled with different fluorescent labeling groups, and 3'-ends of the probes H1-Probe and G-Probe are each labeled with a same quenching group or dif- ferent quenching groups; and the fluorescent labeling group pref- erably includes a FAM or a JOE, and the quenching group includes a
BHQ1. In an example of the present disclosure, for the probe Hl-
Probe, the 5'-end is labeled with the FAM, and the 3'-end is la- beled with the BHQ1; for the probe G-Probe, the 5'-end is labeled with the JOE, and the 3'-end is labeled with the BHQ1. The present disclosure preferably entrusts Shanghai Sunny Biotechnology Co.,
Ltd. to synthesize the above primers (Table 1).
Table 1 TagMan real-time fluorescence quantitative PCR of primer probe
In the present disclosure, the primer probe set when being used is preferably in the form of a mixed solution; and the HRH1-
FP, the HRH1-R, the probe Hl-Probe, the GAPDH-F, the GAPDH-R and the G-Probe in the mixed solution of the primer probe set have a concentration of 1 nM, 1 nM, 1.5 nM, 2 nM, 2 nM and 3 nM, respec- tively.
The present disclosure further provides a kit for one-step detection of an expression level of a human histamine receptor
HRHI mRNA, including a mixed solution of the primer probe set, a
PCR reaction solution, an enzyme mixed solution, a human histamine receptor HRH1 standard, an ROX reference dye and nuclease-free wa- ter.
In the present disclosure, the mixed solution is preferably the same as the above mixed solution and is not further described any more.
In the present disclosure, the PCR reaction solution prefera- bly includes a dNTP mix, MgCl: and a buffer; the dNTP mix is pref- erably a mixture of a dATP, a dTTP, a dCTP, and a dGTP, which is purchased from Thermo Fisher Scientific (product number: R0132), and has a working concentration of preferably 0.1-1 mM; the MgCl, has a concentration of preferably 5-20 mM; and the buffer is a 10- 50 mM Tris-HCl buffer (at pH 8.0). The enzyme mixed solution pref- erably includes a Tag enzyme, a reverse transcriptase, an RNase inhibitor and a Tag enzyme antibody with a mass ratio of prefera- bly 15:6:3:1 to obtain the best amplification efficiency. The his- tamine receptor HRH1 standard is preferably an RNA standard for preparing a standard curve.
In the present disclosure, the Tag enzyme is a heat-resistant
Tag DNA polymerase, deoxynucleotides in the dNTP are added to a 3-
OH terminus one by one using the 3'5' polymerase activity of the
Taq enzyme and using DNA as a template; meanwhile, mismatched pri- mer ends can be identified and eliminated using the 5'-3' exonu- clease activity of the Taq enzyme, which is related to the correc- tion function during the replication process, nucleotides can also be hydrolyzed from the 5'-end and mismatched nucleotides can also be excised through several nucleotides. In this way, the chain re- placement is realized during the chain extension, and the replaced probe is cut off. The reverse transcriptase can reverse transcribe a mRNA into a cDNA for PCR reaction. The RNase inhibitor is used to suppress the activity of an exogencus RNase. The Taq enzyme an-
tibody is an anti-Tag antibody for hot-start PCR, inhibits DNA polymerase activity after binding to the Tag enzyme, and can ef- fectively suppress the non-specific annealing of primers and the non-specific amplification caused by primer dimers under low tem- perature conditions. Taq enzyme antibody is denatured during the initial DNA denaturation of the PCR reaction, and the Tag enzyme recovers the activity to realize PCR amplification.
The present disclosure further provides a method for one-step detection of the expression level of the human histamine receptor
HRHI mRNA based on the kit, including the following steps: prepar- ing a reaction system with the kit by using the human histamine receptor HRH1 standard as a template, conducting a quantitative real-time polymerase chain reaction (gRT-PCR), and constructing a standard curve using a logarithm of a copy number as an abscissa and a Ct value as an ordinate; preparing the same reaction system using an RNA extracted from a sample as a template, conducting the same qgRT-PCR, and measuring the expression level of the human histamine receptor
HRHI mRNA using the standard curve.
In the present disclosure, the reaction system, calculated in 20 pL, preferably includes: 2.4 uL of the nuclease-free water, 10
UL of the PCR reaction solution, 0.5 pL of the enzyme mixed solu- tion, 0.5 pL of the ROX reference dye, 2 pL of the mixed solution of the primer probe set and 5 pL of the standard or a to-be-tested
RNA sample. The RT-PCR reaction program preferably includes: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 s, 40 cycles. The standard curve is constructed using a logarithm of a copy number as an abscissa (x) and a Ct value as an ordinate (vy): y=-3.422x + 37.235 (R°=1.000). There is no special limitation on the source of the RNA, and the RNA can be extracted from human blood, nasal secretions, bronchial irrigating fluid, saliva or tear samples.
The present disclosure further provides use of the primer probe set or the kit as a basis for the preparation of a medicine for treating immune diseases or as a tool for dynamically monitor- ing therapeutic effects.
In the present disclosure, the use is preferably the same as the above method and is not further described any more.
The primer probe set for human histamine receptor HRHI mRNA detection, the kit and the use provided by the present disclosure are described in detail below with reference to the examples, but these examples should not be understood as limiting the claimed protection scope of the present disclosure.
Unless otherwise specified, the reagents, kits and instru- ments used in the present disclosure are all commercially- available conventional in the art: a whole-blood total RNA kit (Hangzhou Simgen Biological Rea- gent Development Co., Ltd., product number: 5201050); a HiScribe T7 High Yield RNA Synthesis Kit (New England Bi- olabs, product number: E2040S); an Applied Biosystems™ 7300 fluorescence quantitative PCR in- strument (Thermo Fisher Scientific, USA}; a -80°C low-temperature refrigerator (Thermo Fisher Scien- tific, USA); a high-speed and low-temperature table centrifuge (Eppendorf,
Germany); and a Qubit 3 Fluorometer (Thermo Fisher Scientific, USA).
Example 1 1. Shanghai Sunny Biotechnology Co., Ltd. was entrusted to synthesize the primers and probes shown in Table 1. 2. Preparation of a standard
In-vitro transcription: a pGM-T ligation kit [TIANGEN Biotech (Beijing) Co., Ltd., product number: VT202-01] was used, a HRH1 plasmid DNA (constructed and synthesized by entrusting Nanjing
GenScript Biotech Co., Ltd., FIG. 8) was constructed using a pGM-T as a vector, and HRH1 plasmid DNA was transcribed into a mRNA in vitro using the HiScribe T7 High Yield RNA Synthesis Kit (NEW ENG-
LAND Biolabs, product number: E20408).
The initial copy number of RNA was calculated according to a copy number calculation formula: copy number=[6.02x10“°xRNA concen- tration (ng/uL)x107°]/[RNA length (bp) *340]. The HRH! mRNA was di- luted with nuclease-free water to 1.0x10'" copies/uL, to obtain a
HRHI mRNA standard. 3. Extraction and dilution of whole-blood RNA: whole-blood total RNA was extracted from ethylenediaminetetraacetic acid (EDTA) anticoagulated whole-blood samples with the whole-blood to- tal RNA kit, quantificated with the Qubit 3 fluorometer, and di- luted with the nuclease-free water to 20 ng/uL. 4. TagMan real-time fluorescent quantitative PCR
A 20 pL system was prepared using the standard/whole-blood
RNA as a template with: 2.4 uL of the nuclease-free water, 10 uL of the PCR reaction solution, 0.5 pL of the enzyme mixed solution, 0.5 pL of the ROX reference dye, 2 uL of the mixed solution of the primer probe set and 5 pL of the standard or a to-be-tested RNA sample.
A gRT-PCR program was as follow: 42°C for 30 min; 95°C for 1 min; 95°C for 5 s, and 60°C for 31 s, 40 cycles. A detection fluo- rescein was set up: FAM, JOE; a reference fluorescence was: ROX; reaction system was: 20 pL; and the fluorescence signal collection was: 60°C for 31 sec. 5. Generation of a standard curve
The HRH1 standard was diluted in a 10-fold gradient using 1.0%10%-1.0x10% copies/pL as a template, 3 replicates were conduct- ed for each dilution, and TagMan real-time fluorescence quantita- tive RT-PCR detection was conducted to generate a standard curve.
The result is shown in FIG. 1. The logarithm of the copy num- ber is taken as the abscissa (x) and the Ct value is taken as the ordinate (y), and a regression equation is obtained: y=- 3.422x+37.235 (R*=1.000), indicating the logarithm of the copy num- ber of the standard equation has a very high correlation with the
Ct value. 6. Precision detection
Standards of 1.0x107 copies/nL and 1.0x10* copies/uL were tak- en as templates, 10 replicates were conducted for each concentra- tion; 10 times of TagMan real-time fluorescent quantitative RT-PCR detections were conducted, a coefficient of variation of the loga- rithm of each concentration was calculated, respectively; and a statistical analysis was conducted to analyze the precision of the detection method.
The results are shown in Table 2 and FIG. 2. The coefficient of variation of the logarithm of each concentration is 0.380% and
0.539% separately, and is less than 5%, indicating that the TagMan real-time fluorescent quantitative RT-PCR detection method estab- lished by the present disclosure has excellent precision.
Table 2 Precision detection result
Mean logarithm of copy =
Theoretical copy number SD C.V number 6.976 0.027 | 0.380% 1.0x10° 4.003 0.539% . ee] 7. Accuracy detection
A 1.0x10° copies/pL standard was subjected to a 30-time dilu- tion (2 pL 1.0x10° copies/pL standard + 58 pL nuclease-free water) as a template, for 3 replicates; 3 times of TagMan real-time fluo- rescence quantitative RT-PCR detections were conducted, and an ab- solute deviation of the logarithm of each concentration was calcu- lated. The results are shown in FIG. 3. The absolute deviation of the logarithm of each concentration is 0.013, -0.004, and -0.010, respectively, within the range of 0.5, indicating that the TagMan real-time fluorescent quantitative RT-PCR detection method estab- lished by the present disclosure has excellent accuracy.
Table 3 Accuracy detection data ee” mm
Results {copies/ | Copy number Theoretical copy Absolute
Cr number (cop-
HL} logarithm number logarithm | deviation ies/uL) 21.790 -0.010
B. Sensitivity detection
A 10.0 copies/ynL standard was taken as a template, for 25 replicates, 25 times of TagMan real-time fluorescence quantitative
RT-PCR detection were conducted to check whether there were ampli- fications, and the sensitivity of the detection method was ana- lyzed.
The results are shown in Table 4 and FIG. 4. A total of 25 detection results are obtained, reaching 100%. This indicates that the TagMan real-time fluorescent quantitative RT-PCR detection method established by the present disclosure has very high sensi-
tivity, and the minimum number of detected copies is less than 10 copies/ nL.
Table 4 Ct value results of sensitivity detection 32.435 | 32.450 | 32.998 | 33.082 | 31.590 32.149 | 31.957 | 32.612 | 32.142 | 31.225 31.892 | 32.739 | 32.496 | 32.059 | 32.104 31.829 | 32.396 | 32.925 | 32.076 | 31.819 33.021 | 31.887 | 32.168 | 32.670 | 31.634 9. Clinical sample detection
Whole-blood samples of patients and normal persons were taken to extract and dilute whole-blood RNA according to the above steps, and TagMan real-time fluorescent quantitative RT-PCR detec- tion was conducted according to the above steps.
Compared with a domestic brand of human histamine Hl receptor ({(HRH1) detection kit (enzyme-linked immunosorbent assay), the re- sults are shown in Table 5 and FIG. 5. The TagMan real-time fluo- rescent quantitative RT-PCR detection method established in the present disclosure has better sensitivity and specificity than that of a counterpart reagent, and can effectively monitor the treatment effect.
Table 5 Comparison of clinical sample detection experiments
Product of the present Human histamine H1 receptor {HRH1} detec- disclosure tion kit {enzyme-linked immunosorbent assay)
SN | Sample type
Results (cop- | Positive/
Results (ng/mL) Positive/ negative ies/ul} negative
Case 1 before 1 74.407 + 156.7 + treatment
Case 1 after 2 11.480 89.3 + treatment
Case 2 before 3 84.491 + 267.9 + treatment
Case 2 after 1.479 49.7 - treatment 5 | Case 3 before | 89.283 + 187.6 +
Ere fe 1.017 42.7 treatment
P [Coes wor fe sr
Pepe 3.964 32.7 trol 1 mn OC 9 3.027 67.9 + trol 2 a pe | fe 10 2.244 47.6 trol 3
Comparative Example 1 Results of amplification using other non-optimal primers and probes
The primers and probes in the system used in the present dis- closure in Example 6 were replaced with other non-optimal primers and probes. The results are shown in Table 6 and FIG. 6. A coeffi- cient of variation of the logarithm of the low-precision concen- tration exceeds 5%, reaching 8.006%.
Sequences of non-optimal HRH1 primers and probes were used:
HRH1-F (SEQ ID NO.7): CAGGGACTATGTAGCCGTCA;
HRH1-R (SEQ ID NO.8): AGAGAAGGATTGGCTATCACC; and
Hl-Probe (SEQ ID NO.9): (FAM)-CTGATATCTCGCTGGCCCCATG- (BHQ1}).
Table 6 Amplification of non-optimal primers and probes or fr TET J Je
SD C.V number ber
Comparative Example 2 Comparison of the effect of enzyme mixed solution
An amplification was conducted on 4 cases of whole-blood RNA samples using a non-optimal ratio of enzyme mixed solution (the
Tag enzyme, reverse transcriptase, RNase inhibitor and Tag enzyme antibody had a mass ratio of 13:7:4:1) and a best ratio of enzyme mixed solution. An amplification result using the non-optimal ra- tio of enzyme mixed solution is shown in FIG. 7 A, and an amplifi- cation result using the best ratio of enzyme mixed solution is shown in FIG. 7 B. It can be seen that the best enzyme mixed solu- tion has better repeatability and better amplification effect.
The above descriptions are merely preferred implementations of the present disclosure.
It should be noted that a person of or- dinary skill in the art may further make several improvements and modifications without departing from the principle of the present disclosure, but such improvements and modifications should be deemed as falling within the protection scope of the present dis- closure.
<110> Hangzhou Zheda Dixun Biological Gene Engineering Co., Ltd. <120> PRIMER PROBE SET FOR HUMAN HISTAMINE RECEPTOR HRH1 MRNA <130> HKJP2021121076 <150> 202110891576.1 <151> 2021-08-04 <160> 9 <170> Patentln version 3.5 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer HRH1-F <400> 1 aatccttctc tcgaacggac t 21 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer HRH1-R
<400> 2 ggcctgtgtt agacccactc 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of H1-Probe <400> 3 ttgcctttge ctggtgctgt c 21
<210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer GAPDH-F <400> 4 gacaacagcc tcaagatcat c 21 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer GAPDH-R
<400> 5 cgccacagtt tcccggag 18
<210> 6 <211> 24 <212> DNA <213> Artificial Sequence
<220> <223> DNA sequence of G-Probe <400> 6 actcatgacc acagtccatg ccat 24 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Non-optimal HRH1 primer HRH1-F
<400> 7 cagggactat gtagccgtca 20 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220>
<223> Non-optimal HRH1 primer HRH1-R
<400> 8 agagaaggat tggctatcac c 21
<210> 9
<211> 22
<212> DNA <213> Artificial Sequence
<220>
<223> DNA sequence of non-optimal HRH1 probe H1-Probe <400> 9 ctgatatctc gctggcccca tg 22
<110> Hangzhou Zheda Dixun Biological Gene Engineering Co., Ltd. <120> PRIMER PROBE SET FOR HUMAN HISTAMINE RECEPTOR HRH1 MRNA <130> HKJIP2021121076 <150> 2021190891576.1 <151> 2021-08-04 <160> 9 <170> PatentIn version 3.5 <21e> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer HRH1-F <400> 1 aatccttctc tcgaacggac t 21 <2105 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer HRH1-R <400> 2 ggcctgtgtt agacccactc 20 <2105 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of H1-Probe <400> 3 ttgcctttgc ctggtgctgt c 21 <2105 4 <211> 21 <212> DNA
<213> Artificial Sequence
<220>
<223> Primer GAPDH-F
<400> 4 gacaacagcc tcaagatcat c 21 <210>5 5
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer GAPDH-R
<400> 5 cgccacagtt tcccggag 18 <210> 6
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA sequence of G-Probe
<400> 6 actcatgacc acagtccatg ccat 24 <210> 7
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Non-optimal HRH1 primer HRH1-F
<400> 7 cagggactat gtagccgtca 20 <2105 8
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Non-optimal HRH1 primer HRH1-R
<400> 8 agagaaggat tggctatcac c 21 <210> 9
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA sequence of non-optimal HRH1 probe H1-Probe
<400> 9 ctgatatctc gctggcccca tg 22
Claims (10)
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110891576.1A CN113604557A (en) | 2021-08-04 | 2021-08-04 | Human histamine receptor HRH1mRNA detection primer probe set, kit and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| NL2030978B1 true NL2030978B1 (en) | 2023-02-21 |
Family
ID=78339495
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| NL2030978A NL2030978B1 (en) | 2021-08-04 | 2022-02-16 | Primer probe set for human histamine receptor hrh1 mrna detection, kit and use |
Country Status (4)
| Country | Link |
|---|---|
| CN (1) | CN113604557A (en) |
| AU (1) | AU2021106574A4 (en) |
| NL (1) | NL2030978B1 (en) |
| ZA (1) | ZA202200485B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011074881A2 (en) * | 2009-12-15 | 2011-06-23 | 국립대학법인 토쿠시마대학 | Substances for inhibiting expression of genes for sensitivity to allergic disorders |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB2283239A (en) * | 1993-10-29 | 1995-05-03 | Ucb Sa | Human H1 histamine receptor |
| WO2002032928A2 (en) * | 2000-10-20 | 2002-04-25 | Genaissance Pharmaceuticals, Inc. | Haplotypes of the hrh1 gene |
| EP2674493B1 (en) * | 2006-04-13 | 2017-12-27 | Arrowhead Research Corporation | RNAi-mediated inhibition of histamine receptor H1-related conditions |
| CN106544392A (en) * | 2015-09-23 | 2017-03-29 | 中国科学院大连化学物理研究所 | A kind of screening technique of histamine H 1 receptor antagonist |
| CN110592290B (en) * | 2019-10-31 | 2022-10-04 | 上海市动物疫病预防控制中心 | Kit and method for detecting feline calicivirus |
| WO2023010330A1 (en) * | 2021-08-04 | 2023-02-09 | 杭州浙大迪迅生物基因工程有限公司 | Primer-probe set, kit and detection method for detecting human histamine receptor hrh1 mrna |
-
2021
- 2021-08-04 CN CN202110891576.1A patent/CN113604557A/en active Pending
- 2021-08-23 AU AU2021106574A patent/AU2021106574A4/en active Active
-
2022
- 2022-01-11 ZA ZA2022/00485A patent/ZA202200485B/en unknown
- 2022-02-16 NL NL2030978A patent/NL2030978B1/en active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011074881A2 (en) * | 2009-12-15 | 2011-06-23 | 국립대학법인 토쿠시마대학 | Substances for inhibiting expression of genes for sensitivity to allergic disorders |
Non-Patent Citations (3)
| Title |
|---|
| HATTORI MASASHI ET AL: "Quercetin inhibits transcriptional up-regulation of histamine H1receptor via suppressing protein kinase C-[delta]/extracellular signal-regulated kinase/poly(ADP-ribose) polymerase-1 signaling pathway in HeLa c", INTERNATIONAL IMMUNOPHARMACOLOGY, ELSEVIER, AMSTERDAM, NL, vol. 15, no. 2, 16 January 2013 (2013-01-16), pages 232 - 239, XP028989509, ISSN: 1567-5769, DOI: 10.1016/J.INTIMP.2012.12.030 * |
| LIPI SARKAR ET AL: "A report on anti-oedemogenic activity ofroots Possible involvement of histamine receptor (type I)", JOURNAL OF ETHNOPHARMACOLOGY, ELSEVIER IRELAND LTD, IE, vol. 140, no. 2, 10 January 2012 (2012-01-10), pages 443 - 446, XP028465864, ISSN: 0378-8741, [retrieved on 20120118], DOI: 10.1016/J.JEP.2012.01.013 * |
| SHUHEI HORIO ET AL: "Interleukin-4 up-regulates histamine H1 receptors by activation of H1 receptor gene transcription", NAUNYN-SCHMIEDEBERG'S ARCHIVES OF PHARMACOLOGY, SPRINGER, BERLIN, DE, vol. 381, no. 4, 30 January 2010 (2010-01-30), pages 305 - 313, XP019798480, ISSN: 1432-1912 * |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2021106574A4 (en) | 2021-11-11 |
| ZA202200485B (en) | 2022-03-30 |
| CN113604557A (en) | 2021-11-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106434982B (en) | The relevant molecular marked compound of cerebral arterial thrombosis and its application | |
| CN105886648A (en) | Kit used for detecting T790M mutation of EGFR gene | |
| WO2023010326A1 (en) | PRIMER-PROBE SET AND KIT FOR HUMAN β-TRYPTASE MRNA RT-PCR DETECTION | |
| CN110373485A (en) | A kind of ureaplasma urealyticum, three joint inspection kit of chlamydia trachomatis and gonococcus | |
| EP2808387B1 (en) | Oligonucleotide for hiv detection, hiv detection kit, and hiv detection method | |
| US20240158856A1 (en) | Primer probe set for human histamine receptor hrh1 mrna detection, kit and detection method | |
| NL2030977B1 (en) | Reagent for detecting expression level of human histamine receptor hrh4 mrna, kit and use | |
| NL2030975B1 (en) | Primer probe set and kit for rt-pcr detection of human leukotriene receptor cysltr2 mrna | |
| NL2030978B1 (en) | Primer probe set for human histamine receptor hrh1 mrna detection, kit and use | |
| US20240150832A1 (en) | Reagent for detecting expression level of human histamine receptor hrh4 mrna, kit and detection method | |
| NL2030973B1 (en) | Primer set for detection of expression of human eosinophil cationic protein (ecp) mrna and kit | |
| WO2023010328A1 (en) | Primer-probe set and kit for human leukotriene receptor cysltr1 mrna rt-pcr detection | |
| CN107557472A (en) | Diagnosis of glioma mark circ9:135881633 | 135883078 and application | |
| CN111378787A (en) | Novel coronavirus detection method | |
| NL2030976B1 (en) | Primer probe set and kit for rt-pcr detection of human leukotriene receptor cysltr1 mrna | |
| CN101760518A (en) | Method for extracting live bacteria RNA in Mycobacterium tuberculosis and detection kit thereof | |
| RU2744198C1 (en) | Set for detecting sars-cov virus by real-time rt-pcr method | |
| WO2023010325A1 (en) | Primer set for detecting expression of human eosinophil cationic protein mrna, kit, and detection method | |
| WO2023010327A1 (en) | Primer probe set and test kit for rt-pcr detection of human leukotriene receptor cysltr2 mrna | |
| CN107029238B (en) | Applications of the LINC01094 in diagnosis and treatment cerebral arterial thrombosis | |
| NL2030974B1 (en) | Primer probe set and kit for rt-pcr detection of human tryptase beta (tpsb) mrna | |
| CN107227343A (en) | It is a kind of to detect the kit and its primer pair and probe for including incubation period tuberculosis infection | |
| CN114350779A (en) | Primer for detecting interferon gamma induced protein 10mRNA and application thereof | |
| CN115725702A (en) | Fluorescent RT-PCR (reverse transcription-polymerase chain reaction) primer and probe for human endogenous RNA (ribonucleic acid) internal standard, kit and using method | |
| CN107988368A (en) | Diagnosis of glioma marker circ9:33948374 | 33948587 and application |