CN114350779A - Primer for detecting interferon gamma induced protein 10mRNA and application thereof - Google Patents
Primer for detecting interferon gamma induced protein 10mRNA and application thereof Download PDFInfo
- Publication number
- CN114350779A CN114350779A CN202111547448.1A CN202111547448A CN114350779A CN 114350779 A CN114350779 A CN 114350779A CN 202111547448 A CN202111547448 A CN 202111547448A CN 114350779 A CN114350779 A CN 114350779A
- Authority
- CN
- China
- Prior art keywords
- primer
- interferon gamma
- tuberculosis
- induced protein
- value
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16H—HEALTHCARE INFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR THE HANDLING OR PROCESSING OF MEDICAL OR HEALTHCARE DATA
- G16H50/00—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics
- G16H50/30—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for calculating health indices; for individual health risk assessment
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Pathology (AREA)
- Medical Informatics (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Data Mining & Analysis (AREA)
- Biomedical Technology (AREA)
- Databases & Information Systems (AREA)
- Primary Health Care (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application relates to the technical field of biology, in particular to a primer for detecting interferon gamma-induced protein 10mRNA and application thereof, wherein the primer for detecting the interferon gamma-induced protein 10mRNA comprises an upstream primer and a downstream primer; the sequence of the upstream primer is shown as SEQ ID No.1, the sequence of the downstream primer is shown as SEQ ID No.2, the provided upstream primer and downstream primer are adopted to detect the interferon gamma induced protein 10 on the mRNA level, the diagnosis time is short, and the kit is suitable for screening large-scale tuberculosis; moreover, the interferon gamma-induced protein 10(IP-10) is used as a detection object, so that the diagnosis kit has stronger diagnosis performance on patients and children with low immunity, can distinguish active tuberculosis, latent tuberculosis infection and healthy people, does not cause false positive, and is more favorable for comprehensively and accurately diagnosing the tuberculosis condition.
Description
Technical Field
The application belongs to the technical field of biology, and particularly relates to a primer for detecting interferon gamma induced protein 10mRNA and application thereof.
Background
Tuberculosis is a highly contagious chronic disease that, despite rapid improvement, remains a major health and economic burden worldwide. The World Health Organization (WHO) estimates that there are about 1040 new cases and 180 million people dying from tuberculosis each year. It is estimated that 20 million people exhibit an immune response to tuberculosis without active infection. Latent tuberculosis infection (LTBI) is defined as the presence of an adaptive immune response against tuberculosis antigens without disease activity and an increased risk of progressing to active tuberculosis. About 10% of LTBI is likely to convert to active tuberculosis, the progression of which is affected by a number of factors, including age, strain virulence, dose, host immune status, and complications.
The extremely wide clinical manifestations and the lack of effective detection methods of tuberculosis bring serious regret to the prevention and control of tuberculosis. In clinical practice, it is very difficult to correctly diagnose tuberculosis, and cough and nonspecific chest radiography are one of the conventional methods for diagnosing tuberculosis. Acid-fast staining, tuberculosis culture, immunological detection and nucleic acid amplification have limited effect in diagnosing tuberculosis. The immunological detection is guided by Tuberculin Skin Test (TST) and interferon gamma (IFN-gamma) release assay (IGRA). TST is an in vivo diagnostic test that measures delayed hypersensitivity reactions in the skin 48-72 hours after intradermal injection of mycobacterial-specific antigens, and the main limitation of TST is the cross-reactivity to mycobacterium bovis bacillus calmette-guerin and environmental mycobacteria, which makes the test in many cases unspecific. IGRAs are diagnostic in vitro substitutes for TSTs. The interferon-gamma release assay (IGRA) is currently the commonly used method for diagnosing tuberculosis, and the principle is to measure the concentration of interferon-gamma (IFN- γ) protein after T cell stimulation using tuberculosis specific antigens (ESAT-6 and CFP 10). The domestic commercial use mainly adopts T-spot test, and false positive results can not be generated after BCG vaccine inoculation or exposure to most environmental mycobacteria. While IGRAs are highly specific, they have a relatively high false negative rate in active tuberculosis patients. In terms of diagnostic performance, IGRA and TST are less sensitive to diagnosis in young children and immunosuppressed people, e.g. due to hiv infection, corticosteroid therapy and other immunosuppressive drugs. And neither IGRA nor TST can distinguish between activity and LTBI. Therefore, in view of these limitations of tuberculosis diagnosis, it is essential to develop new, reliable methods for tuberculosis detection.
Interferon gamma-induced protein 10(IP-10) is a 7.2 kilodalton chemokine, and its expression level is 100 times higher than IFN-gamma after tuberculosis infection. Previous studies have shown that IP-10 expression levels are higher than IFN- γ in IGRA assays. Age, sex and tuberculosis manifestation of the individual did not affect the IP-10 level. Thus, IP-10 improves diagnostic performance by enhancing detection of infection in children, HIV-infected persons, and persons with rheumatism who receive immunosuppressive therapy. In recent years, many studies have reported that IP-10 has been identified as an extremely high sensitive parameter for detecting tuberculosis. Detection of tuberculosis specific IP-10mRNA by real-time quantitative PCR (RT-qPCR) as an IGRA index is faster and more sensitive than standard IGRA enzyme-linked immunosorbent assay. In addition, RT-qPCR allows automation, diversification, and may provide higher detection sensitivity, which also provides feasibility for detection of IP-10 mRNA.
Disclosure of Invention
The application aims to provide a primer for detecting interferon gamma-induced protein 10mRNA and application thereof, and aims to solve the problems that in the prior art, the detection time for detecting the interferon gamma-induced protein 10 on a protein molecular layer is long, the false positive is high, and the differentiation of active tuberculosis and latent tuberculosis is not facilitated.
In order to achieve the purpose of the application, the technical scheme adopted by the application is as follows:
in a first aspect, the present application provides a primer for detecting interferon gamma-induced protein 10mRNA, wherein the primer for detecting interferon gamma-induced protein 10mRNA comprises an upstream primer and a downstream primer; wherein, the sequence of the upstream primer is shown as SEQ ID No.1, and the sequence of the downstream primer is shown as SEQ ID No. 2.
In a second aspect, the application provides an application of an mRNA detection primer in preparation of a product for early diagnosis of tuberculosis, wherein the mRNA detection primer is an mRNA detection primer for interferon gamma-induced protein 10.
In a third aspect, the present application provides a kit for predicting pulmonary tuberculosis morbidity, the kit comprising primers for detecting interferon gamma-induced protein 10 mRNA.
In a fourth aspect, the present application provides a system for predicting pulmonary tuberculosis morbidity, the system comprising:
a data acquisition unit: the primer for detecting the interferon gamma-induced protein 10mRNA of claim 1 is used for carrying out one-step fluorescence quantitative PCR reaction on a sample to obtain the Ct value of the interferon gamma-induced protein 10 of the sample;
a data analysis unit: the method is used for calculating the Ct value and the blank control value to obtain the risk probability value of the sample;
a data prediction unit: the method is used for analyzing the risk probability value to predict the pulmonary tuberculosis diseased condition.
According to the primers for detecting the mRNA of the interferon gamma-induced protein 10, provided upstream primers and downstream primers are adopted to detect the mRNA of the interferon gamma-induced protein 10, the mRNA is detected by detecting the mRNA of the interferon gamma-induced protein 10, a specific antibody does not need to be screened and prepared in the detection and analysis process, PCR detection can be directly carried out, the diagnosis time is only less than 4 hours, the used sample amount is small, the diagnosis speed is greatly improved, the diagnosis time is greatly shortened, and the primers are suitable for screening large-scale tuberculosis; moreover, the interferon gamma-induced protein 10(IP-10) is used as a detection object, so that the kit has stronger diagnosis performance on patients and children with low immunity, can distinguish active tuberculosis, latent tuberculosis infection and healthy people, does not cause false positive, and is more favorable for comprehensively and accurately diagnosing the tuberculosis condition.
The mRNA detection primer provided by the second aspect of the application is applied to preparing a product for early diagnosis of pulmonary tuberculosis, the mRNA detection primer for interferon gamma-induced protein 10 is used for preparing a diagnosis product, an antibody does not need to be prepared in the detection and analysis process, PCR detection is directly carried out, the diagnosis time is short, the speed is high, the method is suitable for screening and analyzing large-scale tuberculosis, false positive cannot be caused, and the application is wider.
According to the kit for predicting pulmonary tuberculosis morbidity provided by the third aspect of the application, the kit comprises a primer for detecting interferon gamma induced protein 10mRNA, a sample can be directly subjected to PCR detection according to the detection primer, the pulmonary tuberculosis morbidity condition on an mRNA layer can be analyzed, the amount of the used sample is small, the detection time is short, and the speed is high; the kit has stronger diagnostic performance on patients with low immunity and children, can distinguish active tuberculosis, latent tuberculosis infection and healthy people, and has wider application.
The system comprises a data acquisition unit, a data analysis unit and a data prediction unit, wherein the system utilizes a primer for detecting interferon gamma induced protein 10mRNA to perform one-step fluorescence quantitative PCR reaction on a sample to obtain a Ct value of the sample, and then performs data analysis to predict the pulmonary tuberculosis illness condition; the system has reliable analysis result and higher accuracy, can have stronger diagnosis performance for patients and children with low immunity, and can distinguish active tuberculosis, latent tuberculosis infection and healthy people.
Drawings
In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed to be used in the embodiments or the prior art descriptions will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present application, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.
FIG. 1 is a graph showing the analysis of the change in the amount of IP-10mRNA provided in example 2 of the present application.
FIG. 2 is a graph showing the analysis of the change in the amount of IP-10mRNA provided in example 3 of the present application.
Detailed Description
In order to make the technical problems, technical solutions and advantageous effects to be solved by the present application more clearly apparent, the present application is further described in detail below with reference to the embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present application and are not intended to limit the present application.
In this application, the term "and/or" describes an association relationship of associated objects, meaning that there may be three relationships, e.g., a and/or B, which may mean: a is present alone, A and B are present simultaneously, and B is present alone. Wherein A and B can be singular or plural. The character "/" generally indicates that the former and latter associated objects are in an "or" relationship.
In the present application, "at least one" means one or more, "a plurality" means two or more. "at least one of the following" or similar expressions refer to any combination of these items, including any combination of the singular or plural items. For example, "at least one (a), b, or c", or "at least one (a), b, and c", may each represent: a, b, c, a-b (i.e., a and b), a-c, b-c, or a-b-c, wherein a, b, and c may be single or plural, respectively.
It should be understood that, in various embodiments of the present application, the sequence numbers of the above-mentioned processes do not mean the execution sequence, some or all of the steps may be executed in parallel or executed sequentially, and the execution sequence of each process should be determined by its function and inherent logic, and should not constitute any limitation to the implementation process of the embodiments of the present application.
The terminology used in the embodiments of the present application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. As used in the examples of this application and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.
The weight of the related components mentioned in the description of the embodiments of the present application may not only refer to the specific content of each component, but also represent the proportional relationship of the weight among the components, and therefore, the content of the related components is scaled up or down within the scope disclosed in the description of the embodiments of the present application as long as it is scaled up or down according to the description of the embodiments of the present application. Specifically, the mass in the description of the embodiments of the present application may be in units of mass known in the chemical industry, such as μ g, mg, g, and kg.
The terms "first" and "second" are used for descriptive purposes only and are used for distinguishing purposes such as substances from one another, and are not to be construed as indicating or implying relative importance or implying any number of technical features indicated. For example, a first XX may also be referred to as a second XX, and similarly, a second XX may also be referred to as a first XX, without departing from the scope of embodiments of the present application. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature.
The first aspect of the embodiments of the present application provides a primer for detecting interferon gamma-induced protein 10mRNA, wherein the primer for detecting interferon gamma-induced protein 10mRNA comprises an upstream primer and a downstream primer; wherein, the sequence of the upstream primer is shown as SEQ ID No.1, and the sequence of the downstream primer is shown as SEQ ID No. 2.
The primers for detecting the mRNA of the interferon gamma-induced protein 10, provided by the first aspect of the embodiment of the application, adopt the provided upstream primers and downstream primers to detect the mRNA of the interferon gamma-induced protein 10, and through detecting the mRNA of the interferon gamma-induced protein 10, in the detection and analysis process, the PCR detection can be directly carried out without screening and preparing specific antibodies, the diagnosis time is only required to be less than 4 hours, and the used sample amount is less, so that the diagnosis speed is greatly improved, the diagnosis time is shortened, and the primers are suitable for screening of large-scale tuberculosis; moreover, the interferon gamma-induced protein 10(IP-10) is used as a detection object, so that the diagnosis kit has stronger diagnosis performance on patients and children with low immunity, can distinguish active tuberculosis, latent tuberculosis infection and healthy people, does not cause false positive, and is more favorable for comprehensively and accurately diagnosing the tuberculosis condition.
In some embodiments, the primers for detecting interferon gamma inducible protein 10mRNA include an upstream primer and a downstream primer, and the provided primers for detecting interferon gamma inducible protein 10mRNA are designed by using a constant region of interferon gamma inducible protein 10(IP-10) mRNA, in which a mutation site is not found, so that the primers are ensured to have high specificity and are favorable for rapid combination; the length of the obtained product is about 100bp, the amplification time is controlled within 1 hour, the diagnosis time is controlled to be shorter, and the diagnosis speed is improved; further, the 3' end of the designed primer is selected from any one of T, C, G bases, so that the strongest binding force is ensured, and the specificity of the primer is improved.
In some embodiments, the sequence of the forward primer is shown as SEQ ID No.1, SEQ ID No.1 is: GGTGAGAAGAGATGTCTGAATCC are provided.
In some embodiments, the sequence of the downstream primer is shown in SEQ ID No.2, SEQ ID No.2 is: GTCCATCCTTGGAAGCACTGCA are provided.
The application of the mRNA detection primer provided by the second aspect of the embodiment of the application in preparing a product for early diagnosis of tuberculosis is disclosed, and the mRNA detection primer is used for detecting interferon gamma induced protein 10 mRNA.
The mRNA detection primer provided by the second aspect of the embodiment of the application is applied to preparing a product for early diagnosis of pulmonary tuberculosis, the mRNA detection primer for interferon gamma-induced protein 10 is used for preparing a diagnosis product, an antibody does not need to be prepared in the detection and analysis process, PCR detection is directly carried out, the diagnosis time is short, the speed is high, the method is suitable for screening and analysis of large-scale tuberculosis, false positive cannot be caused, and the application is wider.
In some embodiments, the product comprises at least one of a kit, a chip, a system. The provided primer for detecting the interferon gamma-induced protein 10mRNA has stronger specificity and higher sensitivity, can improve the detection rate when being applied to the preparation of a kit, a chip or a system, has stronger diagnostic performance on patients with low immunity and children, and can distinguish active tuberculosis, latent tuberculosis infection and healthy people.
The third aspect of the embodiments of the present application provides a kit for predicting pulmonary tuberculosis diseases, which comprises primers for detecting interferon gamma-induced protein 10 mRNA.
According to the kit for predicting pulmonary tuberculosis diseases provided by the third aspect of the embodiment of the application, the kit comprises a primer for detecting interferon gamma induced protein 10mRNA, a sample can be directly subjected to PCR detection according to the detection primer, the pulmonary tuberculosis disease conditions can be analyzed on an mRNA layer, the amount of the used sample is small, the detection time is short, and the speed is high; the kit has stronger diagnostic performance on patients with low immunity and children, can distinguish active tuberculosis, latent tuberculosis infection and healthy people, and has wider application.
In some embodiments, the kit is provided, wherein the final concentration of the primer for detecting the interferon gamma-induced protein 10mRNA is 0.2-0.25 mu mol/L.
In some embodiments, to perform the one-step fluorescent quantitative PCR reaction, the kit further comprises 2 x SYBR one-step fluorescent quantitative PCR buffer, a super mix enzyme, sterile water containing no rnase, and an internal reference control.
In some embodiments, the 2 XSSYBR one-step fluorescent quantitative PCR buffer is added in an amount of 12.5-13. mu.L.
In some embodiments, the super mix enzyme is added in an amount of 0.5 to 0.6. mu.L.
In some embodiments, the internal control is selected from 18 sRNA.
In some embodiments, the kit for predicting pulmonary tuberculosis morbidity is used for predicting pulmonary tuberculosis morbidity, and a one-step fluorescence quantitative PCR experiment is performed by using primers for detecting interferon gamma induced protein 10mRNA and other reagents provided in the kit, wherein a reaction system of the one-step fluorescence quantitative PCR experiment is shown in table 1:
TABLE 1
In some embodiments, the reaction conditions for the one-step fluorescent quantitative PCR experiment are reverse transcription at 45 ℃ for 10 min; PCR pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 15s, annealing/extension at 60 ℃ for 45 s; 35 cycles.
A fourth aspect of the embodiments of the present application provides a system for predicting pulmonary tuberculosis diseases, the system including:
a data acquisition unit: the method is used for carrying out one-step fluorescence quantitative PCR reaction on a sample by adopting an mRNA detection primer for the interferon gamma-induced protein 10 to obtain a Ct value of the interferon gamma-induced protein 10 of the sample;
a data analysis unit: the method is used for calculating the Ct value and the blank control value to obtain the risk probability value of the sample;
a data prediction unit: the method is used for analyzing the risk probability value to predict the pulmonary tuberculosis diseased condition.
The fourth aspect of the embodiment of the application provides a system for predicting pulmonary tuberculosis morbidity, which comprises a data acquisition unit, a data analysis unit and a data prediction unit, wherein the system performs one-step fluorescence quantitative PCR reaction on a sample by using an mRNA detection primer for interferon gamma-induced protein 10 to obtain a Ct value of the sample, and then performs data analysis to predict pulmonary tuberculosis morbidity; the system has reliable analysis result and higher accuracy, can have stronger diagnosis performance for patients and children with low immunity, and can distinguish active tuberculosis, latent tuberculosis infection and healthy people.
Specifically, the system for predicting pulmonary tuberculosis diseases comprises a data acquisition unit, wherein the data acquisition unit is used for carrying out one-step fluorescence quantitative PCR reaction on a sample by adopting an mRNA detection primer for interferon gamma-induced protein 10 to obtain a Ct value of the interferon gamma-induced protein 10 of the sample.
In some embodiments, the step of obtaining a Ct value for interferon gamma induced protein 10 of the sample comprises:
s01, collecting a sample, and preprocessing the sample to obtain RNA;
s02, performing one-step fluorescence quantitative PCR experiment on the RNA to obtain a Ct value obtained by sample reaction.
In step S01, the sample includes at least one of a tissue sample, a body fluid sample, and an extracellular fluid sample. In some embodiments, the sample includes, but is not limited to, plasma, whole blood, serum, interstitial fluid, peritoneal fluid, saliva, urine, semen, tears.
In some embodiments, the step of pretreating the sample to obtain RNA comprises:
s011, incubating a sample at 37 ℃ for 2 hours, adding 200 mu L of blood into 600 mu L of erythrocyte lysate, turning upside down, standing on ice for 15 minutes, and centrifuging to obtain a precipitate;
s012, extracting RNA in cells by adopting a one-step nucleic acid extraction method to obtain RNA.
In step S02, the RNA is subjected to a one-step fluorescence quantitative PCR experiment to obtain a Ct value obtained by the sample reaction.
In some embodiments, the reaction system for the one-step fluorescent quantitative PCR experiment is shown in table 1:
TABLE 1
In some embodiments, the reaction conditions for the one-step fluorescent quantitative PCR experiment are reverse transcription at 45 ℃ for 10 min; PCR pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 15s, annealing/extension at 60 ℃ for 45 s; 35 cycles.
Specifically, the system for predicting pulmonary tuberculosis diseases comprises a data analysis unit, wherein the data analysis unit is used for calculating the Ct value and the blank control value to obtain the risk probability value of the sample.
Specifically, the system for predicting the pulmonary tuberculosis illness comprises a data prediction unit, and the data prediction unit is used for analyzing the risk probability value so as to predict the pulmonary tuberculosis illness condition.
In some embodiments, the data prediction unit further comprises a threshold value for the prevalence of tuberculosis, and when the risk probability value is higher than the threshold value, the provided risk probability value can be used to diagnose active tuberculosis and latent tuberculosis infection; when the risk probability value is below a threshold, no diagnostic value is indicated.
In some embodiments, the threshold is selected from 2, where a sample Ct value/blank tube <2 indicates no diagnostic value; when the sample Ct value/blank tube >2, fold change in TB-Ag/blank tube can be used to diagnose active tuberculosis and latent tuberculosis infection.
The following description will be given with reference to specific examples.
Example 1
An application of mRNA detection primers in preparing products for early diagnosis of pulmonary tuberculosis, wherein the products are selected from kits for predicting pulmonary tuberculosis diseases.
The kit for predicting pulmonary tuberculosis diseases comprises an interferon gamma-induced protein 10mRNA detection primer, a 2 x SYBR one-step method fluorescent quantitative PCR buffer solution, super mixed enzyme, sterile water without RNase and an internal reference control.
The kit for predicting pulmonary tuberculosis diseases is adopted to predict pulmonary tuberculosis diseases, and one-step fluorescence quantitative PCR experiments are carried out by using the primers for detecting interferon gamma induced protein 10mRNA and other reagents provided in the kit, wherein the reaction system of the one-step fluorescence quantitative PCR experiments is shown in Table 1:
TABLE 1
The reaction conditions of the one-step fluorescent quantitative PCR experiment are reverse transcription at 45 ℃ for 10 min; PCR pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 15s, annealing/extension at 60 ℃ for 45 s; 35 cycles.
Example 2
The application of mRNA detection primer in preparing early pulmonary tuberculosis diagnosing product is selected from system for predicting pulmonary tuberculosis diseases.
The system comprises:
(1) a data acquisition unit: the method is used for carrying out one-step fluorescence quantitative PCR reaction on a sample by adopting an mRNA detection primer for the interferon gamma-induced protein 10 to obtain a Ct value of the interferon gamma-induced protein 10 of the sample;
specifically, the method comprises the following steps: firstly, collecting active tuberculosis and 30 cases of healthy control, taking 2ml of peripheral blood, incubating at 37 ℃ for 0, 2, 4, 6, 8 and 10 hours, taking 200 mu l of the peripheral blood, applying a one-step method fluorescent quantitative RT-PCR kit and a Prism 7500 real-time fluorescent quantitative PCR instrument (ABI company of America) for detection;
analyzing RNA by adopting a one-step fluorescent quantitative PCR experiment to obtain a Ct value of interferon gamma induced protein 10 of the sample; the reaction system is shown in Table 1 of example 1, and the reaction conditions of the one-step fluorescent quantitative PCR experiment are reverse transcription at 45 ℃ for 10 min; PCR pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 15s, annealing/extension at 60 ℃ for 45 s; 35 cycles.
(2) A data analysis unit: the method is used for calculating the Ct value and the blank control value to obtain the risk probability value of the sample;
(3) a data prediction unit: the method is used for analyzing the risk probability value to predict the pulmonary tuberculosis diseased condition.
Example 3
The application of mRNA detection primer in preparing early pulmonary tuberculosis diagnosing product is selected from system for predicting pulmonary tuberculosis diseases.
The system comprises:
(1) a data acquisition unit: the method is used for carrying out one-step fluorescence quantitative PCR reaction on a sample by adopting an mRNA detection primer for the interferon gamma-induced protein 10 to obtain a Ct value of the interferon gamma-induced protein 10 of the sample;
specifically, the method comprises the following steps: firstly, collecting active tuberculosis of children (12 years old) and 30 cases of healthy control, taking 2ml of peripheral blood, incubating for 2 hours at 37 ℃, taking 200 mu l of the peripheral blood, and applying a one-step method fluorescent quantitative RT-PCR kit and a Prism 7500 real-time fluorescent quantitative PCR instrument (ABI company in America) to detect;
analyzing RNA by adopting a one-step fluorescent quantitative PCR experiment to obtain a Ct value of interferon gamma induced protein 10 of the sample; the reaction system is shown in Table 1 of example 1, and the reaction conditions of the one-step fluorescent quantitative PCR experiment are reverse transcription at 45 ℃ for 10 min; PCR pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 15s, annealing/extension at 60 ℃ for 45 s; 35 cycles.
(2) A data analysis unit: the method is used for calculating the Ct value and the blank control value to obtain the risk probability value of the sample;
(3) a data prediction unit: the method is used for analyzing the risk probability value to predict the pulmonary tuberculosis diseased condition.
Example 4
The application of mRNA detection primer in preparing early pulmonary tuberculosis diagnosing product is selected from system for predicting pulmonary tuberculosis diseases.
The system comprises:
(1) a data acquisition unit: the method is used for carrying out one-step fluorescence quantitative PCR reaction on a sample by adopting an mRNA detection primer for the interferon gamma-induced protein 10 to obtain a Ct value of the interferon gamma-induced protein 10 of the sample;
specifically, the method comprises the following steps: selecting 30 active tuberculosis cases, primarily treating the tuberculosis for 3-6 months and controlling the health of each 30 cases, taking 2ml of peripheral blood, incubating for 2 hours at 37 ℃, adopting tuberculosis antigen peptide for stimulation for 2 hours, taking 200 mu l of the active tuberculosis cases, and applying a one-step method fluorescent quantitative RT-PCR kit and a Prism 7500 real-time fluorescent quantitative PCR instrument (ABI company in America) for detection;
analyzing RNA by adopting a one-step fluorescent quantitative PCR experiment to obtain a Ct value of interferon gamma induced protein 10 of the sample; the reaction system is shown in Table 1 of example 1, and the reaction conditions of the one-step fluorescent quantitative PCR experiment are reverse transcription at 45 ℃ for 10 min; PCR pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 15s, annealing/extension at 60 ℃ for 45 s; 35 cycles.
(2) A data analysis unit: the method is used for calculating the Ct value and the blank control value to obtain the risk probability value of the sample;
(3) a data prediction unit: the method is used for analyzing the risk probability value to predict the pulmonary tuberculosis diseased condition.
Property testing and results analysis
(first) analysis of the results obtained in example 2
The result obtained by analyzing the incubation time of the sample is shown in fig. 1, and it can be seen that the expression of mRNA after the stimulation of the tuberculosis antigen peptide is a relatively rapid event, highly dependent on the individual and the stimulus, generally increases at 2h after the stimulation, reaches the peak at 6h, and maintains at about 10 hours. The selection of the optimal time point is very important in the assay, with a time-dependent increase between 2 and 6 hours based on mRNA diagnostic tests.
(II) analysis of the results obtained in example 3
The results obtained in example 3 are shown in fig. 2, and it can be seen that, for a sample of a child, the primers for detecting interferon gamma-induced protein 10mRNA provided by the present application are used for detection, so that active tuberculosis and healthy people in a child population can be clearly distinguished, and the method is favorable for realizing stronger diagnostic performance for the child.
(III) analysis of the results obtained in example 4
The results obtained in example 4 are shown in table 2, and it can be seen from table 2 that the primers for detecting interferon gamma-induced protein 10mRNA provided by the present application can effectively distinguish active tuberculosis from latent tuberculosis infection.
TABLE 2
The above description is only exemplary of the present application and should not be taken as limiting the present application, as any modification, equivalent replacement, or improvement made within the spirit and principle of the present application should be included in the protection scope of the present application.
SEQUENCE LISTING
<110> Shenzhen friend fortune gathering technology enterprise (limited partnership)
<120> primer for detecting interferon gamma-induced protein 10mRNA and application thereof
<130> 2021-12-16
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 23
<212> DNA
<213> Artificial Synthesis
<400> 1
ggtgagaaga gatgtctgaa tcc 23
<210> 2
<211> 22
<212> DNA
<213> Artificial Synthesis
<400> 2
gtccatcctt ggaagcactg ca 22
Claims (10)
1. The primer for detecting the mRNA of the interferon gamma-induced protein 10 is characterized by comprising an upstream primer and a downstream primer; wherein, the sequence of the upstream primer is shown as SEQ ID No.1, and the sequence of the downstream primer is shown as SEQ ID No. 2.
2. The application of an mRNA detection primer in preparing a product for early diagnosis of tuberculosis is characterized in that the mRNA detection primer is the mRNA detection primer for interferon gamma-induced protein 10 according to claim 1.
3. A kit for predicting pulmonary tuberculosis morbidity, comprising the primer for detecting interferon gamma-induced protein 10mRNA according to claim 1.
4. The kit according to claim 3, wherein the final concentration of the primer for detecting the interferon gamma-induced protein 10mRNA is 0.2-0.25 μmol/L.
5. The kit of claim 3, further comprising 2 x SYBR one-step fluorescent quantitation PCR buffer, a super mix enzyme, sterile water containing no RNase, and an internal reference control.
6. The kit according to claim 5, wherein the 2 XSSYBR one-step fluorescent quantitative PCR buffer is added in an amount of 12.5-13. mu.L.
7. The kit according to claim 5, wherein the super mix enzyme is added in an amount of 0.5 to 0.6. mu.L.
8. The kit of claim 5, wherein the internal control is selected from 18 sRNA.
9. A system for predicting pulmonary tuberculosis morbidity, the system comprising:
a data acquisition unit: the primer for detecting the interferon gamma-induced protein 10mRNA of claim 1 is used for carrying out one-step fluorescence quantitative PCR reaction on a sample to obtain the Ct value of the interferon gamma-induced protein 10 of the sample;
a data analysis unit: the Ct value and the blank control value are calculated to obtain the risk probability value of the sample;
a data prediction unit: and analyzing the risk probability value to predict pulmonary tuberculosis diseased condition.
10. The system of claim 9, wherein the data prediction unit further comprises a threshold value for tuberculosis morbidity, the risk probability value provided being useful for diagnosing active tuberculosis and latent tuberculosis infection when the risk probability value is above the threshold value; when the risk probability value is below the threshold, no diagnostic value is indicated.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111547448.1A CN114350779A (en) | 2021-12-16 | 2021-12-16 | Primer for detecting interferon gamma induced protein 10mRNA and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111547448.1A CN114350779A (en) | 2021-12-16 | 2021-12-16 | Primer for detecting interferon gamma induced protein 10mRNA and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114350779A true CN114350779A (en) | 2022-04-15 |
Family
ID=81100319
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111547448.1A Pending CN114350779A (en) | 2021-12-16 | 2021-12-16 | Primer for detecting interferon gamma induced protein 10mRNA and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114350779A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110846401A (en) * | 2019-11-07 | 2020-02-28 | 复旦大学附属儿科医院 | Application of LINC01503 as treatment target in preparation of medicine for treating childhood asthma |
-
2021
- 2021-12-16 CN CN202111547448.1A patent/CN114350779A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110846401A (en) * | 2019-11-07 | 2020-02-28 | 复旦大学附属儿科医院 | Application of LINC01503 as treatment target in preparation of medicine for treating childhood asthma |
Non-Patent Citations (2)
| Title |
|---|
| 杨永林等: "γ干扰素诱导蛋白10对活动性结核和潜伏性结核感染的鉴别诊断价值的系统评价和meta分析", 《国际检验医学杂志》 * |
| 汪伟立: "血清干扰素诱导蛋白10 与γ 干扰素水平检测诊断活动性肺结核的临床价值", 《医疗装备》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| van der Zee et al. | Laboratory diagnosis of pertussis | |
| CN116171198A (en) | Systems, methods, and compositions for rapid early detection of infected host RNA biomarkers and early identification of human COVID-19 coronavirus infection | |
| Totten et al. | Etiology of genital ulcer disease in Dakar, Senegal, and comparison of PCR and serologic assays for detection of Haemophilus ducreyi | |
| WO2017026606A1 (en) | Biomarker microrna for diagnosing tuberculosis | |
| CN108449999A (en) | The method for infecting disease or the composition and checkout and diagnosis marker of its complication using color amide-tRNA synthesis enzymatic diagnosis | |
| CN109991417B (en) | Immune marker for tuberculosis and application | |
| CN103276099B (en) | Primer and kit for fluorescent quatititive PCR (polymerase chain reaction) detection of helicobacter pylori | |
| Chedore et al. | Rapid molecular diagnosis of tuberculous meningitis using the Gen-Probe amplified Mycobacterium tuberculosis direct test in a large Canadian public health laboratory | |
| CN107653308A (en) | One group is used to distinguishing active tuberculosis patient and is combined with the primer pair of non-tuberculous pneumonia patient and kit | |
| CN102952850A (en) | Real-time fluorescent quantitative PCR method used for detecting Mycobacterium tuberculosis, and primer, probe and kit thereof | |
| Hansen et al. | Gene transcripts as potential diagnostic markers for allergic contact dermatitis | |
| CN106916903A (en) | The real-time fluorescence RT PCR detection methods and kit of mycobacterium tuberculosis 85B mRNA | |
| CN114350779A (en) | Primer for detecting interferon gamma induced protein 10mRNA and application thereof | |
| CN109402229A (en) | The system of real-time quantitative PCR detection Infected with Brucella based on molecular beacon | |
| WO2021261373A1 (en) | Method for screening tuberculosis infection sample, and biomarker and probe set used for same | |
| WO2017173698A1 (en) | Molecular marker and primer pair for diagnosing mycobacterium tuberculosis infection and uses thereof | |
| CN111440859A (en) | Biomarker for human respiratory syncytial virus infection and application | |
| JP2023517053A (en) | CDI-enhanced COVID-19 testing | |
| CN108504736A (en) | Detect application of the system of ORM1 gene expression amounts in diagnosis of tuberculosis | |
| CN117904334B (en) | Primer composition, kit and detection method for detecting mycobacterium tuberculosis complex | |
| CN112646007B (en) | Combined protein for detecting mycobacterium tuberculosis and detection reagent | |
| CN118222703B (en) | Application of biomarker in preparation of active tuberculosis diagnosis product and active tuberculosis diagnosis kit | |
| US20220235399A1 (en) | Use of p44 as marker for diagnosing anaplasmosis | |
| RU2770803C1 (en) | Method for detecting the dna of the bacterium mycobacterium tuberculosis for the diagnosis of tuberculosis | |
| CN112608995B (en) | Specific marker for pulmonary tuberculosis, application and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20220415 |