CN108192890A - A kind of method of improved reverse transcription microRNA - Google Patents
A kind of method of improved reverse transcription microRNA Download PDFInfo
- Publication number
- CN108192890A CN108192890A CN201810035784.XA CN201810035784A CN108192890A CN 108192890 A CN108192890 A CN 108192890A CN 201810035784 A CN201810035784 A CN 201810035784A CN 108192890 A CN108192890 A CN 108192890A
- Authority
- CN
- China
- Prior art keywords
- reverse transcription
- microrna
- mirna
- stem ring
- reverse
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Computational Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to Molecular Detection fields, and in particular, to a kind of method of improved reverse transcription microRNA.Enzyme of the present invention used in using the special reverse transcription miRNA of stem-loop method different from the past, using the enzyme used in common mRNA or total serum IgE reverse transcription, improve reaction step and method, substantially reduce the high cost of stem-loop method and reverse transcription time, detection efficiency is improved, shortens detection cycle, reduce testing cost, realizes quick, efficient, micro reverse transcription microRNA.
Description
Technical field
The invention belongs to Molecular Detection field, specifically, being a kind of method of improved reverse transcription microRNA.
Background technology
MicroRNA (miRNA) is the microRNA of a kind of long 17~22 nucleotide, by with target gene 3' untranslateds
Area combines, in the expression of post-transcriptional level suppressor.Since 1993 find this 2 kinds of miRNA of lin-4 and let-7 for the first time,
21264 kinds of miRNA having had more than in 193 species are registered in miRBase database.Research prediction, has in human body
Probably regulated and controled more than 60% protein coding gene by miRNA, these albumen take part in cell cycle, development, differentiation and newly
The various biologicals processes such as old metabolism, miRNA have important regulating and controlling effect to physiological activity.It is to be understood that miRNA is in gene table
Institute's role carries out quick, accurate and quantitative analysis it is necessary to express it up in regulation and control.Traditional miRNA detection skills
Art has northern hybridization and microarray, but this method is sensitive for the relatively low miRNA of expression quantity
It spends low.Stem ring primer based on the exploitation of qRT-PCR (Quantitative reverse transcription PCR) principle is anti-
Transcription method, poly-A tailings method and Tagman probe qRT-PCR detection methods etc..Wherein Tagman probes qRT-PCR is detected
Method, stem ring primed reverse transcription method using special stem ring primer and reverse transcriptase, compared to tailing method have very strong sensitivity with
Specificity, but main problem existing for both methods is of high cost, the reverse transcription time is long.
Chinese patent 2014100670446 discloses a kind of method of improved stem ring primer qRT-PCR detections miRNA, packet
It includes：(1) design of miRNA detection primers：Stem ring primer include two parts, general stem ring sequence and with target miRNA3 ' hold
The specific primer sequences of complementary pairing, wherein the base number with target miRNA complementary pairings is 11bp；The downstream primer needle of qPCR
To general stem ring sequence, sense primer is for the 5 ' ends of target miRNA；Increase GC tails in 5 ' ends of the sense primer
Bar, so that the annealing temperature of upstream and downstream primer is close；(2) by target miRNA reverse transcriptions into cDNA；(3) quantitative pcr amplification, should
Method specificity is good, sensitivity is high, only need to synthesize a kind of downstream primer, cost is greatly saved.In the prior art, about this hair
The method of bright reverse transcription microRNA, yet there are no report.
Invention content
The purpose of the present invention is being directed to deficiency of the prior art, a kind of side of improved reverse transcription microRNA is provided
Method by using common mRNA reverse transcriptase, improves reaction step and method, can substantially reduce high cost and the reversion of stem-loop method
Record the time.
To achieve the above object, the technical solution adopted by the present invention is that：
A kind of method of improved reverse transcription microRNA, using mRNA reverse transcriptase, according to following reverse transcription system into
Row reverse transcription：
| Reagent | Final concentration |
| 5×PrimerScript Buffer | 1× |
| PrimerScript RT Enzyme Mix I | 0.5ul |
| Stem ring primer (10uM) | 2pmol |
| Total RNA | 100~500ng |
| RNase Free dH2O | It is settled to 10ul |
As the preferred embodiment of the present invention, the reverse transcription condition is：37 DEG C of 15min, 85 DEG C of 5sec.
As the preferred embodiment of the present invention, the reverse transcription condition is：42 DEG C of 15min, 85 DEG C of 5sec.
As the preferred embodiment of the present invention, the reverse transcription condition is：50 DEG C of 15min, 85 DEG C of 5sec.
As the preferred embodiment of the present invention, the reverse transcriptase is that Takara companies article number is RR037A's
MRNA reverse transcriptase, energy value 1U.
As the present invention a preferred embodiment, the stem ring primer include two parts, general stem ring sequence and
With the specific primer sequences of target miRNA3 ' ends complementary pairing.
Enzyme of the present invention used in using the special reverse transcription miRNA of stem-loop method different from the past, using common mRNA or total serum IgE
Enzyme used in reverse transcription is improved by step and method, equally reaches quick, efficient, micro reverse transcription microRNA
(miRNA)。
The invention has the advantages that：
The special reverse transcription miRNA kits of stem-loop method that the prior art uses, it is expensive, and also the reverse transcription time is opposite
Longer, required RNA amounts are larger.The present invention uses common mRNA reverse transcriptase, equally can be with by adjusting reverse transcription condition
Efficiently, specifically, quick reverse transcription miRNA, and can reduce the cost significantly.
Description of the drawings
Attached drawing 1 is Real Time PCR amplification curve graphs, in figure right two to represent U6, miR-21-3p amplification respectively bent
Line.
Attached drawing 2 is Real Time PCR solubility curve figures, and left side represents miR-21-3p solubility curves in figure, and right side represents
U6 solubility curves.
Specific embodiment
The invention will be further elucidated with reference to specific embodiments.It should be understood that these embodiments are merely to illustrate this hair
It is bright rather than limit the scope of the invention.In addition, it should also be understood that, after the content of the invention recorded has been read, art technology
Personnel can make various changes or modifications the present invention, and such equivalent forms equally fall within the application the appended claims and limited
Fixed range.
Embodiment 1
1 reverse transcription reaction：
Reaction system is as follows：
| Reagent | Usage amount | Final concentration |
| 5×PrimerScript Buffer | 2ul | 1× |
| PrimerScript RT Enzyme Mix I | 0.5ul | |
| Stem ring primer (10uM) | 0.2ul | 2pmol |
| Total RNA | 100~500ng | |
| RNase Free dH2O | It is settled to 10ul |
Reagent：PrimerScript RT reagent Kit：
Template：C57 mouse kidney tissues total serum IgE (500ng)
Reaction volume：10ul
PT-Primer:MiR-21-3p, U6 stem ring primer
RT-miR-21-3p:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAGCC
RT-U6:AACGCTTCACGAATTTGCGT
Reaction condition：37 DEG C of 15min, 85 DEG C of 5s, 4 DEG C of preservations.
2Real Time PCR react：
Reagent：SYBR Premix Ex Taq(Takara)
Template：Above-mentioned inverse transcription reaction liquid 2ul
Reaction volume：20ul
Target Gene:miR-21-3p、U6
Reaction condition：10ul 2 × SYBR Green PCR Master Mix, 0.4ul ROX, 0.4ul miR-21-3p,
U6 upstream and downstream primers (10uM), 6.8ul DEPC water.PCR cycle condition is：95 DEG C of pre-degeneration 30s, 95 DEG C of denaturation 5s, 60 DEG C are prolonged
34s is stretched, is recycled 40 times altogether, solubility curve is performed according to ABI 7500PCR instrument solubility curves standard, each 3 repetitions of sample.
Amplimer used is as follows：
miR-21-3p-F:GCAACACCAGTCGATGGG；miR-21-3p-R:GTGCAGGGTCCGAGGT；
U6-F:CTCGCTTCGGCAGCACA；U6-R:AACGCTTCACGAATTTGCGT.
3Real Time PCR reaction results：
As depicted in figs. 1 and 2.Fig. 1 is Real Time PCR amplification curve graphs, and right two represent U6, miR- respectively in figure
21-3p amplification curves.Fig. 2 is Real Time PCR solubility curve figures, and left side represents miR-21-3p solubility curves, right side in figure
Represent U6 solubility curves.
4 conclusions
Using human pancreatic cancer cell, the total serum IgE of hepatic stellate cells cell extraction, miR-214-3p, miR- have been separately verified
146a-3p, U6 internal reference, qRT-PCR results and solubility curve are also verified, and can also equally obtain efficient, quick, micro expansion
Increase.
Reverse transcriptase is that the enzyme of nucleic acid synthesis complementary DNA (cDNA) is taken off using RNA as template guided triphosphoric acid.Reverse transcriptase
Mainly include several enzymatic activitys：DNA polymerase activity of DNA polymerase activity, RNase H activity and DNA guidances etc., due to
MiRNA length is short, according to random primer and Oligodt methods can not reverse transcription go out the cDNA of miRNA.The present invention will be with power traction
Object and Oligodt change specific stem ring primer into, and by adjusting reaction condition, success reverse transcription goes out miRNA.
Following table is the reverse transcription comparison of reverse transcription microRNA methods of the present invention and conventional method single list sample.
The present invention uses common mRNA reverse transcriptase, equally can efficient, special, quick reverse transcription by adjusting reverse transcription condition
MiRNA, and can reduce the cost significantly.
| Time | RNA amounts | Cost | |
| Conventional method | 1h~2h | 500ng~1000ng | 50~100 yuan |
| New method | 15min | 100ng~500ng | 5~10 yuan |
The above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
Member, under the premise of the method for the present invention is not departed from, can also make several improvement and supplement, these are improved and supplement also should be regarded as
Protection scope of the present invention.
SEQUENCE LISTING
<110>Zhongshan Hospital Attached to Fudan Univ
<120>A kind of method of improved reverse transcription microRNA
<130> /
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 50
<212> DNA
<213>Artificial sequence
<400> 1
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacacagcc 50
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
aacgcttcac gaatttgcgt 20
<210> 3
<211> 18
<212> DNA
<213>Artificial sequence
<400> 3
gcaacaccag tcgatggg 18
<210> 4
<211> 16
<212> DNA
<213>Artificial sequence
<400> 4
gtgcagggtc cgaggt 16
<210> 5
<211> 17
<212> DNA
<213>Artificial sequence
<400> 5
ctcgcttcgg cagcaca 17
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<400> 6
aacgcttcac gaatttgcgt 20
Claims (6)
- A kind of 1. method of improved reverse transcription microRNA, which is characterized in that using mRNA reverse transcriptase, according to following reversion Record system carries out reverse transcription：
Reagent Final concentration 5×PrimerScript Buffer 1× PrimerScript RT Enzyme MixI 0.5ul Stem ring primer (10uM) 2pmol Total RNA 100~500ng RNase Free dH2O It is settled to 10ul - 2. the method for reverse transcription microRNA according to claim 1, which is characterized in that reverse transcription condition is：37℃ 15min, 85 DEG C of 5sec.
- 3. the method for reverse transcription microRNA according to claim 1, which is characterized in that reverse transcription condition is：42℃ 15min, 85 DEG C of 5sec.
- 4. the method for reverse transcription microRNA according to claim 1, which is characterized in that reverse transcription condition is：50℃ 15min, 85 DEG C of 5sec.
- 5. according to the method described in claim 1, it is characterized in that, it is RR037A's that reverse transcriptase, which is Takara companies article number, MRNA reverse transcriptase, energy value 1U.
- 6. according to the method described in claim 1, it is characterized in that, the stem ring primer includes two parts, general stem ring sequence Row and the specific primer sequences with target miRNA3 ' ends complementary pairing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810035784.XA CN108192890A (en) | 2018-01-15 | 2018-01-15 | A kind of method of improved reverse transcription microRNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810035784.XA CN108192890A (en) | 2018-01-15 | 2018-01-15 | A kind of method of improved reverse transcription microRNA |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108192890A true CN108192890A (en) | 2018-06-22 |
Family
ID=62589451
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810035784.XA Pending CN108192890A (en) | 2018-01-15 | 2018-01-15 | A kind of method of improved reverse transcription microRNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108192890A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117887847A (en) * | 2024-01-16 | 2024-04-16 | 湖南宏雅基因技术有限公司 | Composition, kit and detection method for noninvasively and early detecting ovarian cancer by peripheral blood exosome miRNA |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103866009A (en) * | 2014-02-26 | 2014-06-18 | 东华大学 | Method for detecting miRNA (micro Ribose Nucleic Acid) by improved stem-lop primer qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) |
-
2018
- 2018-01-15 CN CN201810035784.XA patent/CN108192890A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103866009A (en) * | 2014-02-26 | 2014-06-18 | 东华大学 | Method for detecting miRNA (micro Ribose Nucleic Acid) by improved stem-lop primer qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) |
Non-Patent Citations (5)
| Title |
|---|
| CAIFU CHEN等: "Real-time quantification of microRNAs by stem-loop RT-PCR", 《NUCLEIC ACIDS RES》 * |
| JUNLIFENG等: "The quantification of tomato microRNAs response to viral infection by stem-loop real-time RT-PCR", 《GENE》 * |
| PATRICK WINATA: "The analysis of novel microRNA mimic sequences in cancer cells reveals lack of specificity in stem-loop RT-qPCR-based microRNA detection", 《BMC RESEARCH NOTES》 * |
| 熊黎等: "特异性逆转录microRNA-505的高效茎环引物的设计", 《现代生物医学进展》 * |
| 赵丽等: "茎－环RT-PCR法定量miRNA-421的引物设计", 《南京师大学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117887847A (en) * | 2024-01-16 | 2024-04-16 | 湖南宏雅基因技术有限公司 | Composition, kit and detection method for noninvasively and early detecting ovarian cancer by peripheral blood exosome miRNA |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102154505B (en) | Method and primers for detecting mi ribonucleic acid (miRNA) and application thereof | |
| EP2419538B1 (en) | Methods and compositions to detect and differentiate small rnas in rna maturation pathway | |
| CN107385014B (en) | RT-qPCR method for directly and quantitatively detecting circulating miRNA | |
| CN103509789B (en) | A kind of primer for the Short interfering RNA that increases and methods involving thereof | |
| CN112048556B (en) | Molecular typing and survival risk gene group of primary hepatocellular carcinoma, diagnosis product and application | |
| CN101082060B (en) | New micro ribonucleic acid quantitative PCR (polymerase chain reaction) detection method | |
| CN105132577B (en) | A kind of method that multiple quantitative detection is carried out to miRNA | |
| CN102925577B (en) | Real-time quantitative polymerase chain reaction (PCR) detection method of micro ribonucleic acid (miRNAs) and application thereof | |
| CN116761899A (en) | Colorectal cancer molecular typing and survival risk gene group, diagnostic product and application | |
| CN109251964B (en) | Circulating microRNAs detection kit, method for specifically detecting circulating microRNAs and application | |
| CN108165622A (en) | A kind of modified universal stem ring primer quantitative for miRNA and its quantitative approach | |
| CN1763223B (en) | miRNA detection method | |
| CN108192890A (en) | A kind of method of improved reverse transcription microRNA | |
| CN109371122B (en) | Reference gene for panda milk miRNA detection and application thereof | |
| CN103757122B (en) | Based on hsa-miR-188-5p detection kit and the detection method thereof of AllGlo fluorescence probe quantitative PCR | |
| NL2030973B1 (en) | Primer set for detection of expression of human eosinophil cationic protein (ecp) mrna and kit | |
| EP4253557A1 (en) | Primer/probe design method, detection composition and kit for mirna detection | |
| CN110295252A (en) | Improve reaction solution, primer pair, probe and the kit of the detection dog parainfluenza of specificity | |
| CN113481197B (en) | Linear probe and method for detecting miRNA (micro ribonucleic acid) by using same | |
| CN104032031A (en) | PCR analyzing method for quantitatively detecting nucleic acid through RNA polymerase and ligase coupled reaction medium | |
| CN103740850B (en) | Based on hsa-miR-9 detection kit and the detection method thereof of AllGlo fluorescence probe quantitative PCR | |
| CN105506146B (en) | A kind of quantitative detecting method and kit of the specific detection maturation microRNA expression of non-disease diagnostic purpose | |
| CN116287146B (en) | dT primer, kit and detection method for miRNA detection | |
| CN103740853B (en) | Based on hsa-miR-134 detection kit and the detection method thereof of AllGlo fluorescence probe quantitative PCR | |
| CN115851729A (en) | Marker tRF-Thr-TGT-4-M2 for detecting prostate cancer by urine and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180622 |
|
| RJ01 | Rejection of invention patent application after publication |