CN112226528B - Quality inspection method for detecting bacterial contamination by biological tissue sample - Google Patents
Quality inspection method for detecting bacterial contamination by biological tissue sample Download PDFInfo
- Publication number
- CN112226528B CN112226528B CN202011463358.XA CN202011463358A CN112226528B CN 112226528 B CN112226528 B CN 112226528B CN 202011463358 A CN202011463358 A CN 202011463358A CN 112226528 B CN112226528 B CN 112226528B
- Authority
- CN
- China
- Prior art keywords
- value
- biological tissue
- tissue sample
- rrna
- actb
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of bioengineering quality inspection, and particularly relates to a quality inspection method for detecting bacterial contamination by using a biological tissue sample, which comprises the steps of respectively preparing two RT-qPCR reaction systems, respectively amplifying rRNA and human ACTB of bacteria 16S, and after RT-qPCR reaction, according to the difference value delta CT = CT of the amplified CT value of the rRNA of the bacteria 16S and the CT value of the human ACTB(ACTB)‑CT(16S)Compare Δ CT to threshold: if the biological tissue sample is higher than the threshold value, the biological tissue sample is positive, and the quality control is unqualified; if the biological tissue sample is lower than the threshold value, the biological tissue sample is negative, and the quality control is qualified. When the threshold value is 4, the quality control result has the best sensitivity (86.7%) and specificity (93.8%), and the method is convenient to detect, short in time consumption and high in accuracy.
Description
Technical Field
The invention belongs to the technical field of bioengineering quality inspection, and particularly relates to a quality inspection method for detecting bacterial contamination by using a biological tissue sample.
Background
With the development of biotechnology, clinical treatment selection is wider, except for traditional radiotherapy, chemical drug therapy and surgical treatment, in recent years, targeted drug therapy and immunotherapy are greatly improved, the targeted therapy and the immunotherapy have strong pertinence, each drug has a specific action site, and a patient can select corresponding drugs for treatment only by carrying specific mutation sites, so that the patient is required to be better dosed by gene detection before selecting the drugs.
Many items in clinical medication guidance for gene detection are only DNA detection, but DNA does not completely contain drug therapy targets, such as gene fusion, gene structure variation, gene expression level and the like, and cannot be obtained through DNA sequences, and RNA is important genetic material, information coded in genes is transcribed into RNA molecules, and the RNA molecules can be translated into protein or directly used for fine control of gene expression. Therefore, RNA transcribed under certain conditions and time reflects the current state of cells, can reveal the pathological mechanism of diseases, and has wide application in scientific research activities.
The sample source for clinical detection is mainly Formalin-Fixed paraffin-Embedded (FFPE) tissue sample, therefore, RNA must be extracted from FFPE sample for drug-guided gene detection, and then RNA sequencing is performed to obtain the required gene information, so that the quality of FFPE determines the accuracy of the finally obtained information.
The bacteria have small size, various shapes, various varieties, fast propagation and strong vitality and are extremely harmful in basic research and clinical tests. If bacteria are easy to breed in the FFPE sample in the sampling and storing processes without strict operation according to standard operation rules, the nucleic acid extracted from the FFPE sample is not completely human genes and also comprises bacterial genes due to bacterial pollution, and the human genes in the FFPE are seriously degraded due to bacterial breeding, so that the quality of the obtained genes is influenced, and the accuracy of a detection result is further influenced. Therefore, detection of bacterial contamination from FFPE samples is an important quality control for RNA sequencing.
At present, no attention is paid to whether nucleic acid extracted from an FFPE sample is polluted by bacteria in clinical application, and a simple and quick method is urgently needed as quality control of the whole process to avoid the influence of the nucleic acid polluted by bacteria on the accuracy of a final result due to the fact that the nucleic acid enters the next link to continue an experiment. With the continuous progress of PCR, gene sequencing and other technologies, bacterial detection has evolved from initial phenotypic and chemical identification to molecular level research. The fluorescent quantitative PCR (RT-qPCR) method becomes an important tool in molecular biology research due to the advantages of good specificity, high speed, high sensitivity, good repeatability, accurate quantification and the like.
The existing bacteria detection only amplifies a conserved region sequence of 16S rRNA of bacteria, has single index, cannot well reflect the quality of RNA extracted from an FFPE sample, and human housekeeping gene (human ACTB) is highly conserved, has small influence of environmental factors on the expression level and can reflect the human gene state.
Therefore, the invention provides a method for detecting the bacterial 16S rRNA and the human ACTB in the RNA extracted from the FFPE sample, which can better embody the RNA quality and is beneficial to the subsequent research and application of the RNA.
Disclosure of Invention
In order to solve the problems of single detection index, low accuracy of a detection result, poor specificity, long time consumption and the like of a method for detecting bacteria in an FFPE tissue sample in the prior art, the invention provides a quality detection method for detecting bacterial pollution in a biological tissue sample, wherein the bacterial pollution degree is associated with delta CT by utilizing RT-qPCR reaction and a method for detecting bacterial pollution by amplifying a partial conserved region sequence of bacterial 16S rRNA and human ACTB, and the method has the advantages of high sensitivity, specificity and short time consumption.
The invention is realized by the following technical scheme:
a quality inspection method for detecting bacterial contamination of a biological tissue sample comprises the following steps:
(1) two RT-qPCR reaction systems are respectively prepared and are respectively used for amplifying bacterial 16S rRNA and human ACTB:
adding a forward primer SEQ ID NO.1, a reverse primer SEQ ID NO.2 and a biological tissue sample RNA template into an amplified bacteria 16S rRNA reaction system to carry out RT-qPCR amplification reaction;
adding a forward primer SEQ ID NO.3, a reverse primer SEQ ID NO.4 and a biological tissue sample RNA template into an amplified human ACTB reaction system to carry out RT-qPCR amplification reaction;
(2) analyzing the CT value of the bacterial 16S rRNA and the CT value of the human ACTB amplified in the step (1), and if the CT value of the bacterial 16S rRNA and the CT value of the human ACTB are both more than 30, directly judging that the quality control of the biological tissue sample is unqualified;
if the CT value of the 16S rRNA of the bacterium or the CT value of the human ACTB is less than or equal to 30, calculating the difference between the CT values of the bacterium and the ACTB, wherein the difference is delta CT = CT(ACTB)-CT(16S)；
The CT(16S)The CT value of the amplification of the 16S rRNA of the bacteria represents the expression content of the 16S rRNA of the bacteria, and the CT value(ACTB)The amplified CT value of human ACTB represents the expression content of human ACTB;
(3) compare Δ CT to threshold: if the value is higher than the threshold value, the sample to be detected is positive, and the quality control is judged to be unqualified; if the value is lower than the threshold value, the sample to be detected is negative, and the quality control is judged to be qualified.
Further, the forward primer SEQ ID NO.1 and the reverse primer SEQ ID NO.2 are used for amplifying a bacterial 16S rRNA conserved region sequence, and the bacterial 16S rRNA conserved region sequence is SEQ ID NO. 5.
The 16S rRNA sequence of the bacteria has high conservation and strong universality. Characteristics of bacterial 16S rRNA: (1) multiple copies, high detection sensitivity; (2) the multiple information consists of a variable region and a conserved region, wherein the conserved region is owned by most bacteria, a universal primer can be designed according to the conserved region, and a bacteria specific primer is designed by utilizing the variable region and is used as an optimal sequence for bacteria detection.
Further, the forward primer SEQ ID NO.3 and the reverse primer SEQ ID NO.4 are used for amplifying a human ACTB conserved region sequence which is SEQ ID NO. 6.
The human ACTB gene is a housekeeping gene of the human genome and is expressed at relatively stable levels in most cells. This is also the reason why people often use it as an internal reference, which can reflect the human genetic status.
Preferably, the forward primer SEQ ID NO.1, the reverse primer SEQ ID NO.2, the forward primer SEQ ID NO.3 and the reverse primer SEQ ID NO.4 are primers modified by thio.
The primers for PCR are subjected to thio-modification, so that the conserved region sequence of the 16S rRNA and the conserved region sequence of the human ACTB can be specifically amplified, better amplification is facilitated, and the sensitivity and specificity of subsequent bacterial detection judgment are improved.
Further, the biological tissue sample is a formalin-fixed paraffin-embedded biological tissue sample; the RNA templates of the biological tissue samples in the step (1) are respectively RNA extracted from formalin-fixed paraffin-embedded biological tissue samples;
further, the conditions of the RT-qPCR amplification reaction in the step (1) are as follows: the first stage is reverse transcription stage, and the temperature is 50 ℃ for 10 min; the second stage is a pre-denaturation stage, and the temperature is 95 ℃ for 5 min; the third stage is a PCR reaction stage, wherein the temperature is 95 ℃ for 10s and 60 ℃ for 30 s; and a fourth stage of melting amplification products, wherein the temperature is 95 ℃ for 15s, the temperature is 60 ℃ for 1min, the temperature is 95 ℃ for 15s, and the temperature is 60 ℃ for 15 s.
The threshold value is determined in step (3) by determining that a detection result higher than a certain Δ CT is positive, determining that a detection result lower than the Δ CT is negative, and setting the Δ CT as the threshold value.
The method comprises the steps of determining that the bacteria content of RNA extracted from a sample obtained by NGS sequencing exceeds 10% to be unqualified, determining that the bacteria content is qualified when the bacteria content is lower than 10%, determining that the RNA is a positive sample when the bacteria content is higher than a certain Delta CT value, determining that the RNA is a negative sample when the bacteria content is lower than the Delta CT value, and then calculating the sensitivity and the specificity, wherein the sensitivity is = (the number of positive samples/the number of unqualified samples determined by NGS sequencing) = 100%, and the specificity is = (the number of negative samples/the number of qualified samples determined by NGS sequencing) = 100%, and the Delta CT value at the optimal sensitivity and. The number of the true positive samples is the number of unqualified samples judged to be positive samples by NGS sequencing, and the number of the true negative samples is the number of qualified samples judged to be negative samples by NGS sequencing.
Preferably, the threshold is 4, with high sensitivity (86.7%) and specificity (93.8%).
Compared with the prior art, the invention has the following effects:
(1) the invention respectively screens a bacterial 16S rRNA conserved region sequence (shown as SEQ ID NO. 5) and a human ACTB conserved sequence (shown as SEQ ID NO. 6) which can specifically increase the detection performance, and the bacterial 16S rRNA conserved region sequence and the human ACTB conserved region sequence can specifically represent genes of bacteria and human.
(2) Compared with the prior art that the detection of the 16S rRNA only aiming at a single index possibly causes the risk of misjudgment and can not truly reflect the quality of the RNA extracted from the biological tissue sample, the invention synchronously detects the 16S rRNA and the human ACTB in the RNA extracted from the biological tissue sample and utilizes the amplified CT value to calculate the difference value delta CT (CT)(ACTB)-CT(16S)) The relation with the content of bacteria in RNA extracted from the biological tissue sample so as to determine the RNA quality of the biological tissue sample, and has higher sensitivitySensitivity (86.7%) and specificity (93.8%).
Drawings
FIG. 1 is a graph of CT values of human ACTB and bacterial 16S rRNA amplification and NGS-verified bacterial content in RT-qPCR detection of RNA extracted from FFPE samples;
FIG. 2 is a curve of human ACTB and bacterial 16S rRNA amplification by RT-qPCR detection of quality control;
FIG. 3 is a graph showing sensitivity and specificity curves corresponding to different thresholds in the RT-qPCR detection process of FFPE-extracted RNA.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. The following description of at least one exemplary embodiment is merely illustrative in nature and is in no way intended to limit the invention, its application, or uses. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Preparation of primer pair and quality control product
(1) Forward primer SEQ ID No. 1: 5 '-CCTACGGGNGGCWGCAG-3'; reverse primer SEQ ID NO. 2: 5 '-GACTACHVGGGTATCTAATCC-3';
(2) forward primer for amplification of human ACTB SEQ ID No. 3: 5'-CATCCGCAAAGACCTGTACG-3', respectively; reverse primer SEQ ID NO. 4: 5'-CCTGCTTGCTGATCCACATC-3', respectively;
(3) bacterial 16S rRNA conserved region sequence SEQ ID NO. 5: GCCCCGCGGTGCATTAGCTAGTTGGTAGGGTAACGGCCTACCAAGGCAATGATGCATAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAACAGTGGAACTCCATGTGTAGCGGTGGAATGCGTAGATATATGGAAGAACACCAGTGGCGAAGGCGGCTCTCTGGTCTGCAACTGACGCTGAGGCTCGAAAGCATGGGTAGCGAACAGGATTAGAGACCCTGGTAGTCCATGCC, respectively;
(4) human ACTB conserved region sequence SEQ ID NO. 6: TGTGGCATCCACGAAACTACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACAGTGCTGTCTGGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAGGAGATCACTGCCCTGGCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGGATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTCTAGGCGGACTATGACTTAGTTGCGTTACACCCT, respectively;
(5) the quality control product comprises a positive quality control product and a negative quality control product, wherein the quality control product is RNA which is extracted from an FFPE sample and subjected to NGS verification, the positive quality control product is a bacterial RNA containing bacterial 16S rRNA and a human RNA mixture containing human ACTB, and the negative quality control product only contains human RNA of the human ACTB.
Quality inspection method for detecting bacterial contamination by formalin-fixed paraffin-embedded (FFPE) biological tissue sample
Example 1
The relationship between human ACTB and bacterial 16S rRNA amplified CT values and NGS-verified bacterial contamination levels was determined:
(1) sample preparation: RNA extracted from FFPE of different bacterial contamination degrees detected by NGS by RNase free ddH2Diluting O to 100 ng;
(2) two RT-qPCR reaction systems are prepared and are respectively used for amplifying bacterial 16S rRNA and human ACTB: adding 200nM forward primer SEQ ID NO.1, 200nM reverse primer SEQ ID NO.2 and 100ng FFPE sample RNA template (FFPE extracted RNA with different bacterial contamination degree detected by NGS) into the amplified bacteria 16S rRNA reaction system to perform RT-qPCR amplification reaction;
adding 200nM forward primer SEQ ID NO.3, 200nM reverse primer SEQ ID NO.4 and 100ng FFPE sample RNA template (RNA extracted from FFPE with different bacterial contamination degrees detected by NGS) into the human ACTB amplification reaction system for RT-qPCR amplification reaction;
the conditions of the RT-qPCR amplification reaction are as follows: the first stage is reverse transcription stage, and the temperature is 50 ℃ for 10 min; the second stage is a pre-denaturation stage, and the temperature is 95 ℃ for 5 min; the third stage is a PCR reaction stage, wherein the temperature is 95 ℃ for 10s and 60 ℃ for 30 s; melting amplification product at the fourth stage at 95 deg.C for 15s, 60 deg.C for 1min, 95 deg.C for 15s, and 60 deg.C for 15 s;
(3) the CT values of samples with different bacterial contamination degrees verified according to the NGS amplified in the step (2) are shown in the related data in the table 1, and the corresponding trend chart is shown in the figure 1:
TABLE 1
According to the results, the method comprises the following steps: as the bacterial proportion in RNA extracted from the FFPE sample is increased, the CT value of human ACTB is increased, and the CT value of bacterial 16S rRNA is decreased, which shows that the CT values of human ACTB and bacterial 16S rRNA are related to the bacterial content, and can pass through delta CT = CT(ACTB)-CT(16S)) Reflecting the bacterial proportion of the RNA extracted by FFPE.
Example 2
Determination of negative and positive threshold:
(1) sample preparation: RNA was extracted from 60 FFPE samples and RNase free ddH was used2Diluting O to 100 ng;
(2) amplifying RNA extracted from 60 FFPE samples by the same method as the step (2) in the embodiment 1, and amplifying a quality control product by the same system and conditions as the samples to confirm the accuracy of the sample detection system, wherein the amplification curve of the quality control product is shown in FIG. 2;
(3) according to the CT value obtained by amplifying the RNA extracted from 60 FFPE samples in the step (2), if the CT values of the bacteria 16s rRNA and the human ACTB after the sample to be detected is amplified>30, directly judging that the quality of the sample is unqualified; if the CT value of the amplified bacteria 16s rRNA or human ACTB of the sample to be detected =<30, then calculate Δ CT = CT(ACTB)-CT(16S)If the sample is higher than a certain Delta CT value, the sample is judged to be a positive sample, and if the sample is lower than the Delta CT value, the sample is judged to be a negative sample;
(4) NGS detection is carried out on RNA extracted from 60 cases of FFPE samples at the same time, judgment is carried out according to the NGS detection result, the condition that the percentage of bacteria is more than 10 percent is judged as disqualification, and the condition that the percentage of bacteria is less than 10 percent is judged as qualification;
(5) and (3) calculating the sensitivity and specificity of the delta CT value as a threshold according to the results of the negative samples and the positive samples judged in the step (3) and the result of the NGS detection judgment of whether the sample is qualified, wherein the sensitivity is = (the number of positive samples/the number of unqualified samples judged by the NGS sequencing) × 100%, and the specificity is = (the number of negative samples/the number of qualified samples judged by the NGS sequencing) × 100%. The number of the true positive samples is the number of unqualified samples judged to be positive samples by NGS sequencing, and the number of the true negative samples is the number of qualified samples judged to be negative samples by NGS sequencing.
It can be seen that different thresholds give different sensitivity and specificity, as shown in figure 3: when the threshold value is 4, the sensitivity and the specificity are optimal, wherein the sensitivity is 86.7 percent, and the specificity is 93.8 percent;
therefore, according to Δ CT = CT(ACTB)-CT(16S)Relationship to threshold: if the delta CT value is higher than the threshold value, the sample to be detected is positive, and the quality control is judged to be unqualified; if the delta CT value is lower than the threshold value, the sample to be detected is negative, and the quality control is judged to be qualified.
Therefore, the quality inspection method for detecting bacteria in formalin-fixed paraffin-embedded (FFPE) biological tissue samples adopts synchronous detection of bacteria 16S rRNA and human ACTB in RNA extracted from FFPE samples, and utilizes the amplified CT value to calculate the difference delta CT (CT)(ACTB)-CT(16S)) And the relation with the content of bacteria in the RNA extracted from the FFPE sample, so that the RNA quality of the FFPE sample is determined, the sensitivity (86.7%) and the specificity (93.8%) are high, the detection result can accurately reflect the quality of the RNA extracted from the FFPE sample, the detection is convenient, and the time consumption is short.
The above-mentioned embodiments are intended to illustrate the objects, technical solutions and advantages of the present invention in further detail, and it should be understood that the above-mentioned embodiments are only exemplary embodiments of the present invention, and are not intended to limit the present invention, and any modifications, equivalents, improvements and the like made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> Zhen He (Beijing) Biotechnology Ltd
Zhen and accurate medical laboratory Wuxi Limited
<120> a quality inspection method for detecting bacterial contamination in a biological tissue sample
<130> 2020
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (9)..(9)
<223> n is a, c, g, or t
<400> 1
cctacgggng gcwgcag 17
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gactachvgg gtatctaatc c 21
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cctgcttgct gatccacatc 20
<210> 5
<211> 267
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gccccgcggt gcattagcta gttggtaggg taacggccta ccaaggcaat gatgcatagc 60
cgagttgaga gactgatcgg ccacattggg actgagacac ggcccaaact cctacgggag 120
gcaacagtgg aactccatgt gtagcggtgg aatgcgtaga tatatggaag aacaccagtg 180
gcgaaggcgg ctctctggtc tgcaactgac gctgaggctc gaaagcatgg gtagcgaaca 240
ggattagaga ccctggtagt ccatgcc 267
<210> 6
<211> 345
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tgtggcatcc acgaaactac cttcaactcc atcatgaagt gtgacgtgga catccgcaaa 60
gacctgtacg ccaacacagt gctgtctggc ggcaccacca tgtaccctgg cattgccgac 120
aggatgcaga aggagatcac tgccctggca cccagcacaa tgaagatcaa gatcattgct 180
cctcctgagc gcaagtactc cgtgtggatc ggcggctcca tcctggcctc gctgtccacc 240
ttccagcaga tgtggatcag caagcaggag tatgacgagt ccggcccctc catcgtccac 300
cgcaaatgct tctaggcgga ctatgactta gttgcgttac accct 345
Claims (5)
1. A quality inspection method for detecting bacterial contamination of a biological tissue sample, comprising the steps of:
(1) two RT-qPCR reaction systems are respectively prepared and are respectively used for amplifying bacterial 16S rRNA and human ACTB:
adding a forward primer SEQ ID NO.1, a reverse primer SEQ ID NO.2 and a biological tissue sample RNA template into an amplified bacteria 16S rRNA reaction system to carry out RT-qPCR amplification reaction;
adding a forward primer SEQ ID NO.3, a reverse primer SEQ ID NO.4 and a biological tissue sample RNA template into an amplified human ACTB reaction system to carry out RT-qPCR amplification reaction;
(2) analyzing the CT value of the bacterial 16S rRNA and the CT value of the human ACTB amplified in the step (1), and if the CT value of the bacterial 16S rRNA and the CT value of the human ACTB are both more than 30, directly judging that the quality control of the biological tissue sample is unqualified;
if the CT value of the 16S rRNA of the bacterium or the CT value of the human ACTB is less than or equal to 30, calculating the difference between the CT values of the bacterium and the ACTB, wherein the difference is delta CT = CT(ACTB)-CT(16S)；
The CT(16S)The CT value of the amplification of the 16S rRNA of the bacteria represents the expression content of the 16S rRNA of the bacteria, and the CT value(ACTB)The amplified CT value of human ACTB represents the expression content of human ACTB;
(3) compare Δ CT to threshold: if the value is higher than the threshold value, the sample to be detected is positive, and the quality control is judged to be unqualified; if the value is lower than the threshold value, the sample to be detected is negative, and quality control is judged to be qualified;
the biological tissue sample is a formalin-fixed paraffin-embedded biological tissue sample; the RNA template of the biological tissue sample in the step (1) is RNA extracted from the biological tissue sample;
the threshold value in step (3) is determined by determining that a detection result higher than a certain Δ CT is positive, determining that a detection result lower than the Δ CT is negative, and using the Δ CT as the threshold value;
the threshold is 4.
2. The method of claim 1, wherein the forward primer SEQ ID No.1 and the reverse primer SEQ ID No.2 are used to amplify a conserved sequence of bacterial 16S rRNA, and the conserved sequence of bacterial 16S rRNA is SEQ ID No. 5.
3. The method of claim 1, wherein the forward primer SEQ ID No.3 and the reverse primer SEQ ID No.4 are used to amplify a human ACTB conserved region sequence, which is SEQ ID No. 6.
4. The method of claim 1, wherein the forward primer SEQ ID No.1, the reverse primer SEQ ID No.2, the forward primer SEQ ID No.3 and the reverse primer SEQ ID No.4 are primers modified with thio.
5. The quality control method for detecting bacterial contamination of a biological tissue sample according to claim 1, wherein the conditions of the RT-qPCR amplification reaction in step (1) are as follows: the first stage is reverse transcription stage, and the temperature is 50 ℃ for 10 min; the second stage is a pre-denaturation stage, and the temperature is 95 ℃ for 5 min; the third stage is a PCR reaction stage, wherein the temperature is 95 ℃ for 10s and 60 ℃ for 30 s; and a fourth stage of melting amplification products, wherein the temperature is 95 ℃ for 15s, the temperature is 60 ℃ for 1min, the temperature is 95 ℃ for 15s, and the temperature is 60 ℃ for 15 s.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011463358.XA CN112226528B (en) | 2020-12-14 | 2020-12-14 | Quality inspection method for detecting bacterial contamination by biological tissue sample |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011463358.XA CN112226528B (en) | 2020-12-14 | 2020-12-14 | Quality inspection method for detecting bacterial contamination by biological tissue sample |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112226528A CN112226528A (en) | 2021-01-15 |
| CN112226528B true CN112226528B (en) | 2021-03-16 |
Family
ID=74123677
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011463358.XA Active CN112226528B (en) | 2020-12-14 | 2020-12-14 | Quality inspection method for detecting bacterial contamination by biological tissue sample |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112226528B (en) |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105473737B (en) * | 2013-07-25 | 2019-10-25 | 德诚分子诊断 | Method and composition for detection bacterium pollution |
| CN108588189B (en) * | 2018-04-28 | 2020-04-21 | 中国科学院南京地理与湖泊研究所 | Method for defining blue algae decay window period |
| CN108660190B (en) * | 2018-04-28 | 2020-04-03 | 中国科学院南京地理与湖泊研究所 | Blue algae rapid growth period discrimination method based on cell division ftsZ gene expression quantity |
| CN109554441A (en) * | 2018-12-29 | 2019-04-02 | 同济大学 | A method of by expanding 16S rDNA conserved region sequence detection bacterium |
| CN111778332A (en) * | 2020-06-30 | 2020-10-16 | 中山大学 | Marker combination and kit for early diagnosis of adenoma and colorectal cancer |
-
2020
- 2020-12-14 CN CN202011463358.XA patent/CN112226528B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112226528A (en) | 2021-01-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110964814B (en) | Primers, compositions and methods for nucleic acid sequence variation detection | |
| CN103710460B (en) | Test kit of detection by quantitative EGFR genetic mutation and uses thereof | |
| CN110878343B (en) | Cpf1 kit for rapidly detecting genetic deafness pathogenic gene SLC26A4 mutation and detection method thereof | |
| JP2007509613A (en) | QRT-PCR assay system for gene expression profiling | |
| CN111020031A (en) | Method for detecting tumor gene mutation by combining sequence specific blocker with specific PCR (polymerase chain reaction) program | |
| EP3353320B1 (en) | Improved detection of short homopolymeric repeats | |
| CN108676872A (en) | A kind of and the relevant biomarker of asthma and its application | |
| CN110885883A (en) | DNA reference standard and application thereof | |
| CN114574557B (en) | General type preclinical biodistribution detection kit for NK cell therapy products | |
| CN107513577A (en) | A kind of method of efficient detection EGFRT790M mutant and probe and kit for detection | |
| CN113046452B (en) | Composition for detecting Boeck hollandia farci and application thereof | |
| WO2018199137A1 (en) | Method for detecting minor bcr-abl1 gene | |
| EP4144859A1 (en) | Tumor detection reagent and kit | |
| CN112226528B (en) | Quality inspection method for detecting bacterial contamination by biological tissue sample | |
| CN116814740A (en) | Library construction method for detecting thyroid cancer molecular typing related gene mutation | |
| CN113373251B (en) | SNP molecular marker for identifying mycobacterium tuberculosis complex, PCR primer and application | |
| CN112430651A (en) | Detection method for integrity of FFPE sample | |
| CN112029833A (en) | Rapid identification method of CTNNB1 gene mutation for tumor organoid culture condition selection | |
| CN111607646A (en) | Nucleotide sequence group for detecting BRAF gene mutation and application thereof | |
| CN110804663A (en) | Primer, kit and detection method for detecting human CYP2C19 gene mutation | |
| KR102604416B1 (en) | Method for gene analysis using guide rna | |
| CN109154026A (en) | Method and composition for DLBCL to classify | |
| CN112553378B (en) | Reagent and kit for detecting 2019-nCoV and application | |
| CN213652526U (en) | Cassette for analyzing gene expression in breast cancer patients | |
| WO2024127723A1 (en) | Analysis method, kit, and detection device |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |