KR102604416B1 - Method for gene analysis using guide rna - Google Patents

Abstract

In the present specification, the steps of first amplifying cfDNA containing target DNA among cfDNA contained in a biological sample isolated from an individual, mixing the cfDNA containing the amplified target DNA to form a complex with Cas9 protein and guide RNA. Step, capturing the target DNA from the mixed complex, denaturing the Cas9 protein contained in the complex through heating to elute the captured target DNA, capturing only the eluted target DNA to target DNA Provided is a genetic analysis method using guide RNA, comprising enriching and second amplifying the enriched target DNA.

Description

Gene analysis method using guide RNA {METHOD FOR GENE ANALYSIS USING GUIDE RNA}

The present invention relates to a new gene analysis method with improved measurement sensitivity for target genes by concentrating genes to be targeted using guide RNA.

Cancer is still a high cause of death worldwide, but as the mortality rate decreases when detected early, the importance of early diagnosis of cancer is emerging. Furthermore, early diagnosis as well as cancer diagnosis that can check the condition and possibility of recurrence during the treatment process may be important in cancer treatment.

Currently, the standard method for diagnosing such cancer is tissue biopsy, which involves collecting a portion of tissue from a living body and examining it under a microscope. However, since tissue biopsies are performed invasively using surgical tools such as endoscopes or needles, pain and burden may increase for the patient and the risk is high for the doctor. In addition, tissue biopsy may not be performed depending on the location and size of the tumor (cancer) and the patient's condition, so the diagnosis itself has been limited.

Accordingly, liquid biopsy, which can overcome the disadvantages of the tissue biopsy described above, is attracting attention. Liquid biopsy is a method of examining cells, DNA, and RNA released into the blood from a tumor through body fluids, and can be tested simply, quickly, and non-invasively. In particular, liquid biopsy analyzes biomarkers unique to tumor cells, so the possibility of false positives is low, and various cancer states such as development and metastasis can also be observed.

Meanwhile, in relation to liquid biopsy, research is being actively conducted on cell-free DNA (cfDNA) that is released from tumors into the bloodstream and exists in the body's blood. As technologies for isolating and detecting cfDNA derived from various biological samples such as blood, plasma, or urine advance, liquid biopsies will become a more effective and reliable tool for monitoring patients at risk for cancer.

In various studies to date, more than 50% of patients with a variety of cancers, including advanced pancreatic cancer, lung cancer, ovarian cancer, colorectal cancer, bladder cancer, gastroesophageal cancer, breast cancer, melanoma, hepatocellular carcinoma, prostate cancer, and head and neck cancer, have cancer-derived cfDNA. In other words, circulating tumor DNA (ctDNA) was confirmed. Furthermore, the sensitivity of cfDNA for detecting KRAS gene mutation in genetic clinical diagnosis for patients with metastatic colorectal cancer was 87.2%, and the specificity was 99.2%.

As these studies show the possibility of cancer diagnosis through cfDNA and ctDNA analysis, ctDNA, a cancer-derived gene in cfDNA, is attracting attention as a next-generation biomarker. Accordingly, attempts are being made to diagnose various cancers through ctDNA in liquid biopsy.

The technology behind the invention has been written to facilitate easier understanding of the invention. It should not be understood as an admission that matters described in the technology underlying the invention exist as prior art.

Meanwhile, cancer diagnosis using the aforementioned circulating tumor DNA (ctDNA) has many limitations. More specifically, cfDNA can undergo natural genetic mutations during the aging process. In addition, when the cancer progresses to the intermediate stage or higher, more ct DNA is present in the liquid biopsy, making it possible to diagnose cancer. However, in the early stages of cancer development and after treatment, most cfDNA present in the patient's liquid biopsy is normal. Circulating tumor DNA (ctDNA), derived from somatic cells and tumor cells, is present at very low levels (%) in cfDNA. Therefore, since the nucleic acid concentration of cfDNA extracted from the sample is low and ctDNA is present in a low percentage (%) within cfDNA, it is difficult to measure ctDNA contained in cfDNA using only current sequencing technology due to limitations in the detection sensitivity of the test method. There is.

Accordingly, in order to measure ctDNA contained in a liquid biopsy in very small amounts, a large amount of blood samples from the patient are currently drawn to overcome the limitation of the content of cfDNA in the sample, but this may be a burden to the patient.

Therefore, there is a need for a new method that can show improved detection sensitivity and specificity through ctDNA present at a low percentage (%) in a small amount of cfDNA obtained from a patient's sample.

Meanwhile, the inventors of the present invention used genome editing based on RNA-guided CRISPR (clustered regularly interspaced short palindrome repeats)-related nuclease Cas protein as a method to solve the above-mentioned problem. I paid attention. The above-mentioned gene scissors technology refers to an editing technology that uses targeted nut-out transcription activation and guide RNA (single guide RNA, sgRNA) to cut a specific DNA region, and is used to determine the cause of genetic diseases in stem cells or somatic cells. It can be used in various fields such as correction of mutations and anti-cancer cell therapy.

At this time, when cutting specific DNA using genetic scissors, the Cas protein, that is, Cas9 nuclease, recognizes and cuts the DNA target sequence specified by the sequence of the guide RNA. This method using gene scissors has been used for the purpose of editing specific genes, as described above.

However, the inventors of the present invention paid more attention to the fact that in the method using gene scissors, Cas9 nuclease and guide RNA can accurately recognize and then bind to the target gene region, and when used in combination with gene amplification, measurement It was discovered that the desired target gene could be detected more effectively.

More specifically, the inventors of the present invention, when selectively capturing and enriching a target in a nucleic acid to be detected through the Cas9 nuclease and guide RNA described above, not only cfDNA but also cfDNA. It was discovered that target genes can be effectively detected even in extremely small amounts of ctDNA.

Moreover, the inventors of the present invention discovered specific conditions that enable selective capture and enrichment of target DNA using Cas9 nuclease and guide RNA. In other words, the inventors of the present invention established conditions in which the effect can be maximized when capturing and concentrating target DNA using Cas9 nuclease and guide RNA. .

Accordingly, the inventors of the present invention have provided a new genetic analysis method that improves the detection efficiency of target genes by first amplifying a trace amount of a biological sample isolated from an individual, that is, a very small amount of sample contained in a liquid biopsy, and then applying genetic scissors. I wanted to do it...

The problems of the present invention are not limited to the problems mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.

In order to solve the problems described above, according to one embodiment of the present invention, the present invention includes the steps of first amplifying cfDNA containing target DNA among cfDNA contained in a biological sample isolated from an individual, the amplified target Step of mixing cfDNA containing DNA to form a complex with Cas9 protein and guide RNA, capturing target DNA from the mixed complex, denaturing the Cas9 protein contained in the complex through heating to capture the captured target Provides a genetic analysis method using guide RNA, comprising the steps of eluting DNA, collecting only the eluted target DNA to enrich the target DNA, and secondly amplifying the enriched target DNA. do.

At this time, according to the features of the present invention, the biological sample may include, but is limited to, at least one of the group consisting of blood, urine, pleural fluid, feces, sputum, peritoneal fluid, breast milk, cerebrospinal fluid, saliva, lymphatic fluid, and tracheal lavage fluid. This is not necessarily the case, and can include all of the various samples that can be used as liquid biopsies.

According to another feature of the present invention, amplification is performed by PCR, which includes reverse transcription polymerase chain reaction (RT-PCR), multiplex PCR, real-time PCR, It may be at least one of Assembly PCR, Fusion PCR, Ligase chain reaction (LCR), and Droplet-digital PCR (ddPCR), but is not limited thereto. Based on the above-described PCR, It can include all of the various methods that can amplify genes.

According to another feature of the present invention, the guide RNA may be a dual guide RNA (dual guide RNA) or sgRNA (single-chain guide RNA) including a crRNA (CRISPR RNA) made of polynucleotides.

According to another feature of the present invention, the guide RNA may include biotin bound to the 3' end, but is not limited thereto, and various cross-linking substances that can bind or connect to the magnetic bead complex are bound to the 3' end. can be used Furthermore, the guide RNA may be a guide RNA in which a biotinylation or nanopatterned anchoring step has been performed to bind the biotin described above.

According to another feature of the present invention, the Cas9 protein is Streptococcus pyogenes Cas9 (SpCas9), Streptococcus thermophilus Cas9 (StCas9), Streptococcus pasteurianus (SpaCas9), Campylobacter jejuni Cas9 (CjCas9), Staphylococcus aureus (SaCas9), Francisella novicida Cas9 ( FnCas9), Neisseria cinerea Cas9 (NcCas9), Neisseria meningitis Cas9 (NmCas9), but is not limited to at least one of Prevotella and Francisella 1 (Cpf1), and can recognize PAM and move with the guide RNA to the target DNA sequence. It can contain all the various proteins available.

According to another feature of the present invention, the mixing step includes mixing Cas9 protein and guide RNA, adding amplified cfDNA to the mixed Cas9 and guide RNA and mixing to form a complex, and complex It may include adding a magnetic bead complex.

According to another feature of the present invention, the magnetic bead complex may include at least one of avidin, streptavidin, and neutravidin, but is not limited thereto, and is coated or bound to the magnetic bead and bound to the end of RNA. It can include all cross-linking substances, that is, various substances that can bind to biotin.

According to another feature of the present invention, the magnetic bead complex can bind to biotin bound to the 3' end of the guide RNA.

According to another feature of the present invention, the capturing step may be performed by magnetic sorting or flow cytometric sorting, but is not limited thereto, and is not limited to magnetic sorting coupled to the end of the guide RNA. Using beads, various methods for capturing and selecting them can be included.

According to another feature of the present invention, heating may be performed at 60 to 70 °C, but is preferably 65 °C.

According to another feature of the present invention, the second amplification step may include the step of diluting the concentrated target DNA when the amplification is performed by ddPCR, where the dilution is the concentrated target DNA. It may be performed by diluting the PCR reaction buffer by more than 100 times, preferably about 1000 times, but is not limited thereto, and according to a person skilled in the art, the type of Cas9 protein and target RNA And it can be set in various ways depending on the amount of sample.

According to another feature of the present invention, after the second amplification step, a step of determining whether or not the target DNA is included may be further included depending on the expression level of the target DNA.

According to another feature of the present invention, the determining step may include determining that the individual contains the target DNA if amplification is performed by ddPCR and the copy/reaction (ml) value of the target DNA is 1 or more. You can.

In order to solve the problems described above, according to one embodiment of the present invention, the present invention provides a dual guide RNA (dual guide) comprising a nucleic acid sequence identical or complementary to at least one consecutive nucleotide of SEQ ID NOs: 9 to 11. Provides guide RNA for diagnosing EGFR mutations, which is RNA) or sgRNA (single-chain guide RNA).

According to another feature of the present invention, the nucleotide is capable of specifically binding to a sequence comprising the 790th region from exon 20 of the EEGFR tyrosine kinase domain, and comprising the 790th region from exon 20 of the EEGFR tyrosine kinase domain. The sequence may be at least one of SEQ ID NO: 5 or 6, and may include a protospacer adjacent motif (PAM), such as 5'-GGC-3', 5'- It may include at least one nucleic acid sequence of CGG-3' and 5'-TGG-3'. In addition, when the sequence containing the 790th region in exon 20 of the EEGFR tyrosine kinase domain is sequence number 5, the 26th nucleic acid from the 5'-end of the nucleic acid sequence for SEQ ID NO: 5 has a sequence from cytosine (C) to thymine (T ) can be characterized as being changed to . In other words, the guide RNA for EGFR mutation diagnosis can target T790M among EGFR mutations.

According to another feature of the present invention, the guide RNA may include biotin bound to the 3' end, but is not limited thereto, and may include all of various cross-linking substances that can be formed at the 3' end. Furthermore, the biotin described above can be formed by designing and producing guide RNA and then performing biotinylation.

According to another feature of the present invention, the guide RNA includes a third primer comprising consecutive nucleotides of SEQ ID NO: 7 or 8, a fourth primer comprising consecutive nucleotides of SEQ ID NO: 12 or 13, and SEQ ID NO: 14 or It can be synthesized by at least one of the fifth primers containing 15 consecutive nucleotides.

In order to solve the problems described above, according to one embodiment of the present invention, the present invention provides a genetic analysis kit for diagnosing EGFR mutations, including the guide RNA for diagnosing EGFR mutations described above.

According to another feature of the present invention, the kit may include a second primer containing consecutive nucleotides of SEQ ID NO: 1 or 2, and further, a first primer containing consecutive nucleotides of SEQ ID NO: 3 or 4. may further include.

Furthermore, the kit includes a third primer comprising consecutive nucleotides of SEQ ID NO: 7 or 8, a fourth primer comprising consecutive nucleotides of SEQ ID NO: 12 or 13, and a primer comprising consecutive nucleotides of SEQ ID NO: 14 or 15. It may include at least one of 5 primers.

Furthermore, the kit may include components well known in the art, in addition to the primers and guide RNA described above, to measure target DNA. Specifically, it may include PCR buffer, dNTP, DNA polymerase, etc.

Hereinafter, the present invention will be described in more detail through examples. However, since these examples are only for illustrative purposes of the present invention, the scope of the present invention should not be construed as being limited by these examples.

The present invention has the effect of accurately diagnosing target genes contained in trace amounts.

More specifically, the present invention uses the Cas9 protein and guide RNA used for gene cutting and editing to accurately capture the target DNA to be measured without cutting or editing the gene, thereby concentrating the target DNA to a high concentration. Accordingly, target DNA, which could not be detected by conventional analysis methods, can be easily detected.

In other words, the present invention is capable of highly concentrating target DNA contained in extremely small amounts, thereby improving sensitivity, specificity, and accuracy, making it possible to accurately detect even very low concentrations of mutations and biomarkers present in a sample.

Accordingly, the present invention has a superior clinical diagnostic effect than conventional analysis and diagnosis methods, and can be used as a gold standard in biomarker analysis such as drug selection and cancer diagnosis.

Moreover, by using liquid biopsy, the present invention can detect mutations and biomarkers non-invasively.

Accordingly, through the present invention, accurate diagnosis in the early stage of the disease is possible, and furthermore, drug resistance and treatment effectiveness can be confirmed through monitoring of drug treatment.

The effects according to the present invention are not limited to the contents exemplified above, and further various effects are included in the present specification.

1 and 2 are flowcharts and illustrations of a genetic analysis method using guide RNA according to an embodiment of the present invention.
Figure 3 is a flowchart of the verification process for the genetic analysis method using guide RNA according to an embodiment of the present invention.
Figure 4 shows the sequences of primers and guide RNA used in the verification process for the genetic analysis method using guide RNA according to an embodiment of the present invention.
Figures 5A and 5B show exemplary diagrams for the T790M area.
Figures 6a and 6b show amplification results for primers that can be used in the genetic analysis method using guide RNA according to an embodiment of the present invention.
Figures 7a and 7b show ddPCR results depending on the dilution factor of the sample in the genetic analysis method using guide RNA according to an embodiment of the present invention.
Figures 8a and 8b show ddPCR results according to the first amplification in the gene analysis method using guide RNA according to an embodiment of the present invention.
Figures 9a to 9c show experimental results on the analysis performance of the genetic analysis method using guide RNA according to an embodiment of the present invention.

The advantages and features of the present invention and methods for achieving them will become clear by referring to the embodiments described in detail below along with the accompanying drawings. However, the present invention is not limited to the embodiments disclosed below and will be implemented in various different forms, but the present embodiments only serve to ensure that the disclosure of the present invention is complete and are within the scope of common knowledge in the technical field to which the present invention pertains. It is provided to fully inform those who have the scope of the invention, and the present invention is only defined by the scope of the claims.

As used herein, the term “nucleic acid” may refer to at least one nucleotide consisting of a sugar linked to an organic base (either a substituted pyrimidine such as cytosine, thymidine, and uracil, or a substituted purine such as adene and guanine). there is. More specifically, nucleic acids may include ribonucleic acid (RNA), deoxyribonucleic acid (DNA), methylphosphonate nucleic acid, S-oligo, cDNA, miRNA, and aptamer, and may be naturally occurring or artificial. It can include anything synthesized with . However, it may preferably be RNA and DNA, but is not limited thereto.

The term “guide RNA” used herein refers to a polynucleotide that recognizes a target nucleic acid and cuts, inserts, or links the target nucleic acid through genome editing. However, in the present invention, it may be RNA specific to the target DNA. More specifically, the guide RNA is an RNA that is expressed through transcription of linear double-stranded DNA delivered into the cell, recognizes the target gene sequence, forms a complex with the Cas 9 protein, and brings the Cas 9 protein to the target DNA. The guide RNA may include a sequence complementary to the target nucleic acid, and is 2 to 24 consecutive nucleotides (e.g., about 20 nt) in the 5' or 3' direction of the PAM in the target nucleic acid (hereinafter referred to as 'nt'). It may include a polynucleotide complementary to the nucleotide sequence of. The length of the guide RNA is 10 nt to 100 nt, 10 nt to 90 nt, 10 nt to 80 nt, 10 nt to 70 nt, 10 nt to 60 nt, 10 nt to 50 nt, 15 nt to 50 nt, and 20 nt. It may be from 50 nt to 50 nt, from 25 nt to 50 nt, from 30 nt to 50 nt, from 35 nt to 50 nt, from 40 nt to 50 nt, or from 45 nt to 50 nt.

As used herein, the term “target gene sequence” refers to a nucleotide present in a target gene or nucleic acid, and specifically, a partial nucleotide sequence of a target region within a target gene or nucleic acid. In this case, “target region” refers to a nucleotide sequence present within a target gene or nucleic acid. This is a site that can be modified by a guide nucleic acid-editor protein.

The term "PAM sequence" used herein refers to a target sequence recognized by the CRISPR-Cas complex as a 3bp-sized sequence located next to the target sequence. The CRISPR-Cas complex recognizes the PAM sequence and then makes a specific location is cut.

The term "biotinylation" used herein refers to a method of attaching biotin to DNA or RNA, by attaching biotin to the 3' end of a single DNA or RNA through an enzyme such as terminal deoxynucleotidyl transferase (TdT). Biotin can be attached. Biotin and TdT are made chemically cross-linked and are commercially available in the art.

As used herein, the term “cell-free DNA (cfDNA)” refers to a cancer cell-derived gene that originates from tumor cells and can be found in biological samples such as blood, plasma, or urine of cancer patients. It is activated by necrosis, apoptosis, or normal cells and/or cancer cells of the urinary tract, and is released into urine, blood, etc. through various cell physiological processes. Urine, cerebrospinal fluid (CSF), plasma, blood, or body fluids are samples that can be easily obtained, making it possible to collect large amounts of simple, non-invasive samples through repeated sampling.

The term "CRISPR/Cas system" used herein is composed of a guide RNA (gRNA) with a sequence complementary to a gene or nucleic acid and the CRISPR enzyme, a nuclease that can cleave the target gene or nucleic acid. gRNA and CRISPR The enzyme forms a CRISPR complex and cleaves or modifies the gene or nucleic acid targeted by the formed CRISPR complex.

As used herein, the term "Cas 9 protein" refers to an essential protein component in the CRISPR/Cas system and forms a complex with two RNAs called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). When doing so, an active endonuclease is formed. Information on the Cas 9 protein gene and protein can be obtained from GenBank of the National Center for Biotechnology Information (NCBI), but is not limited thereto.

The term “amplification” used herein refers to a reaction that amplifies a target nucleic acid sequence, such as reverse transcription polymerase chain reaction (RT-PCR), multiplex PCR, or real-time PCR. , assembly PCR, fusion PCR, ligase chain reaction (LCR), and droplet-digital PCR (ddPCR), etc., but are not limited thereto.

The term “primer” used herein refers to a single-stranded oligonucleotide and may also include ribonucleotides, preferably deoxyribonucleotides. Primers hybridize or anneal to one site of the template to form a double-stranded structure. In the present invention, primers may be hybridized or annealed to an NGS sequencing adapter sequence. Annealing refers to the juxtaposition of an oligonucleotide or nucleic acid to a template nucleic acid, whereby a polymerase polymerizes the nucleotides to form a nucleic acid molecule complementary to the template nucleic acid or a portion thereof. Hybridization means that two single-stranded nucleic acids form a duplex structure by pairing complementary base sequences. A primer can act as a starting point for synthesis under conditions that induce the synthesis of a primer extension product complementary to the template.

As used herein, the term “diagnosis” means identifying the condition or characteristics of a pathological condition. For the purpose of the present invention, it may mean confirming the type, occurrence, and cause of cancer (tumor), and further, confirming the presence and expression level of target genes, that is, biomarkers, to determine tumor treatment strategies and development. It may include, but is not limited to, determining the susceptibility of an individual to a specific disease or condition, and the prognosis of an individual suffering from a specific disease or condition. Determination, or therametrics (e.g., monitoring the condition of an object to provide information about treatment efficacy).

Genetic analysis method using guide RNA

Hereinafter, with reference to FIG. 1, the procedure of the genetic analysis method using guide RNA according to an embodiment of the present invention will be described in detail. At this time, for convenience of understanding, the description will be made with reference to FIG. 2.

First, referring to Figure 1, the genetic analysis method using guide RNA according to an embodiment of the present invention has a total of six steps, in which cfDNA containing target DNA among cfDNA contained in biological samples isolated from an individual is first analyzed. Amplifying step (S110), mixing cfDNA containing the amplified target DNA to form a complex with Cas9 protein and guide RNA (S120), capturing target DNA from the mixed complex (S130), A step of denaturing the cas9 protein contained in the complex through heating to elute the captured target DNA (S140), a step of enriching the target DNA by capturing only the eluted target DNA (S150), and the concentrated It may include a second amplification step (S160) of the target DNA.

More specifically, referring to FIG. 2, in step S110, only the template containing the target DNA among the cfDNA contained in the biological sample isolated from the individual can be amplified using PCR.

Amplification of a template containing target DNA can be performed using primers designed based on the sequence of the target DNA and a PCR method.

For example, when trying to amplify a region containing EGFR-T790M through cfDNA contained in a biological sample isolated from an individual, DNA containing EGFR-T790M is obtained through primers of SEQ ID NO: 1 or 2 below and PCR. The template can be amplified. At this time, in the genetic analysis method using guide RNA according to one embodiment of the present invention, its detection and analysis effects were verified through T790M, but the present invention is not limited to the above-described mutation measurement and can be applied to a wider variety of biomarkers. can be used

Forward primer sequence: 5′-CTCCAGGAAGCCTACGTGAT-3′ (SEQ ID NO: 1)

Reverse primer sequence: 5′-GTCTTTGTGTTCCCGGACAT-3′ (SEQ ID NO: 2)

However, primers capable of amplifying the DNA template containing EGFR-T790M are not limited to the above-mentioned SEQ ID NO: 1 or 2, and their locus, that is, exons 20 to 790 of the EGFR tyrosine kinase domain. It may contain all gene sequences of 40 bp or less that can bind complementary to the region containing the position (SEQ ID NO: 5 or 6), and the primer of SEQ ID NO: 3 or 4 below also contains EGFR-T790M. DNA template can be amplified. At this time, unlike the reference, the nucleotide at position 790 in exon 20 of the EGFR tyrosine kinase domain is changed from C to T, and the amino acid changes from ACG to ATG to threonine (T). It may mean a sequence changed from to methionine (M) (bold text indicates the mutated T790M region).

Forward primer sequence: 5′- CATGCGAAGCCACACTGAC-3′ (SEQ ID NO: 3)

Reverse primer sequence: 5′- CGGACATAGTCCAGGAGGCA-3′ (SEQ ID NO: 4)

DNA sequence containing forward EGFR-T790M: 5′-CTCACCTCCACCGTGCAGCTCATCA T GCAGCTCATGCCCTTCGGCTGCC-3′ (SEQ ID NO: 5)

Complementary DNA sequence containing EGFR-T790M: 3′-GACTGGAGGTGGCACGTCGAGTAGTGCGTCGAGTACGGGAAGCCGACGG-5′ (SEQ ID NO: 6)

Furthermore, the conditions under which PCR is performed can be set based on methods widely known in the art.

Ultimately, through step S110, only cfDNA containing the target DNA to be measured can be amplified.

Next, in step S120, cfDNA containing the amplified target DNA can be mixed with the Cas9 protein and guide RNA to form a complex (assembly).

More specifically, first, Cas9 protein and guide RNA can be mixed with NEB3 buffer at a 1:5 ratio, and then incubated at room temperature for 10 minutes.

Next, 0.5 ng of amplified cfDNA is added to the Cas9 protein and guide RNA mixed in a certain ratio to form a complex with a final concentration of 100 nmol/L, and then allowed to react at 37°C for 2 hours.

At this time, the ratio of the Cas9 protein containing the amplified target DNA and the guide RNA may be preferably 1:5, but is not limited thereto and may vary depending on the type of Cas9 protein mixed with the guide RNA. For example, the Cas9 protein in the genetic analysis method using guide RNA according to an embodiment of the present invention may preferably be Streptococcus pyogenes Cas9 (SpCas9), but is not limited thereto, and may include Streptococcus thermophilus Cas9 (StCas9), At least one of Streptococcus pasteurianus (SpaCas9), Campylobacter jejuni Cas9 (CjCas9), Staphylococcus aureus (SaCas9), Francisella novicida Cas9 (FnCas9), Neisseria cinerea Cas9 (NcCas9), Neisseria meningitis Cas9 (NmCas9) Prevotella and Francisella 1 (Cpf1) You can. However, the CAS9 protein can form a complex with guide RNA and cfDNA and contain various proteins that can cleave the target site, and the complex formation rate of Cas9 protein and guide RNA varies depending on the type of Cas9 protein, according to the present technology. It can be set in various ways by a person skilled in the art who wishes to practice the present invention based on methods widely known in the field.

Next, the magnetic bead complex can be added to the complex containing cfDNA, Cas9 protein, and guide RNA reacted at 37°C for 2 hours, and the magnetic bead complex can be bound to the guide RNA.

At this time, the guide RNA is an RNA that can specifically bind to the target DNA, and is expressed through transcription of linear double-stranded DNA delivered into the cell to recognize the target gene sequence and form a complex with the Cas9 protein. It serves to guide the target DNA.

Accordingly, since the guide RNA must specifically bind to the target DNA, it can be designed based on the sequence of the target DNA. However, since the guide RNA must react as a complex with the Cas9 protein, the sequence may originate from a protospacer adjacent motif (PAM) sequence that the Cas9 protein can recognize.

For example, if it is intended to target EGFR-T790M through cfDNA contained in a biological sample isolated from an individual, the guide RNA may be produced by a DNA sequence containing EGFR-T790M of SEQ ID NO: 5 or 6 below. The DNA sequence of SEQ ID NO: 5 or 6 below contains a total of three PAMs around the EGFR-T790M region (the underlined letters indicate the PAM region).

DNA sequence containing forward EGFR-T790M: 5′-CTCACCTCCACCGTGCAGCTCATCA T GCAGCTCATGCCCTTC GGC TGCC-3′ (SEQ ID NO: 5)

Complementary DNA sequence containing EGFR-T790M: 3′-GACTGGA GGTGGC ACGTCGAGTAGTGCGTCGAGTACGGGAAGCCGACGG-5′ (SEQ ID NO: 6)

Accordingly, in the case of targeting EGFR-T790M, the guide RNA may start from the above-described PAM region, so a sequence consisting of at least one of the following SEQ ID NOs: 9, 10, and 11, or a nucleic acid sequence complementary thereto. It can be included.

crRNA of guide RNA 1: 5′- ATCAGCAGCTCATGCCCTT -3′ (SEQ ID NO: 9)

crRNA of guide RNA 2: 3′-GGCACGTCGAGTAGTGCGTC-5′ (SEQ ID NO: 10)

crRNA of guide RNA 3: 3′- ACGTCGAGTAGTGCGTCGAG-5′ (SEQ ID NO: 11)

In other words, the sequences of SEQ ID NOs: 9, 10, and 11 may mean a crRNA (target specific) region that can bind to the target DNA in the guide RNA, and the gene using the guide RNA according to an embodiment of the present invention In the analysis method, the crRNA region that can concentrate the target DNA containing T790M with the highest efficiency may be preferably SEQ ID NO: 9. More specifically, the guide RNA used in the gene analysis method using guide RNA according to an embodiment of the present invention is a two-part guide RNA containing crRNA and tracrRNA, and the tracrRNA and crRNA can be connected by a linker loop sequence. there is.

Meanwhile, in the gene analysis method using guide RNA according to an embodiment of the present invention, when the guide RNA includes the crRNA region of SEQ ID NO: 9 described above, the guide RNA can be synthesized using a primer containing the following sequence.

Primer sequence for forward guide RNA synthesis: 5′- TAATACGACTCACTATAG ATCA T GCAGCTCATGCCC-3′

Primer sequence for reverse guide RNA synthesis: 5′- TTCTAGCTCTAAAAC AAGGGCATGAGCTGCATGAT-3′

At this time, the sequence of the underlined region is not limited to the above-described TAATACGACTCACTATAG (forward) and TTCTAGCTCTAAAAC (reverse), and various commercially available primer sequences can be used.

Ultimately, when it is intended to target EGFR-T790M in the genetic analysis method using guide RNA according to an embodiment of the present invention, the preferred guide RNA of the present invention is synthesized using a primer containing the sequence of SEQ ID NO: 7 or 8 below. It can be.

Primer sequence for forward guide RNA synthesis: 5′- ATCA T GCAGCTCATGCCC -3′ (SEQ ID NO. 7)

Primer sequence for reverse guide RNA synthesis: 5′- AAGGGCATGAGCTGCATGAT -3′ (SEQ ID NO. 8)

Furthermore, when targeting EGFR-T790M in the genetic analysis method using guide RNA according to an embodiment of the present invention, the guide RNA will include not only the crRNA region of SEQ ID NO: 9, but also the crRNA regions of SEQ ID NO: 10 and 11. As can be done, the guide RNA can be synthesized using primers containing the sequences of SEQ ID NOs: 12 to 15 below.

Primer sequence for forward guide RNA synthesis: 5′- CTGCATGATGAGCTGC -3′ (SEQ ID NO. 12)

Primer sequence for reverse guide RNA synthesis: 5′- CCGTGCAGCTCATCATGCAG -3′ (SEQ ID NO. 13)

Primer sequence for forward guide RNA synthesis: 5′- GAGCTGCATGATGAGC -3′ (SEQ ID NO. 14)

Primer sequence for reverse guide RNA synthesis: 5′- TGCAGCTCATCATGCAGCTC -3′ (SEQ ID NO. 15)

Meanwhile, as described above, the conventional guide RNA is complementary to the specific region sequence of the target gene, so it moves to bind to the specific region sequence, allowing the Cas9 protein to cleave it and modify it. However, in the genetic analysis method using guide RNA according to an embodiment of the present invention, the guide RNA is used for the purpose of capturing only the target DNA after recognizing the target DNA and before the Cas9 protein cleaves the specific region sequence. You can.

More specifically, in the genetic analysis method using guide RNA according to an embodiment of the present invention, the guide RNA may include magnetic beads (particles) to capture only target DNA. That is, the guide RNA in the gene analysis method using guide RNA according to an embodiment of the present invention is RNA that has undergone a biotinylation process to form biotin at the 3' end region.

Accordingly, the guide RNA in the genetic analysis method using guide RNA according to an embodiment of the present invention contains biotin in the 3' terminal region, and thus magnetic beads coated with proteins such as avidin, streptavidin, and neutravidin ( In other words, when a magnetic bead complex is added, the magnetic bead complex can bind to biotin in the 3' end region of the guide RNA. Furthermore, as the guide RNA in the genetic analysis method using guide RNA according to an embodiment of the present invention contains biotin in the 3' terminal region, it can be used in various ways such as donor polynucleotides, nanoparticles, and dye molecules as well as the above-mentioned magnetic beads. It can be connected to substances and contain more.

Moreover, the guide RNA in the genetic analysis method using guide RNA according to an embodiment of the present invention includes a magnetic bead bound to biotin at the 3' end region by the above-described process, thereby binding to the target DNA and then being magnetically It can be physically captured and sorted together with the target DNA.

Accordingly, in step S130, target DNA can be enriched from a complex containing cfDNA, Cas9 protein, and guide RNA. More specifically, by the above-described step S120, the target DNA contained in the cfDNA in the complex including cfDNA, Cas9 protein, and guide RNA may be bound to the guide RNA including the magnetic bead.

Therefore, in step S130, first, through a physical method, that is, a method using magnetic force such as magnetic sorting or flow cytometric sorting, the target DNA is separated from the complex by binding to a guide RNA containing a magnetic bead. can be captured.

Next, in step S140, the Cas9 protein contained in the complex can be denatured through heating to elute the captured target DNA. More specifically, since the target DNA captured in the above-described process is contained within the Cas9 protein and guide RNA complex, it may be cleaved by the Cas9 protein after a certain period of time.

However, in the genetic analysis method using guide RNA according to an embodiment of the present invention, the Cas9 protein can be used not for the purpose of cutting the target DNA, but as a mediator that can accurately move the guide RNA to the target DNA. That is, in the genetic analysis method using guide RNA according to an embodiment of the present invention, the Cas9 protein may be a mediator that can improve specificity for the target DNA region by accurately recognizing the PAM region.

Accordingly, in the genetic analysis method using guide RNA according to an embodiment of the present invention, the Cas9 protein must be deactivated after the guide RNA binds to the target DNA and before the target DNA is cut, so it is heated in step S130. A step of denaturing the Cas9 protein through heating may be performed. Ultimately, as the Cas9 protein is denatured by heating, the target DNA may be separated from the Cas9 protein and eluted. At this time, the heating temperature may be 60 to 70°C, which can denature the Cas9 protein, but is not limited thereto, and is preferably 65°C.

Next, in step S150, only the eluted target DNA can be collected and only the target DNA can be concentrated.

Ultimately, through steps S110 to S150, only the target DNA, that is, the template containing the target DNA, can be accurately concentrated.

Next, in step S160, the concentrated target DNA can be amplified by the step S150 described above. At this time, amplification of the target DNA may be performed in the same manner as the above-described step S110.

Meanwhile, in the genetic analysis method using guide RNA according to an embodiment of the present invention, when step S160 is performed by ddPCR, a step of diluting the concentrated target DNA before amplification may be performed in step S160. there is. More specifically, since the target DNA concentrated by the above-described S110 to S150 is fragmented into small sizes, it may include damaged samples, and these damaged samples may act as inhibitors that interfere with gene amplification. You can. That is, as the concentrated target DNA contains damaged samples, the damaged samples may be replicated and amplified, or replication and amplification of the target DNA may be inhibited, and the target DNA to be measured may not be detected.

Accordingly, in the genetic analysis method using guide RNA according to an embodiment of the present invention, amplification efficiency can be improved by reducing the amount of elements such as inhibitors through dilution. At this time, since the target DNA concentrated by the above-described S110 to S150 is a highly concentrated sample, it can exhibit the most ideal amplification efficiency when diluted about 1000 times in the PCR reaction buffer. However, this dilution factor is not limited to the above-mentioned 1000 times, and can be set variously by a person skilled in the art depending on the type of target DNA to be measured.

Through the above process, the genetic analysis method using guide RNA according to an embodiment of the present invention can highly concentrate target DNA contained in trace amounts in various samples, and thus has high sensitivity, that is, high specificity and sensitivity. It can accurately measure the target DNA to be measured.

Hereinafter, the genetic analysis method using the guide RNA according to an embodiment of the present invention described above will be verified through the guide RNA for EGFR mutation diagnosis according to an embodiment of the present invention.

Verification process for guide RNA for EGFR mutation diagnosis and genetic analysis method using guide RNA according to an embodiment of the present invention

First, with reference to FIGS. 3 to 5, the verification process for the genetic analysis method using guide RNA according to an embodiment of the present invention and the primers and guide RNA used therein will be described.

Referring to FIG. 3, a flowchart of the verification process for the genetic analysis method using guide RNA according to an embodiment of the present invention is shown.

At this time, in order to verify the gene analysis method using guide RNA according to an embodiment of the present invention, T790M, an EGFR mutation, was selected. More specifically, in diagnosing non-small cell lung cancer, EGFR mutations, that is, activation mutations such as Exon19Del or L858R, can be measured at the beginning of hospital admission. These activating mutations may be important in determining the type of cancer at the initial presentation and selecting treatment such as TKI. As the activating mutation test at the initial presentation indicates that the cancer is progressing, a large number of copies of the activating mutation are present in the liquid biopsy. Therefore, measurement efficiency and reliability can be high. However, unlike the above-mentioned activating mutation, T790M is a drug resistance mutation that occurs during treatment such as TKI, and the appearance of such a resistance mutation, regardless of the amount, can change the direction of treatment. Furthermore, as resistance mutations are measured after treatment has already been performed, the tumor size may be reduced and the number of cfDNA derived from the tumor in the liquid biopsy may be very low. Accordingly, detection of resistance mutations such as T790M from liquid biopsies can be difficult.

Accordingly, in the genetic analysis method using guide RNA according to an embodiment of the present invention, T790M was selected as the target DNA in order to confirm the detection power of biomarkers that are difficult to detect because they are contained in the sample in such trace amounts.

Meanwhile, in the genetic analysis method using guide RNA according to an embodiment of the present invention, its detection and analysis effects were verified through T790M, but the present invention is not limited to the above-described mutation measurement and can be used for a variety of biomarkers. It can be applied and used. For example, the genetic analysis method using guide RNA according to an embodiment of the present invention can be used to measure mutations disclosed in Table 1 below.

Again, referring to FIG. 3, the verification process for the genetic analysis method using guide RNA according to an embodiment of the present invention is performed on patients with non-small cell lung cancer containing an EGFR mutation when TKI treatment was performed (after EGFR-TKI). After selecting patients undergoing TKI treatment (clinically progressed during EGFR-TKI), T790M was confirmed in their samples using qPCR. Next, the samples confirmed to have the T790M mutation (positive-negative) were measured again using ddPCR and a genetic analysis method using guide RNA according to an embodiment of the present invention, and the results for each method were compared. .

Referring to Figure 4, the sequences of primers and guide RNA used in the verification process for the genetic analysis method using guide RNA according to an embodiment of the present invention are shown.

In the genetic analysis method using guide RNA according to an embodiment of the present invention, the primers used for DNA amplification are one set of primers containing the sequence of SEQ ID NO: 3 or 4 or two sets of primers containing the sequence of SEQ ID NO: 1 or 2. may be used, but preferably, it may be 2 sets of primers comprising SEQ ID NOs: 1 and 2.

Furthermore, in the genetic analysis method using guide RNA according to an embodiment of the present invention, primers for synthesizing guide RNA used for DNA amplification may include the sequences of SEQ ID NOs: 7 and 8.

These primers can be designed based on the region containing T790M. More specifically, referring to Figure 5A, an example diagram for the T790M region is shown. T790M refers to a mutation in which the nucleotide is changed from C to T in the region from exon 20 to 790 of the EGFR tyrosine kinase domain. As the sequence changes from ACG to ATG due to the above-mentioned mutation, the produced amino acid may change from threonine (T) to methionine (M).

The DNA sequence containing EGFR-T790M may be SEQ ID NO: 5 or 6, as shown in (a) of FIG. 5A, and in SEQ ID NO: 5 or 6, there is a PAM region that can be recognized by the Cas9 protein. . Accordingly, the guide RNA can be designed to include the T790M region starting from the PAM region.

For example, referring to (b) of FIG. 5A, the guide RNA may include at least one sequence of SEQ ID NOs: 9, 10, and 11 including the PAM region and the T790M region, as described above, and these sequences Sequences numbered 9, 10, and 11 may refer to crRNA regions capable of binding to target DNA in the guide RNA. Meanwhile, the guide RNA used in the genetic analysis method using guide RNA according to an embodiment of the present invention may include at least one sequence of SEQ ID NOs: 9, 10, and 11, but is not limited thereto, and preferably , may include SEQ ID NO: 9.

Furthermore, guide RNA can be synthesized using primers designed based on the above-described crRNA region. For example, referring to Figure 5b, the guide RNA used in the gene analysis method using guide RNA according to an embodiment of the present invention may include at least one sequence of SEQ ID NOs: 9, 10, and 11, that is, crRNA. The primer for synthesizing the guide RNA may include at least one sequence of SEQ ID NOs: 7 to 15 based on the above-described crRNA sequence.

More specifically, when it is intended to synthesize guide RNA containing the crRNA of SEQ ID NO: 9, the guide RNA can be synthesized through 3 sets of primers (third primers) containing the sequence of SEQ ID NO: 7 or 8, and the sequence When it is desired to synthesize a guide RNA containing the crRNA of SEQ ID NO: 10, the guide RNA can be synthesized through 4 sets of primers (4th primers) containing the sequence of SEQ ID NO: 12 or 13, and the crRNA of SEQ ID NO: 11 When it is intended to synthesize a guide RNA containing the sequence, the guide RNA can be synthesized through 5 sets of primers (5th primer) containing the sequence of SEQ ID NO: 14 or 15. At this time, the primer for guide RNA synthesis is not only the crRNA sequence, which is the targeting sequence of the guide RNA described above, but also a promoter required for in vitro transcription and a scaffold template that can form a complex with Cas9. Additional sequences for the (Scaffold Template) region may be included, but various commercially used sequences in the present technical field may be used.

Accordingly, the genetic analysis method using guide RNA according to an embodiment of the present invention can accurately measure mutations related to EGFR-TKI treatment drug resistance through the above-described primers and guide RNA, and further, these mutations can be identified as described above. By early diagnosis using primers and guide RNA, more effective treatment strategies can be provided to patients.

Optimization of a genetic analysis method using guide RNA according to an embodiment of the present invention

Hereinafter, with reference to FIGS. 6A to 7B, optimization conditions for the gene analysis method using guide RNA according to an embodiment of the present invention will be described.

Referring to FIGS. 6A and 6B, amplification results for primers that can be used in the genetic analysis method using guide RNA according to an embodiment of the present invention are shown.

First, referring to (a) of Figure 6a, the size of primer set 1 used in the gene analysis method using guide RNA according to an embodiment of the present invention is shown to be 164bp, and includes the sequences of SEQ ID NOs: 3 and 4. It appears to contain a primer that does. Additionally, the size of primer set 2 appears to be 144 bp and appears to include primers containing the sequences of SEQ ID NOs: 1 and 2.

Furthermore, referring to (b) of Figure 6a, both of the above-described primer sets showed band expression in the T790M positive patient sample (P1), indicating that they can be used in PCR as primers for measuring target DNA, that is, T790M. It can mean.

Accordingly, referring to Figure 6b, ddPCR results for primer sets 1 and 2 are shown. At this time, the x-axis represents the type of each sample in the ddPCR well, and the y-axis represents the fluorescence amplitude for each droplet. Furthermore, the horizontal line represents the threshold that separates positive and negative. At this time, the threshold is shown as 3000, but is not limited thereto and may vary depending on the experimental batch.

Furthermore, the expression level threshold for determining whether T790M is present may be 1 copy/reaction (ml) in ddPCR, but is not limited thereto. Therefore, if the measured expression level of T790M is more than 1 copy/reaction (ml), the individual is resistant to EGFR-TKI treatment and can be determined to be positive for T790M, and the measured expression level of T790M is 1 copy/reaction (ml) or more. If the reaction is less than (ml), the individual is not resistant to EGFR-TKI treatment and can be determined to be negative for T790M. In other words, ddPCR can detect DNA copies as small as 1, making it more sensitive than other conventional measurement methods.

At this time, ddPCR is a method of splitting a certain amount of sample into tens of thousands of droplets, amplifying them through PCR reaction, and then counting the targets. Each split droplet is displayed as positive (1) or negative (0) depending on whether or not the target is amplified, and the copy of the target can be calculated through Poisson distribution and expressed as the number of copies per sample.

Primer sets 1 and 2 in the T790M positive patient sample (P1) showed the expression of droplets at an amplitude of 6000 above the threshold, which means that the T790M positive patient sample can be determined positive in the PCR method with primer sets 1 and 2. It can mean.

Furthermore, primer sets 1 and 2 in normal control patient samples (control) showed the expression of droplets at an amplitude of 2000 below the threshold, which indicates that normal control patient samples were negative in the PCR method with primer sets 1 and 2. It can mean that it can be decided.

In other words, this may mean that primer sets 1 and 2 can accurately distinguish between positive and negative T790M based on a specific threshold through the PCR method.

Meanwhile, in the T790M positive patient sample (P1), primer set 1 appears to have generated a droplet rain phenomenon in the amplitude range of 4000 to 5000. A droplet lane may mean that the conditions for primers and PCR are not optimized, or an error phenomenon occurs when the droplet is broken due to physical factors.

Accordingly, the primer set used in the genetic analysis method using guide RNA according to an embodiment of the present invention may include both primer sets 1 and 2, but preferably the primer set that can provide the highest sensitivity and specificity. may be primer set 2 including SEQ ID NOs: 1 and 2 in which the droplet lane phenomenon does not occur.

Referring to FIGS. 7A and 7B, ddPCR results according to the dilution factor of the sample in the genetic analysis method using guide RNA according to an embodiment of the present invention are shown. At this time, in order to determine false positives and true positives for the genetic analysis method using guide RNA according to an embodiment of the present invention, the reference standard for T790M is set to SQI (Semi Quantitative Index). and compared. SQI is a semi-quantitative representation of the amount of mutant cell-free DNA (cfDNA) in a sample. Although it is not an absolute number, it allows for a relative comparison of the difference in the amount of mutant DNA that appears when measured consecutively in the same patient.

Furthermore, the measurement sample is target DNA concentrated by a genetic analysis method using guide RNA according to an embodiment of the present invention, and includes primer set 1 including SEQ ID NOs: 3 and 4 and SEQ ID NOs: 1 and 2. ddPCR was performed using primer set 2.

First, referring to FIG. 7A, the SQI in the 1-1 and 1-2 samples is shown to be 12.7, so the 1-1 and 1-2 samples appear to be positive for T790M.

However, samples 1-1 and 1-2 at 530 copies/ml in ddPCR were found to be negative for T790M, as samples 1-1 and 1-2 expressed droplets at an amplitude below the threshold (3253). appear.

Furthermore, the SQI in the 2-1 and 2-2 samples was found to be 17.2, indicating that the 2-1 and 2-2 samples were positive for T790M.

Additionally, samples 2-1 and 2-2 appear positive for T790M in ddPCR, as 2-1 and 2-2 samples at 12000 copies/ml express droplets at an amplitude above the threshold (3253). .

That is, when target DNA concentrated by the genetic analysis method using guide RNA according to an embodiment of the present invention is measured by ddPCR, it may be difficult to accurately measure the expression of target DNA due to various PCR inhibitor elements. . Accordingly, in the genetic analysis method using guide RNA according to an embodiment of the present invention, amplification efficiency can be improved by reducing the amount of elements such as inhibitors through dilution.

More specifically, referring to Figure 7b, the ddPCR results measured after diluting the sample in Figure 7a are shown.

In ddPCR, when the 1-1 and 1-2 samples of 530 copies/ml were diluted about 1000 times, the number of droplets (events) with amplitudes above the threshold (3253) was found to be 79 and 68, so 1- Samples 1 and 1-2 appear positive for T790M.

In other words, this may mean that through dilution, the problem of false positives and false negatives showing results different from the reference standard can be solved.

Furthermore, in samples 2-1 and 2-2, the number of droplets (events) with an amplitude greater than the threshold value (3253) appears to be the largest when diluted about 1000 times. In other words, this may mean that a dilution factor of about 1000 times can produce the most stable results in ddPCR measurement. Accordingly, the target DNA concentrated by the genetic analysis method using guide RNA for diagnosing EGFR mutations according to one embodiment may be used after being diluted about 100 times or more when it is intended to be detected through ddPCR, but is not limited thereto. The most preferred dilution factor may be about 1000 times.

Through the above process, the genetic analysis method using guide RNA for diagnosing EGFR mutations according to one embodiment can minimize errors in result values by optimizing primer and sample pretreatment (dilution) conditions, and measure target DNA more accurately. There is an effect that can be done.

Verification of the effect on first amplification (pre-amplification) in the genetic analysis method using guide RNA according to an embodiment of the present invention

Hereinafter, with reference to FIGS. 8A and 8B, the effect on first amplification will be verified in the gene analysis method using guide RNA according to an embodiment of the present invention. At this time, the measurement of ddPCR may be the second amplification step in the genetic analysis method using guide RNA according to an embodiment of the present invention, when the first amplification step is performed and the first amplification step is not performed. If not, concentrated target DNA samples were used.

Referring to FIG. 8A, when the first amplification (pre-amplification) is not performed, there appears to be no event for a droplet with an amplitude greater than the threshold value 2471.

In contrast, when the first amplification was performed, it appears that a large number of droplets with an amplitude greater than the threshold value (2471) were generated, regardless of the input concentration of the target DNA in the sample.

More specifically, referring to Figure 8b, it appears that the mutation copy number occurred at all DNA concentrations (concentration) of 2ng/μl, 1ng/μl, 0.4 ng/μl, and 0.2ng/μl, and the mutation rate (vaf, %) ) appears to be the same as 5.1.

According to the above results, it appears that the genetic analysis method using guide RNA according to an embodiment of the present invention can detect even a trace amount of 0.2ng/μl sample through first amplification. Furthermore, according to the above-mentioned results, it may mean that the target DNA to be measured was accurately collected through the first amplification and subsequent enrichment process of the present invention.

Furthermore, in the genetic analysis method using guide RNA according to an embodiment of the present invention, it appears that target DNA enrichment and detection by Cas9 and guide RNA are possible only when first amplification is performed. In other words, this may mean that Cas9 and guide RNA can specifically bind to the target DNA only when cfDNA containing the target DNA is included at a certain concentration or higher through the first amplification. Accordingly, the gene analysis method using guide RNA according to an embodiment of the present invention may require a first amplification step. However, in the genetic analysis method using guide RNA according to an embodiment of the present invention, when the first amplification step is not included, cfDNA containing the target DNA added in the mixing step is added at a certain concentration or higher. It can be done.

Confirmation of analysis performance of genetic analysis method using guide RNA according to an embodiment of the present invention

Hereinafter, with reference to FIGS. 9A to 9C, the analysis performance of the genetic analysis method using guide RNA according to an embodiment of the present invention will be verified.

First, referring to 9a, T790M was determined to be positive in the genetic analysis method (CRISPR-CPPC) using guide RNA according to an embodiment of the present invention, but was determined to be negative in the ddPCR analysis method. The total number of samples tested was 16, resulting in a false positive rate of 26.7%.

Furthermore, for T790M, the number of samples determined to be negative in the genetic analysis method (CRISPR-CPPC) using guide RNA according to an embodiment of the present invention, but positive in the ddPCR analysis method was a total of 2, resulting in a false negative rate. It appears to be 3.3%.

At this time, the analysis method using ddPCR, like the genetic analysis method using guide RNA according to an embodiment of the present invention, is not the gold standard for diagnosis, so comparison with other additional analysis methods may be necessary. there is.

Accordingly, referring to Figure 9b, additional analysis results of T790M for 18 patients showing the above-mentioned false positive and false negative rates are shown.

False negative samples Nos. 12 and 17 appear to be negative in the SQI analysis method in the same way as the genetic analysis method using guide RNA according to an embodiment of the present invention. That is, in samples 12 and 17, the genetic analysis method using guide RNA according to an embodiment of the present invention showed the same results as SQI, indicating that the result by the present invention may be a true negative, not a false negative. It can mean.

Furthermore, the false positive samples 21, 25, 31, 40, 43, 44, 55, and 56 appear to be negative in the SQI analysis method, but the clinical findings (clinical records and CT, MRIM PET-CT findings) are negative for T790M. This suggests that it may be benign. That is, in samples 21, 25, 31, 40, 43, 44, 55, and 56, the genetic analysis method using guide RNA according to an embodiment of the present invention showed the same results as the clinical findings, so according to the present invention This may mean that the result may be a true positive, not a false positive.

Accordingly, referring to FIG. 9C, the model performance evaluation results for the genetic analysis method using guide RNA according to an embodiment of the present invention are shown.

First, referring to (a) of Figure 9c, the analysis performance evaluation results for T790M in cfDNA of NSCLC patients undergoing first or second generation EGFR-TKI treatment are shown. The sensitivity of the genetic analysis method using guide RNA according to an embodiment of the present invention is 92.00%, which is higher than that of the analysis method using ddPCR, a conventional analysis method, and the accuracy appears to be the same.

Furthermore, referring to (b) of FIG. 9C, the analysis performance evaluation results for T790M according to clinical diagnosis are shown. The sensitivity of the genetic analysis method using guide RNA according to an embodiment of the present invention is 93.94%, which is higher than the analysis method using ddPCR, a conventional analysis method.

Moreover, specificity and accuracy are 100% and 96.67%, respectively, which appear to be higher than that of the analysis method using ddPCR, a conventional analysis method.

Accordingly, the genetic analysis method using guide RNA according to an embodiment of the present invention has higher sensitivity and specificity than the ddPCR analysis method, which is a conventional DNA detection method, and provides an improved detection method that can accurately measure target DNA. can do.

Ultimately, the genetic analysis method using guide RNA according to an embodiment of the present invention has a clinical diagnostic effect superior to that of conventional diagnostic methods, and thus is the gold standard in biomarker analysis such as drug selection and cancer diagnosis. can be used as a standard).

Although embodiments of the present invention have been described in more detail with reference to the accompanying drawings, the present invention is not necessarily limited to these embodiments, and may be modified and implemented in various ways without departing from the technical spirit of the present invention. Accordingly, the embodiments disclosed in the present invention are not intended to limit the technical idea of the present invention, but rather to explain it, and the scope of the technical idea of the present invention is not limited by these embodiments. Therefore, the embodiments described above should be understood in all respects as illustrative and not restrictive. The scope of protection of the present invention should be interpreted in accordance with the claims below, and all technical ideas within the equivalent scope should be construed as being included in the scope of rights of the present invention.

<110> Industry-Academic Cooperation foundation Yonsei University <120> METHOD FOR GENE ANALYSIS USING GUIDE RNA <130> DP-2021-0053 <160> 15 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 1 ctccaggaag cctacgtgat 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 2 gtctttgtgt tcccggacat 20 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 3 catgcgaagc cacactgac 19 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 4 cgggacatagt ccagggaggca 20 <210> 5 <211> 49 <212> DNA <213> homo sapiens <220> <221> mutation <222> (26) <223> C>T <400> 5 ctcacctcca ccgtgcagct catcatgcag ctcatgccct tcggctgcc 49 <210> 6 <211> 49 <212> DNA <213> homo sapiens <400> 6 gactggaggt ggcacgtcga gtagtgcgtc gagtacggga agccgacgg 49 <210> 7 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> forward sgRNA (single-chain guide RNA) primer <400> 7 atcatgcagc tcatgccc 18 <210> 8 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> reverse sgRNA (single-chain guide RNA) primer <400> 8 aagggcatga gctgcatgat 20 <210> 9 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> crRNA of sgRNA <400> 9 atcacgcagc tcatgccctt 20 <210> 10 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> crRNA of sgRNA <400> 10 ggcacgtcga gtagtgcgtc 20 <210> 11 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> crRNA of sgRNA <400> 11 acgtcgagta gtgcgtcgag 20 <210> 12 <211> 16 <212> RNA <213> Artificial Sequence <220> <223> forward sgRNA (single-chain guide RNA) primer <400> 12 ctgcatgatg agctgc 16 <210> 13 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> reverse sgRNA (single-chain guide RNA) primer <400> 13 ccgtgcagct catcatgcag 20 <210> 14 <211> 16 <212> RNA <213> Artificial Sequence <220> <223> forward sgRNA (single-chain guide RNA) primer <400> 14 gagctgcatg atgagc 16 <210> 15 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> reverse sgRNA (single-chain guide RNA) primer <400> 15 tgcagctcat catgcagctc 20

Claims (26)

Dual guide RNA (dual guide RNA) or sgRNA (single- chain guide RNA),
The sequence comprising the 790th region from exon 20 of the EGFR tyrosine kinase domain includes at least one nucleic acid sequence of 5'-GGC-3', 5'-CGG-3', and 5'-TGG-3'. Contains a protospacer adjacent motif (PAM),
Contains biotin bound to the 3' end,
A guide RNA for diagnosing EGFR mutations, which is synthesized by a third primer containing consecutive nucleotides of SEQ ID NO: 7 or 8. delete According to clause 1,
The sequence comprising the 790th region from exon 20 of the EGFR tyrosine kinase domain is,
Guide RNA for diagnosing EGFR mutation, which is at least one of SEQ ID NO: 5 or 6. delete According to clause 3,
The sequence comprising the 790th region from exon 20 of the EGFR tyrosine kinase domain is,
In the case of SEQ ID NO: 5,
A guide RNA for diagnosing EGFR mutations, in which the 26th nucleic acid from the 5'-end of the nucleic acid sequence for SEQ ID NO: 5 is changed from cytosine (C) to thymine (T). delete delete A genetic analysis kit for diagnosing an EGFR mutation, comprising the guide RNA according to any one of claims 1, 3, and 5. According to clause 8,
The kit is,
A genetic analysis kit comprising a guide RNA for diagnosing an EGFR mutation, including a second primer containing consecutive nucleotides of SEQ ID NO: 1 or 2. According to clause 8,
The kit is,
A genetic analysis kit comprising a guide RNA for diagnosing an EGFR mutation, further comprising a first primer containing consecutive nucleotides of SEQ ID NO: 3 or 4. According to clause 8,
The kit is,
A genetic analysis kit comprising a guide RNA for diagnosing an EGFR mutation, including a third primer containing consecutive nucleotides of SEQ ID NO: 7 or 8. A step of first amplifying cfDNA containing target DNA among cfDNA contained in a biological sample isolated from an individual;
Mixing cfDNA containing the amplified target DNA to form a complex with Cas9 protein and guide RNA;
Capturing target DNA from the mixed complex;
heating the complex to denature the Cas9 protein contained in the complex and elute the captured target DNA;
Enriching the target DNA by collecting only the eluted target DNA, and
Comprising a second amplification of the concentrated target DNA,
The guide RNA is a guide RNA according to any one of claims 1, 3, and 5. A genetic analysis method using guide RNA. According to clause 12,
The biological sample is,
A genetic analysis method using guide RNA, comprising at least one of the group consisting of blood, urine, pleural fluid, feces, sputum, peritoneal fluid, breast milk, cerebrospinal fluid, saliva, lymph fluid, and tracheal lavage fluid. According to clause 12,
The amplification is,
Performed by PCR,
The PCR is,
Reverse transcription polymerase chain reaction (RT-PCR), multiplex PCR, real-time PCR, Assembly PCR, Fusion PCR, Ligase chain reaction ; LCR) and ddPCR (Droplet-digital PCR), a genetic analysis method using guide RNA. According to clause 12,
The guide RNA is,
A genetic analysis method using guide RNA, which is a dual guide RNA (dual guide RNA) or sgRNA (single-chain guide RNA) containing crRNA (CRISPR RNA) made of polynucleotides. According to clause 15,
The guide RNA is,
Gene analysis method using guide RNA containing biotin bound to the 3' end. According to clause 12,
The Cas9 protein,
Streptococcus pyogenes Cas9 (SpCas9), Streptococcus thermophilus Cas9 (StCas9), Streptococcus pasteurianus (SpaCas9), Campylobacter jejuni Cas9 (CjCas9), Staphylococcus aureus (SaCas9), Francisella novicida Cas9 (FnCas9), Neisseria cinerea Cas9 (NcCas9), Neisseria ria meningitis Cas9 (NmCas9) Gene analysis method using guide RNA, at least one of Prevotella and Francisella 1 (Cpf1). According to clause 12,
The mixing step is,
Mixing the Cas9 protein and the guide RNA;
Adding the amplified cfDNA to the mixed Cas9 and guide RNA and mixing to form a complex, and
A genetic analysis method using guide RNA, comprising adding a magnetic bead complex to the complex. According to clause 18,
The magnetic bead complex,
Genetic analysis method using guide RNA, including at least one of avidin, streptavidin, and neutravidin. According to clause 18,
The magnetic bead complex,
A genetic analysis method using a guide RNA that binds to biotin bound to the 3' end of the guide RNA. According to clause 12,
The capturing step is,
A genetic analysis method using guide RNA, performed by magnetic sorting or flow cytometric sorting. According to clause 12,
The heating is
Genetic analysis method using guide RNA, performed at 60 to 70 ° C. According to clause 12,
The second amplification step is,
When the amplification is performed by ddPCR,
A genetic analysis method using guide RNA, comprising the step of diluting the concentrated target DNA. According to clause 23,
The dilution is,
A genetic analysis method using guide RNA, which is performed by diluting the concentrated target DNA more than 100 times in PCR reaction buffer. According to clause 12,
After the second amplification step,
A genetic analysis method using guide RNA, further comprising determining whether or not the target DNA is included, depending on the expression level of the target DNA. According to clause 25,
The determining step is,
When the amplification is performed by ddPCR and the copy/reaction (ml) value of the target DNA is 1 or more,
A genetic analysis method using guide RNA, comprising the step of determining that the individual contains the target DNA.