CN107964549A

CN107964549A - Target Chimeric antigen receptor of CD22 and application thereof

Info

Publication number: CN107964549A
Application number: CN201610913527.2A
Authority: CN
Inventors: 黄飞; 金涛; 王海鹰; 何凤; 史子啸
Original assignee: Shanghai Hrain Biotechnology Co Ltd
Current assignee: Shanghai Hengrun Dasheng biopharmaceutical Co.,Ltd.
Priority date: 2016-10-20
Filing date: 2016-10-20
Publication date: 2018-04-27
Anticipated expiration: 2036-10-20
Also published as: CN107964549B

Abstract

Chimeric antigen receptor the present invention relates to targeting CD22 and application thereof.Specifically, the present invention provides a kind of polynucleotide sequence, is selected from：(1) polynucleotide sequence of the coded sequence of the fragment of III containing extracellular domain and extracellular domain IV containing the coded sequence of sequentially connected anti-CD22 single-chain antibodies, the coded sequence of people's CD8 α hinge areas, the coded sequence of people's CD8 transmembrane regions, the coded sequence of people's 41BB intracellular regions, the coded sequence of people's CD3 ζ intracellular regions and optional EGFR；(2) complementary series of (1) described polynucleotide sequence.The present invention also provides relevant fusion protein, the carrier containing the coded sequence, and the purposes of the fusion protein, coded sequence, carrier.

Description

Target Chimeric antigen receptor of CD22 and application thereof

Technical field

The invention belongs to Chimeric antigen receptor field, and in particular to target Chimeric antigen receptor of CD22 and application thereof.

Background technology

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cell refers to repair through gene After decorations, specific purpose antigen, and the T cell of continuous activation amplification can be identified with MHC non-limiting ways.It is 2012 international thin Born of the same parents, which treat association annual meeting middle finger and go out biological immune cell therapy, has become operation, radiotherapy, the 4th kind for the treatment of tumour outside chemotherapy Means, and future tumors will be become and treat essential means.CAR-T cell adoptive therapies are that most clearly have in current cancer therapies The immunotherapeutic form of effect.Numerous studies show that CAR-T cells can effectively identify tumour antigen, cause specific anti- Tumor immune response, significantly improves the survival state of patient.

Chimeric antigen receptor (CAR) is the core component of CAR-T, assigns the non-dependent modes of T cell HLA and identifies that tumour resists Former ability, this enables the T cell by CAR transformations to identify wider mesh compared to nave T cell surface receptor TCR Mark.It is (logical that the basic engineering of CAR includes a tumor associated antigen (tumor-associated antigen, TAA) land Often derive from the scFV sections of monoclonal antibody antigen calmodulin binding domain CaM), an extracellular hinge area, a transmembrane region and an intracellular are believed Number area.The selection of target antigen for the specificity of CAR, validity and the genetic modification T cell security of itself all It is crucial determinant.

With Chimeric antigen receptor T cell (Chimeric Antigen Receptor-T cell, CAR-T), technology is not Disconnected development, CAR-T can mainly be divided into for four generations at present.

First generation CAR-T cells by extracellular land-single-chain antibody (single chain fragment variable, ScFV), transmembrane region (transmembrane region, TM) and intracellular signal area-immunoreceptor tyrosine activating motif (immunoreceptor tyrosine based activation motif, ITAM) is formed, and wherein Chimeric antigen receptor is each Part is connected by following form：scFv-TM-CD3ζ.Although first generation CAR it can be seen that some specific cytotoxicities, Have been found that curative effect is barely satisfactory when carrying out clinical test summary to it within 2006.Trace it to its cause is because first generation CAR-T Cell will soon exhaust that its persistence is very poor in patient body, so that CAR-T cells do not have enough time also touching largely Tumour cell when just this kind of CAR-T cell of apoptosis can excite antitumoral cytotoxic effect, but cell because Son secretion is fewer, but its survival period in vivo is shorter cannot excite lasting anti-tumor effect (Chimeric NKG2D- modified T cells inhibit systemic T-cell lymphoma growth in a manner Involving multiple cytokines and cytotoxic pathways, Cancer Res.2007,67 (22)： 11029-11036〕。

T cell activation signaling zone is still the hot spot of research in the optimization CAR designs of second generation CAR-T cells.T cell it is complete Full activation depends on the effect of dual signal and cell factor.Wherein the first signal is specific signals, and antigen submission is identified by TCR Antigenic Peptide-MHC the compounds of cell surface are started；Secondary signal is costimulatory signal.Early in 1998, there have been Two generation CAR (Finney HM etc., J Immunol., 1998；161(6)：2791-7).2nd generation CAR is added in intracellular signal peptide area One costimulatory molecules, i.e., be assembled into costimulatory signal inside CAR, preferably can provide work for CAR-T cells Change signal, can activate costimulatory molecules and intracellular signal at the same time after such CAR tumor cells, realize dual activation, T cell propagation secretion capacity and anti-tumor effect can be significantly improved.First T cell costimulatory signal acceptor studied in detail It is CD28, it can be combined with the B7 family members of target cell surface.The costimulation of CD28 can promote the propagation of T cell, IL- 2 synthesis and expression and the ability of enhancing T cell resistance apoptosis.Then there is CD134 (OX40) and 41BB (4-1BB) again Deng costimulatory molecules, to improve the cytotoxicity of T cell, proliferation activity, t cell response is maintained, extends the T cell time-to-live Deng.Such second generation CAR generates unexpected effect in subsequent clinical test, based on the second generation from 2010 The clinical report of CAR repeatedly triggers vibrations, and especially for recurrent, intractable patient ALL, its complete remission rate is up to More than 90%.

Third generation CAR signal peptides area integrates the costimulatory molecules of more than 2, can breed T cell continuous activation, cell Factor continuous release, the ability of T cell killing tumor cell is more notable, i.e., CAR of new generation can be obtained stronger antitumor Response.It is most typical be exactly U Pen Carl June under the action of CD28 stimulating factors and added the stimulation of a 41BB because Son.

The CAR-T cells of forth generation then add cell factor or costimulation ligand, such as four generation CAR can produce IL- 12, it can adjust the activation of immune microenvironment-increase T cell, while activating inherent immunity cell makes it play a role clearly Except the cancer cell of target antigen feminine gender, so as to have the function that bidirectional modulation (Chmielewski M, Abken H.TRUCKs：the Fourth generation of CARs, Expert Opin Biol Ther., 2015；15(8)：1145-54〕.

CD22 wide expressions are in the acute lymphatic leukaemia (BCP-ALL) of B cell precursor, in 111 case loads of research In have CD22 antigens all expressed in the initial cell of 109, expression rate is more than 90%.Lars Nitschke reports CD22 is subordinate to In sialic acid binding domain-immunoglobulin sample agglutinin (Siglecs, sialic acid-binding immunoglobulin- Like lectins) family.The albumen of this family is only expressed in the cell of immune system, all autoimmunities and acquired Cell type in immune system at least expresses a kind of Siglecs family proteins.B cell expresses the member of two this families, One of them is exactly CD22, another is Siglec-G.The suppression that most of Siglecs is relied on tyrosine immunity receptor Structure (ITIMs, immunoreceptor tyrosine-based inhibitory motifs) processed, negative tune is carried out to immune Section.Tyrosine on ITIMs generates some and contains SH2 (Src homology after Src family protein tyrosine phosphorylations 2) binding site of domain molecule.SHP1 (SHP, SH2-domain containing protein tyrosine Phosphatase) and the mostly important SH2 domains of SHP2 contain albumen, these albumen are enrolled into the acceptor containing ITIMs Afterwards, the dephosphorylation of intracellular matter can be caused and suppress several signal paths.For example CD22 is exactly by the way that SHP-1 is recruited Believe to the ITIMs of itself so as to suppress calcium ion caused by the BCR (B-cell receptor, B-cell receptor) of normal B cells Number path.CD22 combines the ligand with α 2-6 coupling sialic acids.This combination directly adjust the combination of CD22 and BCR from And regulate and control the suppression function of CD22, the migration of B cell and the threshold value of BCR signals can be regulated and controled.

Nitscheke report CD22 length is 140kDa, possesses seven immunoglobulin like domain, specific expression In B cell system, expressed since pre B cell (pre-B cell) period.CD22 is present in each period of B cell, including swashs B cell living and memory B cell；The but loss of expression in the thick liquid cell of terminal differentiation.CD22 is in the developing wide spectrum of B cell Expression, becomes the molecule of a very attractive targeting B cell.

In fact, CD22 treatment antibodies have been synthesized and applied to one of clinics, David J. reports Epratuzumab is successfully applied to be clinically used for treatment non-Hodgkin lymphoma and systemic immune disease such as generalized erythema Lupus.The immunotoxin for the coupling CD22 antibody that Alan S. reports are directed to CD22 at the same time is also used clinically for treating acute Lymphoma leukemia, and achieve certain validity.The immunotoxin of Mansfield E report targeting B cells (Immunotoxin) it has been successfully used in the treatment of B cell leukemia and lymthoma.These researchs all illustrate to pass through targeting CD22 treats the feasibility and security of B cell lymphoma, will not produce the adverse consequences that undershooting-effect is brought.

The long-term existence of CD22CAR T cells is both advantageous and disadvantageous, and profit is there is monitoring effect to disease, and disadvantage is to cause The long-term defect of B cell.Except CAR possessed signal domains in itself, other factors can also influence CAR T there are when Between, such as the mode of cell culture system, gene transfer, the promoter of gene expression, the function and phenotype for being transfused T cell, These also can all be influenced be subject to patient age, illnesses type and the treatment means that have received.The one of CAR-T cells is big excellent Point is that they are active medicines, once input, the balance of physiological mechanism meeting modulating T cell, memory are formed and the expansion of antigen driving Increase.However, this treatment is not perfect enough, T cell can miss the target and attack other tissues, or amplification amount is excessive, beyond treatment institute Need.In view of CAR-T cells have been included into standard care scope, patient or the controllable startup of medicine or shutdown mechanism are designed to regulate and control The presence of CAR-T cells is highly useful.Due to technical reason, shutdown mechanism is more easy to be applied to T cell.As wherein it One, iCas9 system are just among clinical research.Cell is when expressing iCas9, before can induce iCas9 using micromolecular compound Body molecule forms dimer, apoptosis pathway is activated, so as to fulfill the purpose of scavenger-cell.In graft versus host disease(GVH disease), small point Sub- AP1903 has been used for inducing iCas9 dimers and removes T cell, indicates the feasibility (Making of this method Better Chimeric Antigen Receptors for Adoptive T-cell Therapy.Clin Cancer Res.2016Apr15；22(8):1875-84).

The content of the invention

First aspect present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from：

(1) containing the coded sequence of sequentially connected anti-CD22 single-chain antibodies, the coded sequence of people's CD8 α hinge areas, people The coded sequence of CD8 transmembrane regions, the coded sequence of people's 41BB intracellular regions, the coded sequence of people's CD3 ζ intracellular regions and optional EGFR III containing extracellular domain and extracellular domain IV fragment coded sequence polynucleotide sequence；With

(2) complementary series of (1) described polynucleotide sequence.

In one or more embodiments, coded sequence of the polynucleotide sequence in the anti-CD22 single-chain antibodies The preceding also coded sequence containing signal peptide.In one or more embodiments, the amino acid sequence such as SEQ of the signal peptide ID NO:Shown in 2 1-21 amino acids.In one or more embodiments, the weight chain variable of the anti-CD22 single-chain antibodies The amino acid sequence in area such as SEQ ID NO:Shown in 2 22-145 amino acids.It is described anti-in one or more embodiments The amino acid sequence of the light chain variable region of CD22 single-chain antibodies such as SEQ ID NO:Shown in 2 161-267 amino acids.At one Or in multiple embodiments, the amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:2 268-314 amino acids institutes Show.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the people CD8 transmembrane regions:2 315-336 Shown in amino acid.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the people 41BB intracellular regions:2 Shown in 337-384 amino acids.In one or more embodiments, the amino acid sequence such as SEQ of the people CD3 ζ intracellular regions ID NO:Shown in 2 385-495 amino acids.In one or more embodiments, the fragment of the EGFR contains EGFR's Extracellular domain III, extracellular domain IV and transmembrane region, or by the extracellular domain III of EGFR, extracellular domain IV and Transmembrane region forms.In one or more embodiments, the fragment of the EGFR contains the 310-646 amino acids of Human epidermal growth factor receptor Sequence, or be made of the 310-646 amino acids sequences of Human epidermal growth factor receptor.In one or more embodiments, the EGFR's The amino acid sequence of fragment such as SEQ ID NO:Shown in 2 544-878 amino acids.In one or more embodiments, institute Coded sequence of the polynucleotide sequence also containing GM-CSF receptor alpha chain signal peptides is stated, the GM-CSF receptor alpha chains signal peptide is set In the N-terminal of the EGFR fragments.In one or more embodiments, the amino acid sequence of the GM-CSF receptor alpha chains signal peptide Row such as SEQ ID NO:Shown in 2 522-543 amino acids.In one or more embodiments, the polynucleotide sequence Also containing the coded sequence for connecting the GM-CSF receptor alpha chains signal peptide and the joint sequence of the people CD3 ζ intracellular regions.One In a or multiple embodiments, the amino acid sequence such as SEQ ID NO of the joint sequence:2 496-521 amino acids institutes Show.

In one or more embodiments, the signal peptide before the coded sequence of the anti-CD22 single-chain antibodies Coded sequence such as SEQ ID NO:Shown in 1 1-63 nucleotide sequences.In one or more embodiments, the anti-CD22 The coded sequence of the heavy chain variable region of single-chain antibody such as SEQ ID NO:Shown in 1 64-435 nucleotide sequences.At one or In multiple embodiments, the coded sequence such as SEQ ID NO of the light chain variable region of the anti-CD22 single-chain antibodies:1 481-801 Shown in the nucleotide sequence of position.In one or more embodiments, the coded sequence such as SEQ ID of the people CD8 α hinge areas NO:Shown in 1 802-942 nucleotide sequences.In one or more embodiments, the code sequence of the people CD8 transmembrane regions Row such as SEQ ID NO:Shown in 1 943-1008 nucleotide sequences.In one or more embodiments, the people 41BB born of the same parents The coded sequence of inner region such as SEQ ID NO:Shown in 1 1009-1152 nucleotide sequences.In one or more embodiments In, the coded sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 1 1153-1485 nucleotide sequences.At one Or in multiple embodiments, connect the joint sequence of the GM-CSF receptor alpha chains signal peptide and the people CD3 ζ intracellular regions Coded sequence such as SEQ ID NO:Shown in 1 1486-1563 nucleotide sequences.In one or more embodiments, institute State the coded sequence such as SEQ ID NO of GM-CSF receptor alpha chain signal peptides:Shown in 1 1564-1629 nucleotide sequences.One In a or multiple embodiments, the coded sequence such as SEQ ID NO of the fragment of the EGFR:1 1630-2634 nucleotides sequences Shown in row.In one or more embodiments, the polynucleotide sequence coding such as SEQ ID NO:2 shown in 1-495 Amino acid sequence, or such as SEQ ID NO:2 amino acid sequence shown in 22-495, or coding such as SEQ ID NO:2 Amino acid sequence shown in 22-878, or coding such as SEQ ID NO:Amino acid sequence shown in 2.Implement in one or more In scheme, the polynucleotide sequence contains SEQ ID NO:1、SEQ ID NO:1 nucleotide sequence shown in 1-1485, SEQ ID NO:1 nucleotide sequence or SEQ ID NO shown in 64-1485:1 nucleotides sequence shown in 64-2634 Row, or by SEQ ID NO:1、SEQ ID NO:1 nucleotide sequence, the SEQ ID NO shown in 1-1485:1 64-1485 Nucleotide sequence or SEQ ID NO shown in position:The 1 nucleotide sequence composition shown in 64-2634.

Second aspect of the present invention provides a kind of fusion protein, and the fusion protein is selected from：

(1) containing sequentially connected anti-CD22 single-chain antibodies, people CD8 α hinge areas, people CD8 transmembrane regions, people's 41BB intracellular regions With people's CD3 ζ intracellular regions and the fusion protein of the fragment of the III containing extracellular domain and extracellular domain IV of optional EGFR；With

(2) by substituting, lacking or add one or several amino in the amino acid sequence for the fusion protein that (1) limits Acid and the fusion protein as derived from (1) for retaining activating T cell activity；

Preferably, the anti-CD22 single-chain antibodies are Anti-CD22 monoclonal antibody 32716.

In one or more embodiments, the fusion protein also contains letter in the N-terminal of the anti-CD22 single-chain antibodies Number peptide.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the signal peptide:2 1-21 amino acids It is shown.In one or more embodiments, the amino acid sequence such as SEQ of the heavy chain variable region of the anti-CD22 single-chain antibodies ID NO:Shown in 1 22-145 amino acids.In one or more embodiments, the light chain of the anti-CD22 single-chain antibodies can The amino acid sequence for becoming area can be such as SEQ ID NO:Shown in 1 161-267 amino acids.In one or more embodiments, The amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 1 268-314 amino acids.One or more real Apply in scheme, the amino acid sequence such as SEQ ID NO of the people CD8 transmembrane regions:Shown in 1 315-336 amino acids.At one Or in multiple embodiments, the amino acid sequence such as SEQ ID NO of the people 41BB intracellular regions:1 337-384 amino acids institute Show.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:1 385-495 Shown in amino acids.In one or more embodiments, the fragment of the EGFR contains extracellular domain III, the born of the same parents of EGFR Extracellular portion IV and transmembrane region, or be made of the extracellular domain III, extracellular domain IV and transmembrane region of EGFR.One In a or multiple embodiments, the EGFR fragments contain the 310-646 amino acids sequences of Human epidermal growth factor receptor, or by Human epidermal growth factor receptor 310-646 amino acids sequence forms.In one or more embodiments, the amino acid sequence of the EGFR fragments is such as SEQ ID NO:Shown in 1 544-878 amino acids.In one or more embodiments, the fusion protein also contains GM- CSF receptor alpha chain signal peptides, the GM-CSF receptor alpha chains signal peptide are arranged at the N-terminal of the EGFR fragments.In one or more In embodiment, the amino acid sequence such as SEQ ID NO of the GM-CSF receptor alpha chains signal peptide:2 522-543 amino acids It is shown.In one or more embodiments, the fusion protein is also containing the connection GM-CSF receptor alpha chains signal peptide and institute State the joint sequence of people's CD3 ζ intracellular regions.In one or more embodiments, the amino acid sequence such as SEQ of the joint sequence ID NO:Shown in 2 496-521 amino acids.In one or more embodiments, the amino acid sequence of the fusion protein Such as SEQ ID NO:Shown in 2 22-495 amino acids or such as SEQ ID NO:Shown in 2 22-878 amino acids, or such as SEQ ID NO:Shown in 2.

Third aspect present invention provides a kind of nucleic acid constructs, and the nucleic acid constructs contains polynucleotides as described herein Sequence.

In one or more embodiments, the nucleic acid constructs is carrier.In one or more embodiments, institute It is retroviral vector to state nucleic acid constructs, contains replication origin, 3 ' LTR, 5 ' LTR, pis packaging signals, marmot Hepatitis viruse posttranscriptional regulatory element, polynucleotide sequence as described herein, and optional selectable mark.

Fourth aspect present invention provides a kind of retrovirus, and the retrovirus contains nucleic acid construct as described herein Thing, preferably comprises the carrier, further preferably described retroviral vector.

Fifth aspect present invention provides a kind of T cell of genetic modification, and the cell contains polynucleotides as described herein Sequence, or containing nucleic acid constructs as described herein, or retrovirus as described herein has been infected, or stablize expression this paper institutes The fragment of fusion protein and the III containing extracellular domain of optional EGFR, extracellular domain IV and the optional transmembrane region stated.

Sixth aspect present invention provides a kind of pharmaceutical composition of the T cell containing genetic modification as described herein.

Seventh aspect present invention provides polynucleotide sequence, fusion protein, nucleic acid constructs or reverse transcription as described herein Application of the virus in the T cell for preparing activation.

Eighth aspect present invention offer polynucleotide sequence as described herein, fusion protein, nucleic acid constructs, reverse transcription disease The purposes of poison or the T cell of genetic modification or its pharmaceutical composition in the medicine of disease for the treatment of CD22 mediations is prepared.

In one or more embodiments, the disease of the CD22 mediations is non-Hodgkin lymphoma and acute lymphoma Leukaemia.

Brief description of the drawings

Fig. 1 is RV-CD22-BBz retrovirus expression vector schematic diagrames.SP：Signal peptide；VL：Light chain variable region；Lk： Connector (G4S) 3；VH：Heavy chain variable region；H：CD8 α hinge areas；TM：CD8 transmembrane regions；WPRE：For improving virus transcription thing The groundhog hepatitis virus posttranscriptional regulatory element of stability.

Fig. 2 is the part sequencing result peak value figure of RV-CD22-BBz retrovirus expression plasmids.

Fig. 3 is RV-CD22-BBz-tEGFR retrovirus expression vector schematic diagrames.SP：Signal peptide；VL：Light chain variable Area；Lk：Connector (G4S) 3；VH：Heavy chain variable region；H：CD8 α hinge areas；TM：CD8 transmembrane regions；2A：P2A peptides；WPRE：Marmot Hepatitis viruse posttranscriptional regulatory element.

Fig. 4 is the part sequencing result peak value figure of RV-CD22-BBz-tEGFR retrovirus expression plasmids.

Fig. 5 is CD22-BBz-tEGFR CART expression when FCM results show retroviral infection T cell 72 is small Efficiency.

Fig. 6 expresses for FCM results show target cell CD22.

CD107a is expressed when Fig. 7 is CD22-BBz-tEGFR CART cells and the small target cell co-cultivation 5 for preparing 5 days.

The secretion of INF γ when Fig. 8 is CD22-BBz-tEGFR CART cells and the small target cell co-cultivation 5 for preparing 5 days.

To tumour cell after when Fig. 9 is CD22-BBz-tEGFR CART cells and the small target cell co-cultivation 5 for preparing 5 days Lethal effect.

Embodiment

The present invention provides a kind of Chimeric antigen receptor (CAR) of targeting CD22.It is mono- that the CAR contains sequentially connected anti-CD22 Chain antibody, people CD8 α hinge areas, people CD8 transmembrane regions, people 41BB intracellular regions, people's CD3 ζ intracellular regions and optional EGFR containing extracellular The fragment of Domain III and extracellular domain IV.

Various Anti-CD22 monoclonal antibodies well known in the art can be derived from by being suitable for the invention anti-CD22 single-chain antibodies. Optionally, the heavy chain variable region and light chain variable region can be linked together by joint sequence.What can be illustrated is this kind of single-stranded anti- Body includes but not limited to clone number single-chain antibody for being HA22, BL22 and m971.In certain embodiments, the monoclonal resists Body is the monoclonal antibody that clone number is m971.In certain embodiments, the heavy chain variable region of the anti-CD22 single-chain antibodies Amino acid sequence such as SEQ ID NO:Shown in 2 22-145 amino acids residues.In other embodiments, it is described anti- The amino acid sequence of the light chain variable region of CD22 single-chain antibodies such as SEQ ID NO:Shown in 2 161-267 amino acids residues.

The amino acid sequence for being suitable for the invention people's CD8 α hinge areas can be such as SEQ ID NO:2 268-314 bit aminos Shown in acid.

It can be commonly used in the art in the various people CD8 transmembrane domains of CAR to be suitable for the invention people CD8 transmembrane regions. In certain embodiments, the amino acid sequence of the people CD8 transmembrane regions such as SEQ ID NO:2 315-336 amino acids institutes Show.

It can be the various 41BB for CAR known in the art to be suitable for the invention 41BB.As illustrative example, The present invention uses SEQ ID NO:41BB shown in 2 337-384 amino acids sequences.

It can be various people CD3 ζ intracellular regions of this area conventionally used for CAR to be suitable for the invention people's CD3 ζ intracellular regions. In certain embodiments, the amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:2 385-495 amino acids institutes Show.

The each part mentioned above of the fusion protein of the present invention is formed, such as the light chain variable region of anti-CD22 single-chain antibodies and heavy chain can Become area, people CD8 α hinge areas, people CD8 transmembrane regions, 41BB and people's CD3 ζ intracellular regions etc., can be directly connected between each other, Huo Zheke Connected by joint sequence.Joint sequence can be the joint sequence suitable for antibody well known in the art, such as containing G's and S Joint sequence.In general, connector contains the front and rear motif repeated of one or more.For example, the motif can be GGGS, GGGGS, SSSSG, GSGSA and GGSGG.Preferably, which is adjacent that amino acid is not inserted between repetition in joint sequence Residue.Joint sequence can include 1,2,3,4 or 5 repetition motif and form.The length of connector can be that 3~25 amino acid are residual Base, such as 3~15,5~15,10~20 amino acid residues.In certain embodiments, joint sequence is more glycine linlcers Sequence.The quantity of glycine is not particularly limited in joint sequence, usually 2~20, such as 2~15,2~10,2~8.Remove Glycine and serine come, and also contain other known amino acid residue in connector, for example, alanine (A), leucine (L), Threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q) etc..As an example, connector can be by SEQ ID NO:Any amino acid sequence composition in 7-18.In certain embodiments, the light chain of the anti-CD22 single-chain antibodies of the present invention can Become between area and heavy chain variable region by (GGGGS)_nConnection, wherein n are 1~5 integer.

In certain embodiments, the amino acid sequence of CAR of the present invention such as SEQ ID NO:2 22-495 amino acids institutes Show or such as SEQ ID NO:Shown in 2 1-495 amino acids.In certain embodiments, the amino acid sequence of CAR of the invention In also III containing extracellular domain and extracellular domain IV comprising EGFR as described below fragment, its signal peptide and connect Header sequence.Therefore, in certain embodiments, the amino acid sequence of CAR of the invention such as SEQ IDNO:2 22-878 ammonia Shown in base acid, or such as SEQ ID NO:Shown in 2.

It is to be understood that in gene cloning operation, it is often necessary to design suitable restriction enzyme site, this certainly will be in expressed ammonia Base acid sequence end introduces one or more incoherent residues, and this has no effect on the activity of aim sequence.In order to build Fusion protein, the expression for promoting recombinant protein, obtain the automatic recombinant protein being secreted into outside host cell or beneficial to recombinant protein Purifying, it is often necessary to by some amino acid added to other suitable in the N- ends of recombinant protein, C- ends or the albumen In region, it may for example comprise but be not limited to, suitable joint peptide, signal peptide, leader peptide, end extension etc..Therefore, it is of the invention The aminoterminal or c-terminus of fusion protein (i.e. described CAR) can also contain one or more polypeptide fragments, as protein tag.Appoint What suitable label may be used to herein.For example, the label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out albumen pure Change.

The present invention also includes SEQ ID NO:CAR, SEQ ID NO shown in 2 22-495 amino acids sequences:2 22- CAR, SEQ ID NO shown in 878 amino acids sequences:CAR or SEQ ID NO shown in 2 1-495 amino acids sequences:2 The mutant of shown CAR.These mutant include：Have at least 80%, preferably at least 85% with the CAR, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence thereto simultaneously retain the biological activity of the CAR (as activation T is thin Born of the same parents) amino acid sequence.The sequence thereto between the sequence of two comparisons can be calculated using the BLASTp of such as NCBI.

Mutant further includes：In SEQ ID NO:2 amino acid sequence, the SEQ ID NO shown in 22-495:2 22- Amino acid sequence, SEQ ID NO shown in 878:2 amino acid sequence or SEQ ID NO shown in 1-495:Shown in 2 There is one or several mutation (insertion, deletion or substitution) while the biological activity that still retains the CAR in amino acid sequence Amino acid sequence.Several mutation are often referred within 1-10, such as 1-8,1-5 or 1-3.Substitution is preferably Conservative replaces.For example, in the art, when carrying out conservative replaces with similar nature or similar amino acid, usually will not Change the function of protein or polypeptide." similar nature or similar amino acid " is included for example, the amino acid with similar side chain The family of residue, these families include the amino acid (such as lysine, arginine, histidine) with basic side chain, with acid Property side chain amino acid (such as aspartic acid, glutamic acid), there is amino acid (such as the sweet ammonia of uncharged polar side chain Acid, asparagine, glutamine, serine, threonine, tyrosine, cysteine), have non-polar sidechain amino acid (example Such as alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), there is β-branch side The amino acid (such as threonine, valine, isoleucine) of chain and amino acid (such as tyrosine, phenylpropyl alcohol with aromatic side chain Propylhomoserin, tryptophan, histidine).Therefore, in polypeptide of the present invention one is replaced with another amino acid residue from the same side chain class A or several sites, will not be in substantially influences its activity.

The present invention includes encoding the polynucleotide sequence of fusion protein of the present invention.The present invention polynucleotide sequence can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be it is single-stranded or Double-strand.DNA can be coding strand or noncoding strand.The present invention also includes the degeneracy of the polynucleotide sequence of encoding fusion protein Variant, that is, encode identical amino acid sequence but the different nucleotide sequence of nucleotide sequence.

Polynucleotide sequence as described herein can usually use PCR amplification method to obtain.Specifically, can be public according to institute herein The nucleotide sequence opened, especially open reading frame sequence design primer, and with commercially available cDNA storehouses or by art technology CDNA storehouses prepared by conventional method known to personnel expand as template and obtain related sequence.When sequence is longer, usually need Twice or multiple PCR amplification, then each fragment amplified is stitched together by proper order again.For example, In some embodiments, the polynucleotide sequence such as SEQ ID NO of fusion protein described herein are encoded:1 64-1485 nucleosides Shown in acid, or such as SEQ ID NO:Shown in 1 1-1485 nucleotide.

In certain embodiments, the nucleotides sequence of the fragment of polynucleotide sequence of the invention also comprising coding EGFR Row.

It can be EGFR well known in the art to be suitable for the invention EGFR, such as the EGFR from people.EGFR contains N ends End extracellular domain I and II, extracellular domain III, extracellular domain IV, transmembrane region, membrane-proximal region domain and tyrosine-kinase Enzyme domains.Present invention preferably uses truncated EGFR (" tEGFR ", i.e., the fragment of EGFR as described herein), do not wrap especially Include the truncated EGFR of its intracellular region (membrane-proximal region domain and tyrosine kinase domain).In certain embodiments, also Further can further be truncated to the EGFR for not including intracellular region does not include extracellular domain I and II.Therefore, some In embodiment, extracellular domain III, extracellular domain IV and transmembrane region that the tEGFR of the invention used contains EGFR, or It is made of the extracellular domain III, extracellular domain IV and transmembrane region of EGFR.In certain embodiments, the tEGFR contains There are the 310-646 amino acids sequences of Human epidermal growth factor receptor, or be made of the 310-646 amino acids sequences of Human epidermal growth factor receptor, wherein the 310-480 amino acids sequence is the extracellular domain IV of Human epidermal growth factor receptor for the extracellular domain III, 481-620 of Human epidermal growth factor receptor, the 621-646 amino acids are the transmembrane region of Human epidermal growth factor receptor.In certain embodiments, the extracellular knot of the amino acid sequence of the tEGFR Structure domain III and IV such as SEQ ID NO:Amino acid sequence shown in 2 544-855 amino acids.In certain embodiments, institute State the transmembrane domain such as SEQ ID NO of tEGFR:Shown in 2 856-878 amino acids.

To promote the expression of tEGFR, also targeting sequencing can be set in its N-terminal.In certain embodiments, the present invention uses Signal peptide from GM-CSF acceptors (" GMCSFR ") α chains.In certain embodiments, the amino acid sequence of the signal peptide is such as SEQ ID NO:Shown in 2 522-543 amino acids.

In addition, can be by the coded sequences of P2A polypeptides by the coded sequence of the signal peptide and tEGFR and the present invention The coded sequence of people CD3 ζ intracellular regions is connected in CAR.In one or more embodiments, the amino acid sequence of the P2A peptides Such as SEQ ID NO:Shown in 2 496-521 amino acids.

Therefore, in certain embodiments, polynucleotide sequence of the invention contains the coded sequence of CAR of the present invention, P2A The coded sequence of polypeptide, the coded sequence of signal peptide and the coded sequence of tEGFR from GM-CSF receptor alpha chains.Some In embodiment, the sequence such as SEQ ID NO of polynucleotides of the present invention:Shown in 1 64-2634 nucleotide, or such as SEQ ID NO:Shown in 1.

The present invention also relates to nucleic acid constructs, which contains polynucleotide sequence as described herein, Yi Jiyu One or more regulating and controlling sequences of these series of operations connection.Polynucleotide sequence of the present invention can in many ways by Operate to ensure the expression of the fusion protein (CAR and/or tEGFR).Can basis before nucleic acid constructs is inserted into carrier Difference or the requirement of expression vector and nucleic acid constructs is operated.Change polynucleotide sequence using recombinant DNA method Technology be known in the art.

Regulating and controlling sequence can be suitable promoter sequence.Promoter sequence is usually grasped with the coded sequence of albumen to be expressed The property made connection.Promoter can be that any nucleotide sequence of transcriptional activity is shown in selected host cell, including prominent Become, truncated and hybrid promoter, and can be from coding and the homologous or heterologous extracellular or intracellular polypeptide of the host cell Gene obtain.Regulating and controlling sequence can also be suitable transcription terminator sequences, be identified by host cell to terminate the sequence of transcription Row.3 ' end effectors of nucleotide sequence of the terminator sequence with encoding the polypeptide are connected.Have in the host cell of selection Any terminator of function can be used in the present invention.Regulating and controlling sequence can also be suitable targeting sequencing, to host cell translation The non-translational region of important mRNA.5 ' ends of nucleotide sequence of the targeting sequencing with encoding the polypeptide are operatively connected.Selecting Functional any terminator can be used in the present invention in the host cell selected.

In certain embodiments, the nucleic acid constructs is carrier.Usually pass through the more of the present invention that are operably connected Nucleotide sequence is incorporated to expression vector to promoter, and by construct, realizes the expression of polynucleotide sequence of the present invention.The carrier Can be suitable for replicating and integrating eukaryotic.Typical cloning vector, which includes to can be used for adjusting, it is expected nucleotide sequence expression Transcription and translation terminator, homing sequence and promoter.

The polynucleotide sequence of the present invention can be cloned into the carrier of many types.For example, plasmid, phagocytosis can be cloned into Grain, phage-derived thing, animal virus and clay.Further, carrier is expression vector.Expression vector can be with viral vector Form is supplied to cell.Viral vector technology be well known in the present art and such as Sambrook (2001, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, New York) It is described with other virology and molecular biology manual.The virus that can be used as carrier includes but not limited to reverse transcription disease Poison, adenovirus, adeno-associated virus, herpesviral and slow virus.

In general, suitable carrier is included in the replication orgin to work at least one organism, promoter sequence, conveniently Restriction enzyme sites and one or more selectable mark (for example, WO 01/96584；WO01/29058；And U.S. Patent number 6,326,193)。

For example, in certain embodiments, the present invention uses retroviral vector, which contains multiple Initiation site processed, 3 ' LTR, 5 ' LTR, pis packaging signals, groundhog hepatitis virus posttranscriptional regulatory element, multiple cloning sites, this Polynucleotide sequence described in text, and optional selectable mark.

One example of suitable promoter is instant early stage cytomegalovirus (CMV) promoter sequence.The promoter sequence Row are can to drive the strong constitutive promoter sequence for being operably coupled to any polynucleotide sequence high level expression thereon Row.Another example of suitable promoter is -1 α of the elongation growth factor (EF-1 α).It is also possible, however, to use other composing types open Promoter sequences, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer viral (MMTV), people are immunized scarce It is instant to fall into long end repetition (LTR) promoter of virus (HIV), MoMuLV promoters, avian leukosis virus promoter, Epstein-Barr virus Early promoter, Rous sarcoma virus promoter and people's gene promoter, such as, but not limited to actin promoter, Myosin promoter, ferroheme promoter and creatine kinase promoter.Further, also contemplate for starting using induction type Son.The use of inducible promoter provides molecular switch, it can open the induction type that is operably connected when date slip reaches The expression of the polynucleotide sequence of promoter, and expression is being closed when expression is undesirable.The example of inducible promoter Including but not limited to metallothionein promoter, Glucocorticoid promoter, progesterone promoter and tetracycline promoter.

In order to assess the expression of CAR polypeptides or part thereof, selectable mark can also be included by being introduced into the expression vector of cell Any one in gene or reporter or both is remembered, in order to from the cell mass sought to be transfected by viral vector or infected Middle identification and selection expression cell.In other respects, selectable mark can be carried on independent section of DNA and be used for corotation Contaminate program.The flank of both selectable mark and reporter can all have appropriate regulatory sequence, so as in host Expressed in cell.Useful selectable marker includes such as antibiotics resistance gene, such as neo etc..

Reporter is used for the cell for identifying potential transfection and the feature for evaluating regulatory sequence.DNA by After introducing recipient cell, the expression of reporter is measured under the suitable time.Suitable reporter may include to encode Luciferase, beta galactosidase, chloramphenicol acetyltransferase, the base of secreted alkaline phosphatase or Green Fluorescent Protein gene Cause.Suitable expression system is known and prepares using known technology or commercially obtain.

The method that gene is introduced cell and gene expression is entered to cell is well known in the art.Carrier can by Any method in this area is easily introduced into host cell, for example, mammal, bacterium, yeast or insect cell.For example, Expression vector can be transferred to host cell by physics, chemistry or biological means.

Polynucleotides are introduced to the physical method of host cell includes calcium phosphate precipitation, lipofection, particle bombardment, micro- Injection, electroporation etc..The biological method that polynucleotides interested are introduced to host cell includes the use of DNA and RNA loads Body.Polynucleotides are introduced to the chemical means of host cell includes dispersion system of colloid, such as macromolecular complex, nanometre glue Capsule, microballoon, pearl；With the system based on lipid, including oil in water emulsion, micella, mixed micelle and liposome.

The biological method that polynucleotides are introduced to host cell includes the use of viral vector, particularly retrovirus vector Body, this has become the most widely used method by gene insertion mammal such as people's cell.Other viral vectors can source From slow virus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus etc..Many has been developed based on virus System, for gene transfer to be entered mammalian cell.For example, retrovirus provides the convenience for gene delivery system Platform.By the gene insertion vector of selection and retroviral particle is packaged into using technology as known in the art.Should Recombinant virus then can be separated and be transferred in vivo or in vitro subject cell.Many retroviral systems are in the art It is known.In some embodiments, using adenovirus vector.Many adenovirus vectors are well known in the art. In one embodiment, slow virus carrier is used.

Therefore, in certain embodiments, the present invention also provides the retrovirus for activating T cell, the virus to contain There are retroviral vector as described herein and corresponding packaging gene, such as gag, pol and vsvg.

It is suitable for the invention various types of T cells that T cell can be various sources.For example, T cell can derive from The PBMC of B cell malignant tumor patient.

In certain embodiments, can be first with suitable (such as 30~80ng/ml, such as 50ng/ml) after obtaining T cell CD3 antibody stimulate activation, then containing suitable (such as 30~80IU/ml, such as 50IU/ml) IL2 culture mediums carry out Cultivate spare.

Therefore, in certain embodiments, the present invention provides a kind of T cell of genetic modification, the T cell of the genetic modification Containing polynucleotide sequence as described herein, or containing retroviral vector as described herein, or infect as described herein Retrovirus, or be prepared using method described herein, or stablize and express fusion protein as described herein and optional tEGFR。

The CAR-T cells of the present invention can undergo firm internal T cell and extend and be held in blood and marrow with high level Continue extended time quantum, and form specific memory T cell.Be not intended to by it is any it is specific theoretical fetter, run into and with Afterwards eliminate expression Surrogate antigen target cell after, CAR-T cells of the invention can differentiation in vivo into center remember sample state.

Present invention additionally comprises a kind of cell therapy, wherein T cell by genetic modification with express CAR as described herein and optionally TEGFR, and CAR-T cells be injected into need its recipient in.The cell of injection can kill the tumour cell of recipient. Unlike antibody therapy, CAR-T cells can replicate in vivo, produce the long-term persistence that continued tumor can be caused to control.

The anti-tumor immune response as caused by CAR-T cells can be active or passive immunity response.In addition, CAR mediations Immune response can be a part for adoptive immunotherapy step, and wherein CAR-T cells induction is to the antigen-binding portion dtex in CAR The immune response of the opposite sex.

Therefore, can CAR using the present invention, its coded sequence, nucleic acid constructs, expression vector, virus and CAR-T it is thin The disease of born of the same parents' treatment is preferably the disease of CD22 mediations, is preferably non-Hodgkin lymphoma and acute lymphoma leukaemia.

The T cell of the CAR- modifications of the present invention can be administered alone or as pharmaceutical composition and diluent and/or and its Such as relevant cell factor of his component or cell mass, which combine, to be applied.Briefly, pharmaceutical composition of the invention may include as CAR-T cells as described herein, with one or more pharmacy or physiologically acceptable carriers, diluent or excipient are combined. Such composition may include buffer solution such as neutral buffered saline, sulfate buffered saline etc.；Carbohydrate such as Portugal Grape sugar, mannose, sucrose or glucan, mannitol；Protein；Polypeptide or amino acid such as glycine；Antioxidant；Chelating agent Such as EDTA or glutathione；Adjuvant (for example, aluminium hydroxide)；And preservative.

The mode that the pharmaceutical composition of the present invention can be suitable for the disease of (or prevention) to be treated is applied.The quantity of administration It will be determined with frequency by such factor, such as the illness of patient and the type of patient disease and severity.

When pointing out " effective dose in immunology ", " antitumor effective dose ", " tumour-suppression effective dose " or " therapeutic dose ", The precise volume of the present composition to be administered can be determined that it considers that the age of patient's (object), weight, tumour are big by doctor Small, infection or the individual difference of metastasis degree and illness.Can usually it point out：Include the pharmaceutical composition of T cell described herein Can be with 10⁴To 10⁹The dosage of a cell/kg weight, preferably 10⁵To 10⁶The dosage of a cell/kg weight.T cell composition Can also be with these dosage multiple applications.Cell can be by using known injection technique in immunotherapy (see for example Rosenberg etc., New Eng.J.of Med.319:1676,1988) apply.Optimal dose and treatment for specific patient Scheme can be by monitoring the disease indication of patient and therefore adjustment for the treatment of is readily determined by medical domain technical staff.

The administration of object group compound can carry out in any convenient manner, including by spray-on process, inject, swallow, defeated Liquid, implantation or transplanting.Compositions described herein can by subcutaneous, intracutaneous, knurl, in knot, in spinal cord, intramuscular, pass through vein Patient is administered in interior injection or peritonaeum.In one embodiment, T cell composition of the invention passes through intracutaneous or subcutaneous note Penetrate and be administered to patient.In another embodiment, T cell composition of the invention is preferably applied by being injected intravenously.T is thin The composition of born of the same parents can be injected directly into tumour, lymph node or infection position.

In some embodiments of the present invention, CAR-T cells of the invention or its composition can with it is known in the art Other therapies combine.The therapy includes but not limited to chemotherapy, radiotherapy and immunodepressant.For example, it can combine well known in the art Treatment CD22 mediation disease radiotherapy or chemotheraping preparation treated.

Herein, " anti-tumor effect " refers to a kind of biological effect, it can be by the reduction of gross tumor volume, tumor cell number Reduction, the increase of life expectancy or the improvement expression with the relevant various physiological signs of cancer reduce, shifted number.

" patient ", " object ", " individual " etc. are used interchangeably herein, and referring to can cause the work of immune response organic Body, such as mammal.Example includes but not limited to people, dog, cat, mouse, rat and its genetically modified organism.

The present invention using the anti-CD22 antibody scFv of clone m971 (specifically be derived from) gene order, and from NCBI The CD8 α hinge areas of people, the CD8 transmembrane regions of people, the 41BB intracellular regions of people and the CD3 ζ born of the same parents of people are searched in GenBank databases Inner region gene sequence information, full genome synthesis the anti-CD22scFv-CD8 hinge areas-CD8TM-41BB-CD3 ζ of Chimeric antigen receptor with The genetic fragment of anti-CD22scFv-CD8 hinge areas-CD8TM-41BB-CD3 ζ-GMCSFR targeting sequencings-tEGFR, is inserted into inverse In transcription vector.Recombinant plasmid packaging virus in 293T cells, infect T cell, make T cell express the chimeric antigen by Body.The present invention realizes that the method for transformation of the T lymphocytes of Chimeric antigen receptor genetic modification is to be based on Retroviral Transformation side Method.This method has transformation efficiency high, and foreign gene can stablize expression, and can shorten the arrival of in vitro culture T lymphocytes The advantages that time of clinical number of stages.In transgenosis T lymphocytic cell surfaces, the nucleic acid of conversion is existed by transcription, accurate translation Thereon.CAR-T cells prepared by the present invention have specific tumor cell strong killing ability, and effect target ratio is 10 to 1 feelings Under condition, killing-efficiency is more than 80%.Further, CAR of the invention also carries tEGFR components, the space conformation of the component It can combine closely with the monoclonal antibody against EGFR Cetuximab of pharmaceutically grade, can be as the mark of cell surface, at the same time It also is adapted for the internal tracking (can be detected by streaming and immunohistochemistry) of T cell；It can also be resisted in vivo by appropriate Xidan (cetuximab) remove, that is, appropriate Xidan can be added when CAR of the invention plays a role by, which being not intended to, resists, and safely and effectively control should CAR-T cells play a role in vivo.Therefore, CAR of the invention also has the function that tracing in vivo and safety switch.

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restricted, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including due to provided herein is teaching will become apparent from any and whole change. Method used and reagent in embodiment, unless otherwise stated, method and reagent for this area routine.

NT cells used are the T cell of the untransfected in source same as Example 4 in embodiment, as control cell. Raji and K562 derives from ATCC cell banks.With the expression quantity of CD22 in CD22 antibody test Raji cells.As shown in fig. 6, The expression quantity of CD22 is 99.9% in Raji cells.

Embodiment 1：CD22-scFv-CD8 α-CD28-41BB-CD3 ζ gene orders determine

People CD8 α hinge areas, people CD8 α transmembrane regions, 41BB intracellular regions and people CD3 ζ born of the same parents are searched from NCBI site databases Inner region gene sequence information, anti-CD22 single-chain antibodies clone number is m971, these sequences are in website http:// Codon optimization is carried out on sg.idtdna.com/site, ensures to be more suitable for the mankind in the case where encoding amino acid sequence is constant Cell is expressed.

Using over-lap PCR by above-mentioned sequence successively by anti-CD22scFv, people's CD8 α hinge areas gene, people's CD8 α transmembrane region bases Cause, 41BB intracellular regions gene, people's CD3 ζ intracellular region gene orders are attached, and different digestion positions are introduced in each sequence junction Point, forms complete CD22CAR gene sequence informations.

With the nucleotide sequence of NotI (NEB) and EcoRI (NEB) double digestion the CAR molecules, connect through T4 ligases (NEB) The NotI-EcoRI sites into retrovirus MSCV (Addgene) are patched, are transformed into competence Escherichia coli (DH5 α).

Recombinant plasmid is served Hai Sheng works Bioisystech Co., Ltd be sequenced, by sequencing result and be fitted to CD22CAR sequence alignments verify whether sequence is correct.Sequencing primer is：

Justice：AGCATCGTTCTGTGTTGTCTC(SEQ ID NO:3)；

Antisense：TGTTTGTCTTGTGGCAATACAC(SEQ ID NO:4).

After being sequenced correctly, simultaneously plasmid purification is extracted using the plasmid purification kit of Qiagen companies, plasmid purification Plasmid calcium phosphate method transfection 293T cells carry out retrovirus Packaging experimentation.

The plasmid map obtained constructed by the present embodiment is as shown in Figure 1.Fig. 2 shows the portion of the retrovirus expression plasmid Divide sequencing result peak value figure.

Embodiment 2：CD22CAR-GMCSFR targeting sequencing-tEGFR gene orders determine

Human epidermal growth factor receptor Extracellular domain sequence information is searched from NCBI site databases, sequence is in website http:// Codon optimization is carried out on sg.idtdna.com/site, ensures to be more suitable for the mankind in the case where encoding amino acid sequence is constant Cell is expressed.

Above-mentioned sequence is carried out by CD22CAR, GMCSFR targeting sequencing of embodiment 1, tEGFR successively using over-lap PCR Connection, introduces different restriction enzyme sites in each sequence junction, forms complete CD22CAR-GMCSFR targeting sequencings-tEGFR bases Because of sequence information.

Recombinant plasmid is served Hai Sheng works Bioisystech Co., Ltd be sequenced, by sequencing result and be fitted to CD22CAR-GMCSFR targeting sequencing-tEGFR sequence alignments verify whether sequence is correct.Sequencing primer is：

Justice：AGCATCGTTCTGTGTTGTCTC(SEQ ID NO:5)；

Antisense：TGTTTGTCTTGTGGCAATACAC(SEQ ID NO:6).

The plasmid map obtained constructed by the present embodiment is as shown in Figure 3.Fig. 4 shows the portion of the retrovirus expression plasmid Divide sequencing result peak value figure.

Embodiment 3：Retrovirus is packed

1st, the 1st day：293T cells should be less than for 20 generations, cover with not too much.With 0.6 × 10⁶Cell/ml bed boards, 10cm Ware adds the DMEM culture mediums of 10ml, fully mixes cell, 37 DEG C of overnight incubations.

2nd, the 2nd day：293T cell fusion degree reaches 90% or so and is transfected (being typically bed board 14-18h or so)；Prepare Plasmid composite, the amount of various plasmids is MSCV skeletons 12.5ug, Gag-pol 10ug, VSVg 6.25ug, CaCl₂250ul, H₂O 1ml, cumulative volume 1.25ml；Addition is with the isometric HBS of plasmid composite in another pipe, while adding plasmid composite Side, which is vortexed, shakes 20s.Softly mixture is added in 293T wares along side, 37 DEG C of culture 4h, remove culture medium, PBS is washed One time, rejoin the fresh culture of preheating.

3rd, the 4th day：Packing is stored in -80 DEG C after supernatant is collected after transfection 48h and is filtered with 0.45um filters, continues to add The fresh DMEM medium of preheating.

Embodiment 4：The T cell of retroviral infection people

1st, purer CD3+T cells are obtained with Ficcol separating liquids (Tianjin Hao oceans) separation, with the X-VIVO of serum containing 5%AB (LONZA) culture medium adjustment cell density is 1 × 10⁶/mL.Cell is inoculated into advance with anti-human 50ng/ml with 1ml/ holes CD3 antibody (Beijing is with vertical Hai Yuan) and 50ng/ml CD28 antibody (Beijing is with vertical Hai Yuan), add the leucocyte of 100IU/ml Interleukin 2 (Beijing double aigrets), when stimulating culture 48 small after the virus that is prepared with embodiment 3 infect；

2nd, after T cell activation culture every other day, PBS is diluted to Retronectin (Takara) bags of final concentration of 15 μ g/ml By non-tissue treatment culture plate, 24 orifice plates are per 250 μ l of hole.Lucifuge, 4 DEG C spare overnight.

3rd, T cell activation culture two days later, takes out 2 pieces of 24 orifice plates being coated with, and suction is abandoned coating buffer, added containing 2%BSA's HBSS room temperatures close 30min.Confining liquid volume is per 500 μ l of hole, and confining liquid is abandoned in suction, with the HBSS board-washings two containing 2.5%HEPES It is secondary.

4th, in the virus liquid adding hole that embodiment 3 is prepared, 2ml virus liquids is added per hole, 32 DEG C, 2000g, are centrifuged 2h。

5th, abandoning supernatant, 24 orifice plates add the T cell 1 × 10 after activation per hole⁶A, volume 1ml, culture medium is that T is thin IL-2 200IU/ml are added in born of the same parents' culture medium.30 DEG C, 1000g, centrifuge 10min.

6th, after centrifuging, culture plate is placed in 37 DEG C, 5%CO₂Cultivated in incubator.

7th, 24h after infecting, cell suspension is suctioned out, 1200rpm, 4 DEG C, centrifuges 7min.

8th, after cell infection, the density of cell is observed daily, adds the T cell nutrient solution of the 100IU/ml containing IL-2 in due course, The density of T cell is set to maintain 5 × 10⁵/ ml or so, expands cell.

It is derived from having infected the CART cells of retrovirus shown in embodiment 3 respectively, is respectively designated as CD22- BBzCART cells (CD22CAR of expression embodiment 1) and CD22-BBz-tEGFR CART cells (express embodiment 2 CD22CAR and tEGFR).

Embodiment 5：The ratio of T lymphocytes and the expression of surface C AR albumen after flow cytomery infection

Be collected by centrifugation respectively after infection 72 it is small when embodiment 4 the CAR-T cells and NT cells (control group) that are prepared, PBS abandons supernatant after washing 1 time, and PBS is washed after adding corresponding antibody lucifuge 30min, is resuspended, last flow cytomery. CAR+ is detected by anti-mouse IgG F (ab') antibody (Jackson Immunoresearch).

The results show is in Figure 5.Fig. 5 shows that the retroviral infection T cell 72 being prepared using embodiment 3 is small The expression efficiency of Shi Hou, CD22-BBz-tEGFR CAR+ are up to 42.6%.

Embodiment 6：CD107a detection of expression after CAR-T cells are co-cultured with target cell

1. taking one piece of 96 orifice plate of V bottoms, add CART the or NT cells 2 × 10 that embodiment 4 is prepared respectively per hole⁵It is a, with And target cell (Raji) or control cell (K562) 2 × 10⁵It is a, the X-VIVO complete mediums that IL-2 is free of for 100ul are resuspended, BD GolgiStop (containing monesin, 1 μ l BD GolgiStop are added in every 1ml culture mediums) are added, are added per hole 2ul CD107a antibody (1:50) when, 37 DEG C of incubations 5 are small, cell is collected.

2. sample is centrifuged and removes culture medium, PBS washes cell once, 400g, and 4 DEG C centrifuge 5 minutes.Supernatant is abandoned, often pipe adds Enter appropriate specific surfaces antibody (CD107a antibody, Biolegend), resuspension volume 100ul, lucifuge incubation on ice 30 minutes.

3. the PBS cleaning cell per effective 3mL 1 time, 400g is centrifuged 5 minutes.Carefully suck supernatant.

4. appropriate PBS is resuspended, flow cytomery CD107a.

The results show is in the figure 7.Fig. 7 shows that CD22-BBz-tEGFR CART cells are in the Raji cells of the CD8 positives For 42.6%, CD22-BBz-tEGFR cells, the CD107a in the Raji cells of the CD4 positives secretes the percentage of CD107a secretions Percentage be 46.8%.

Embodiment 7：INF- γ secretions detect after CAR-T cells are co-cultured with target cell

1. taking the CAR-T cells prepared, it is resuspended in Lonza culture mediums, adjustment cell concentration is 1 × 10⁶/mL。

2. experimental group contains target cell (Raji) or negative control cell (K562) 2 × 10 per hole⁵It is a, CD22-BBz- TEGFRCAR-T cells 2 × 10⁵A, 200 μ l are free of the Lonza culture mediums of IL-2.Added after fully mixing in 96 orifice plates.At the same time BD GolgiPlug (containing monesin, 1 μ l BD GolgiPlug are added in every 1ml cell culture mediums) are added, it is fully mixed After even, when 37 DEG C of incubation 5-6 are small.Cell is collected, as experimental group.

3. the PBS cleaning cell per effective 1mL 1 time, 300g is centrifuged 5 minutes.Carefully suck or outwell supernatant.

After 4.PBS washes cell, add 250 μ l/EP pipes and fix/penetrating fluid, 4 DEG C are incubated 20 minutes to fix cell and break Film.With 1 × BD Perm/WashTM buffer solution for cleaning cell 2 times, 1mL/ times.

5. carrying out intracellular factor dyeing, appropriate IFN-γ cell factor fluorescence antibody or negative control are taken, uses BDPerm/ Wash^TMBuffer solution is diluted to 50 μ l.The cell for fixing rupture of membranes is fully resuspended with this antibody diluent, 4 DEG C of lucifuges are incubated 30min, 1 × BD Perm/Wash^TMThe cleaning cell 2 times of buffer solution 1mL/ times, is then resuspended with PBS.

6. flow cytomery.

The results are shown in Figure 8.The results show that CD22-BBz-tEGFR CART cells are in the Raji cells of the CD8 positives The percentage of INF- γ secretions is respectively 24.1%, CD22-BBz-tEGFR cells INF- in the Raji cells of the CD4 positives The percentage of γ secretions is respectively 11.9%.

Embodiment 8：CAR-T cells detect tumor specific cell lethal effect after being co-cultured with target cell

1.K562 cells (being free of CD19 target proteins, be the negative control cell of target cell) are resuspended in serum free medium (1640) in, adjustment cell concentration is 1 × 10⁶/ ml, adds fluorescent dye BMQC (2,3,6,7- tetrahydrochysene -9- bromomethyls -1H, 5H Quinolizino (9,1-gh) cumarin) to final concentration of 5 μM.

2. mix, 37 DEG C of incubation 30min.

3. room temperature, 1500rpm centrifugation 5min, abandon supernatant, and cell is resuspended in cytotoxicity culture medium (without phenol red 1640+ 5%AB serum) in, 37 DEG C of incubation 60min.

4. twice of fresh cells toxicity culture medium cleaning cell, and be resuspended in fresh cells toxicity culture medium, density 1 × 10⁶/ml。

5.Raji cells (target protein containing CD22, is target cell) are suspended in the PBS containing 0.1%BSA, and adjustment concentration is 1×10⁶/ml。

6. fluorescein based dye CFSE (carbox fluorescenceindiacetate succinimidyl ester) is added to final concentration of 1 μM.

7. mix, 37 DEG C of incubation 10min.

8. after being incubated, add and reacted with the isometric FBS of cell suspension, incubation at room temperature 2min with end mark.

9. cleaning cell is simultaneously resuspended in fresh cells toxicity culture medium, density 1 × 10⁶/ml。

10. cleaning effector T cell is simultaneously suspended in cytotoxicity culture medium, adjustment concentration is 5 × 10⁶/ml。

11. in all experiments, infected CD22-BBz-tEGFR CAR effector T cell (CAR-T cells) it is thin Cellular toxicity is compared with the cytotoxicity for having infected control CAR or the negative control effector T cell (NT) being uninfected by, and this A little effector T cells come from same patient.

12.CD22-BBz-tEGFR CAR-T and negative control effector T cell, according to T cell：Target cell=10:1,2:1 Ratio, cultivated in 5ml sterility tests pipe (BD Biosciences), every group of two multiple holes of setting.Each co-cultivation group In, target cell is Raji cells 50,000 (50 μ l), 50,000 K562 cell (50 μ l) of negative control cell.Set at the same time Put one group and only include Raji target cells and K562 negative control cells.

13. co-cultured cell is placed in 37 DEG C of incubation 4h.

14. after the completion of being incubated, PBS cleaning cell, the concentration recommended to specifications immediately after rapidly joins 7-AAD (7-aminoactinomycin D), is incubated 30min on ice.

15. being not required to clean, machine testing in streaming is directly carried out, data are analyzed with Flow Jo.

16. it is thin to measure the Raji targets lived after T cell and target cell co-cultivation using the living cells gating of 7AAD feminine genders for analysis Born of the same parents and the ratio of K562 negative control cells living：

A) T cell for each group of co-cultivation and target cell,

Target cell survival %=Raji viable counts/K562 viable counts；

B) the target cell survival % of cytotoxic killer cell %=100- calibrations, i.e., (Raji lives thin during no effector cell Born of the same parents' number-when containing effector cell Raji viable counts)/K562 viable counts ratio.

The results show is in fig.9.The results show that it is 10 in effect target ratio:In the case of 1, CD22-BBz-tEGFR

Killing rate of the CAR-T cells to Raji cells is 90%.

Claims

1. a kind of polynucleotide sequence, the polynucleotide sequence is selected from：

(1) containing the coded sequence of sequentially connected anti-CD22 single-chain antibodies, the coded sequence of people's CD8 α hinge areas, people CD8 across The coded sequence in film area, the coded sequence of people's 41BB intracellular regions, the coded sequence of people's CD3 ζ intracellular regions and optional EGFR contain The polynucleotide sequence of the coded sequence of the fragment of extracellular domain III and extracellular domain IV；With

(2) complementary series of (1) described polynucleotide sequence.

2. polynucleotide sequence as claimed in claim 1, it is characterised in that

The polynucleotide sequence also coded sequence containing signal peptide before the coded sequence of the anti-CD22 single-chain antibodies, it is excellent Selection of land, the amino acid sequence such as SEQ ID NO of the signal peptide:Shown in 2 1-21 amino acids；And/or

The amino acid sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD22 single-chain antibodies:2 22-145 amino acids institutes Show；And/or

The amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-CD22 single-chain antibodies:2 161-267 amino acids It is shown；And/or

The amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 2 268-314 amino acids；And/or

The amino acid sequence of the people CD8 transmembrane regions such as SEQ ID NO:Shown in 2 315-336 amino acids；And/or

The amino acid sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 2 337-384 amino acids；And/or

The amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 2 385-495 amino acids；And/or

The fragment of the EGFR contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or the born of the same parents by EGFR Extracellular portion III, extracellular domain IV and transmembrane region composition；Preferably, the fragment contains 310-646 of Human epidermal growth factor receptor Amino acid sequence, or be made of the 310-646 amino acids sequences of Human epidermal growth factor receptor；It is highly preferred that the amino acid sequence of the fragment Row such as SEQ ID NO:Shown in 2 544-878 amino acids；Preferably, the polynucleotide sequence also contains GM-CSF receptor alphas The coded sequence of chain signal peptide, the GM-CSF receptor alpha chains signal peptide are arranged at the N-terminal of the EGFR fragments；Preferably, it is described The amino acid sequence of GM-CSF receptor alpha chain signal peptides such as SEQ ID NO:Shown in 2 522-543 amino acids；Preferably, institute Polynucleotide sequence is stated also containing the joint sequence for connecting the GM-CSF receptor alpha chains signal peptide and the people CD3 ζ intracellular regions Coded sequence, the amino acid sequence such as SEQ ID NO of preferably described joint sequence:Shown in 2 496-521 amino acids.

3. polynucleotide sequence as claimed in claim 2, it is characterised in that

The coded sequence such as SEQ ID NO of the signal peptide before the coded sequence of the anti-CD22 single-chain antibodies:1 1-63 Shown in the nucleotide sequence of position；And/or

The coded sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD22 single-chain antibodies:1 64-435 nucleotide sequences It is shown；And/or

The coded sequence such as SEQ ID NO of the light chain variable region of the anti-CD22 single-chain antibodies:1 481-801 nucleotides sequences Shown in row；And/or

The coded sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 1 802-942 nucleotide sequences；And/or

The coded sequence of the people CD8 transmembrane regions such as SEQ ID NO:Shown in 1 943-1008 nucleotide sequences；And/or

The coded sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 1 1009-1152 nucleotide sequences；And/or

The coded sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 1 1153-1485 nucleotide sequences；And/or

Connect the coded sequence of the joint sequence of the GM-CSF receptor alpha chains signal peptide and the people CD3 ζ intracellular regions such as SEQ ID NO:Shown in 1 1486-1563 nucleotide sequences；

The coded sequence of the GM-CSF receptor alpha chains signal peptide such as SEQ ID NO:1 1564-1629 nucleotide sequence institutes Show；And/or

The coded sequence of the fragment of the EGFR such as SEQ ID NO:Shown in 1 1630-2634 nucleotide sequences；Or

The polynucleotide sequence coding such as SEQ ID NO:2 amino acid sequence shown in 1-495, or such as SEQ ID NO: 2 amino acid sequence shown in 22-495, or coding such as SEQ ID NO:2 amino acid sequence shown in 22-878, or Coding such as SEQ ID NO:Amino acid sequence shown in 2；Or

The polynucleotide sequence contains SEQ ID NO:1、SEQ ID NO:1 nucleotide sequence, the SEQ shown in 1-1485 ID NO:1 nucleotide sequence or SEQ ID NO shown in 64-1485:1 nucleotide sequence shown in 64-2634, or By SEQ ID NO:1、SEQ ID NO:1 nucleotide sequence, the SEQ ID NO shown in 1-1485:1 64-1485 institutes The nucleotide sequence or SEQ ID NO shown:The 1 nucleotide sequence composition shown in 64-2634.

4. a kind of fusion protein, the fusion protein is selected from：

(1) sequentially connected anti-CD22 single-chain antibodies, people CD8 α hinge areas, people CD8 transmembrane regions, people 41BB intracellular regions and people are contained The fusion protein of the fragment of the III containing extracellular domain and extracellular domain IV of CD3 ζ intracellular regions and optional EGFR；With

(2) (1) limit fusion protein amino acid sequence in by substitution, lack or add one or several amino acid and Retain the fusion protein as derived from (1) of activating T cell activity；

Preferably, the anti-CD22 single-chain antibodies are Anti-CD22 monoclonal antibody m971.

5. fusion protein as claimed in claim 4, it is characterised in that the fusion protein has following one or more special Sign：

The fusion protein also contains signal peptide in the N-terminal of the anti-CD22 single-chain antibodies, it is preferable that the amino of the signal peptide Acid sequence such as SEQ ID NO:Shown in 2 1-21 amino acids；

The amino acid sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD22 single-chain antibodies:1 22-145 amino acids institute Show；

The amino acid sequence of the light chain variable region of the anti-CD22 single-chain antibodies can be such as SEQ ID NO:1 161-267 bit aminos Shown in acid；

The amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 1 268-314 amino acids；

The amino acid sequence of the people CD8 transmembrane regions such as SEQ ID NO:Shown in 1 315-336 amino acids；

The amino acid sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 1 337-384 amino acids；

The amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 1 385-495 amino acids；With

The fragment of the EGFR contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or the born of the same parents by EGFR Extracellular portion III, extracellular domain IV and transmembrane region composition；Preferably, the fragment contains 310-646 of Human epidermal growth factor receptor Amino acid sequence, or be made of the 310-646 amino acids sequences of Human epidermal growth factor receptor；It is highly preferred that the amino acid sequence of the fragment Row such as SEQ ID NO:Shown in 1 544-878 amino acids；Preferably, the fusion protein also contains GM-CSF receptor alpha chains Signal peptide, the GM-CSF receptor alpha chains signal peptide are arranged at the N-terminal of the EGFR fragments；Preferably, the GM-CSF receptor alphas The amino acid sequence of chain signal peptide such as SEQ ID NO:Shown in 2 522-543 amino acids；Preferably, the fusion protein Also containing the joint sequence for connecting the GM-CSF receptor alpha chains signal peptide and the people CD3 ζ intracellular regions, preferably described connector The amino acid sequence of sequence such as SEQ ID NO:Shown in 2 496-521 amino acids；With

Preferably, the amino acid sequence of the fusion protein such as SEQ ID NO:Shown in 2 22-495 amino acids, or such as SEQ ID NO:Shown in 2 22-878 amino acids, or such as SEQ ID NO:Shown in 2 1-495 amino acids, or such as SEQ ID NO: Shown in 2.

6. a kind of nucleic acid constructs, the nucleic acid constructs contains the polynucleotide sequence any one of claim 1-3；

Preferably, the nucleic acid constructs is carrier；

It is highly preferred that the nucleic acid constructs is retroviral vector, contain replication origin, 3 ' LTR, 5 ' LTR, pis Packaging signal, groundhog hepatitis virus posttranscriptional regulatory element, and the polynucleotides sequence any one of claim 1-3 Row.

7. a kind of retrovirus, the retrovirus contains the nucleic acid constructs described in claim 6, preferably comprises described Carrier, further preferably described retroviral vector.

8. the pharmaceutical composition of a kind of T cell of genetic modification or the T cell containing the genetic modification, it is characterised in that described thin Born of the same parents contain the polynucleotide sequence any one of claim 1-3, or containing the nucleic acid constructs described in claim 6, Or retrovirus described in claim 7 has been infected, or stablize the fusion protein any one of expression claim 4-5 The fragment of III containing extracellular domain, extracellular domain IV and optional transmembrane region with optional EGFR.

9. the fusion egg any one of polynucleotide sequence, claim 4-5 any one of claim 1-3 In vain, the nucleic acid constructs described in claim 6 or the retrovirus described in claim 7 are in the T cell for preparing activation Using.

10. the fusion egg any one of polynucleotide sequence, claim 4-5 any one of claim 1-3 In vain, the nucleic acid constructs described in claim 6, the retrovirus described in claim 7 or the gene described in claim 8 The purposes of the T cell of modification or its pharmaceutical composition in the medicine of disease for the treatment of CD22 mediations is prepared；

Preferably, the disease of the CD22 mediations is non-Hodgkin lymphoma and acute lymphoma leukaemia.