CN110551740A

CN110551740A - chimeric antigen receptor targeting CD30 and uses thereof

Info

Publication number: CN110551740A
Application number: CN201810557762.XA
Authority: CN
Inventors: 金涛; 王海鹰; 彭荣
Original assignee: Shanghai Hrain Biotechnology Co Ltd
Current assignee: Shanghai Hrain Biotechnology Co Ltd
Priority date: 2018-06-01
Filing date: 2018-06-01
Publication date: 2019-12-10

Abstract

the present invention relates to chimeric antigen receptors targeting CD30 and uses thereof. In particular, the invention provides a polynucleotide sequence selected from: (1) a polynucleotide sequence comprising the coding sequence of an anti-CD 30 single-chain antibody, the coding sequence of a human CD8 α hinge region, the coding sequence of a human CD8 transmembrane region, the coding sequence of a human 41BB intracellular region, the coding sequence of a human CD3 ζ intracellular region, which are linked in sequence; and (2) the complement of the polynucleotide sequence of (1). The invention also provides a related fusion protein, a vector containing the coding sequence, and applications of the fusion protein, the coding sequence and the vector.

Description

Chimeric antigen receptor targeting CD30 and uses thereof

Technical Field

The invention belongs to the field of cell therapy, and particularly relates to a chimeric antigen receptor targeting CD30 and application thereof.

Background

CD30 is a transmembrane protein belonging to the tumor necrosis factor receptor family, which is expressed on activated B and T cells, and may play a role in maintaining and propagating memory B or T cells, B cell proliferation, and increased immunoglobulin production. CD30 is highly expressed in R-S cells of Hodgkin' S lymphoma and in certain types of peripheral T-cell lymphoma. Antibody-coupled drug brentuximab vedotin against the CD30 target has been demonstrated to be effective in relapsing refractory hodgkin lymphoma and anaplastic large cell lymphoma, and has received FDA approval in the united states. Thus CD30 is also an ideal target for CAR-T therapy.

Chimeric Antigen Receptor-T cell (CAR-T) T cell refers to a T cell that is genetically modified to recognize a specific Antigen of interest in an MHC non-limiting manner and to continuously activate expanded T cells. The international cell therapy association (interna) in 2012 indicates that biological immune cell therapy has become a fourth means for treating tumors besides surgery, radiotherapy and chemotherapy, and will become a necessary means for treating tumors in the future. CAR-T cell back-infusion therapy is the most clearly effective form of immunotherapy in current tumor therapy. A large number of studies show that the CAR-T cells can effectively recognize tumor antigens, cause specific anti-tumor immune response and remarkably improve the survival condition of patients.

Chimeric Antigen Receptors (CARs) are a core component of CAR-T, conferring on T cells the ability to recognize tumor antigens in an HLA-independent manner, which enables CAR-engineered T cells to recognize a broader range of targets than native T cell surface receptor TCRs. The basic design of a CAR includes a tumor-associated antigen (TAA) binding region (usually the scFV fragment from the antigen binding region of a monoclonal antibody), an extracellular hinge region, a transmembrane region, and an intracellular signaling region. The choice of antigen of interest is a key determinant for the specificity, efficacy of the CAR and safety of the genetically engineered T cells themselves.

With the continuous development of Chimeric Antigen Receptor T cell (CAR-T) technology, CAR-T can be divided into four generations.

The first generation CAR-T cells consist of an extracellular binding domain-single chain antibody (scFV), a transmembrane domain (TM), and an intracellular signaling domain-Immunoreceptor Tyrosine Activation Motif (ITAM), wherein the chimeric antigen receptor portions are linked as follows: scFv-TM-CD3 ζ. Although some specific cytotoxicity could be seen in the first generation CARs, it was found to be less effective when summarized in 2006 in clinical trials. The reason for this is because the first generation of CAR-T cells are rapidly depleted in the patient and have so poor persistence that CAR-T cells already apoptotic when they have not yet come into contact with a large number of tumor cells can elicit an anti-tumor cytotoxic effect, but rather less cytokine secretion, but their short survival time in vivo fails to elicit a persistent anti-tumor effect [ chieric g2D-modified T cells inhibition system T-cell lymphoma growth in a mannenrinating multiple cytokines and cytotoxic pathways. 11029-.

optimization of T cell activation signaling regions in CAR design of second generation CAR-T cells remains a hotspot of research. Complete activation of T cells relies on dual signaling and cytokine action. Wherein the first signal is a specific signal initiated by the recognition of an antigen peptide-MHC complex on the surface of an antigen presenting cell by the TCR; the second signal is a co-stimulatory signal. Second generation CARs have appeared as early as 1998 (Finney HM et al, J Immunol.1998; 161 (6): 2791-7). The 2 nd generation CAR adds a costimulatory molecule in the intracellular signal peptide region, namely the costimulatory signal is assembled into the CAR, and can better provide an activation signal for CAR-T cells, so that the CAR can simultaneously activate the costimulatory molecule and the intracellular signal after identifying tumor cells, double activation is realized, and the proliferation and secretion capacity of the T cells and the anti-tumor effect can be obviously improved. The first well-studied T cell costimulatory signal receptor was CD28, which was capable of binding to a B7 family member on the surface of target cells. Co-stimulation of CD28 promotes T cell proliferation, IL-2 synthesis and expression, and enhances T cell resistance to apoptosis. Costimulatory molecules such as CD134(OX40) and 41BB (4-1BB) are subsequently presented to increase cytotoxicity and proliferative activity of T cells, maintain T cell responses, prolong T cell survival, and the like. Such second generation CARs produced unexpected results in subsequent clinical trials, with shaking frequently triggered since 2010 based on clinical reports of second generation CARs, with complete remission rates of up to 90% and above, especially for relapsed, refractory ALL patients.

the third generation CAR signal peptide region is integrated with more than 2 costimulatory molecules, so that the T cells can be continuously activated and proliferated, cytokines can be continuously secreted, and the capability of the T cells in killing tumor cells is more remarkable, namely, the new generation CAR can obtain stronger anti-tumor response. Most typically, U Pen Carl June is added with a 41BB stimulating factor under the action of CD28 stimulating factor.

Fourth generation CAR-T cells are supplemented with cytokines or co-stimulatory ligands, for example fourth generation CARs can produce IL-12, which can modulate the immune microenvironment-increase the activation of T cells, while activating innate immune cells to act to eliminate target antigen negative cancer cells, thus achieving a bi-directional regulatory effect [ chimielewski M, Abken h. the four generation of cars. expert Opin Biol ther. 2015; 15(8): 1145-54 ].

clinical studies of CD 30-targeted CAR-T treatment of lymphoma were reported in year 2015 at the 57 th American Society of Hematology (ASH), and included 7 patients with hodgkin lymphoma and 2 patients with anaplastic lymphoma, 8 of which were all relapsed after receiving CD30 monoclonal antibody treatment, the number of CAR-ts targeted to CD30 was 2 × 10 ⁷/m2 (2), 1 × 10 ⁸/m2 (2), 2 × 10 ⁸/m2 (5), none of which were pretreated, the findings showed that 1 of 9 patients achieved CR, 1 achieved very good partial remission (very good clinical remissions, VGPR), 4 of SD, 3 of PD, and the CAR-T targeted to CD30 persisted for 4 weeks in all patients, and all patients did not develop cytokine release syndrome (syncytokine release syndrome, this study was still on-going to be a clinically effective schedule 2, this study suggested that CD 2/CRs-targeted to be a clinically effective schedule.

One clinical study (NCT01316146) reported that 9 patients with relapsed refractory Hodgkin lymphoma or anaplastic lymphoma received a dose escalation study with CD30CAR-T therapy. Of 7 patients with recurrent hodgkin lymphoma, 1 had CR for more than 2.5 years, 1 had CR for 2 years, and 3 had retained SD. Of 2 patients with anaplastic large cell lymphoma, 1 lasted CR9 months after treatment, and another 1 failed to respond. Common adverse reactions that may be associated with CD30CAR-T cell infusion include fatigue, hyperkalemia, hypokalemia, or transient elevations in aspartate aminotransferase. There was no significant difference in the patient's white blood cell counts after CAR-T infusion, except for a slight reduction in eosinophils, and B and T cell counts remained stable. In the absence of CRS symptoms, the investigators indicated a certain elevation in inflammatory cytokines such as IL-6 and TNF- α, generally consistent with the peak of CD30CAR-T cell expansion. This study shows for the first time that CD30CAR-T therapy is able to achieve CR in such patients even without other adjuvant therapies, such as pre-treatment or subsequent treatment. In addition, investigators also found that infused (33 ± 9)% of CD30CAR-T expressed programmed death receptor 1(PD-1), but PD-1 expression did not correlate with amplification or persistence of CD30CAR-T in vivo. This study demonstrates the tolerability, safety and potential efficacy of CD30CAR-T in the treatment of CD30 positive lymphoid malignancies.

Another study (NCT02690545) treated with chemotherapy pretreatment followed by CD30CAR-T reinfusion to 13 patients with hodgkin lymphoma, for a total of 7 patients who achieved CR. Of these, a total of 8 patients were pretreated with bendamustine alone and 3 with CR, while 5 patients were pretreated with bendamustine in combination with fludarabine regimen with 4 with CR. Therefore, the research proves that the tumor number can be reduced and lymphocyte apoptosis can be induced by the pretreatment treatment of bendamustine and fludarabine, the activity of CD30CAR-T for treating Hodgkin lymphoma can be increased, and the curative effect can be improved.

The CD30-41BBz CAR-T cell plays a good role in vitro cell experiments. Lays a good foundation for clinical experiments and clinical treatment.

Disclosure of Invention

in a first aspect, the present invention provides a polynucleotide sequence selected from the group consisting of:

(1) a polynucleotide sequence comprising the coding sequence of an anti-CD 30 single-chain antibody, the coding sequence of a human CD8 α hinge region, the coding sequence of a human CD8 transmembrane region, the coding sequence of a human 41BB intracellular region, the coding sequence of a human CD3 ζ intracellular region, which are linked in sequence; and

(2) (1) the complement of the polynucleotide sequence.

In one or more embodiments, the polynucleotide sequence further comprises a coding sequence for a signal peptide prior to the coding sequence for the anti-CD 30 single chain antibody. In one or more embodiments, the signal peptide has an amino acid sequence as set forth in amino acids 1-21 of SEQ ID NO. 2. In one or more embodiments, the light chain variable region of the anti-CD 30 single chain antibody has the amino acid sequence as set forth in amino acids 22-138 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the heavy chain variable region of the anti-CD 30 single chain antibody is as shown in amino acids 154-264 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the human CD8 α hinge region is depicted as amino acids 265 and 311 of SEQ ID NO 2. In one or more embodiments, the amino acid sequence of the transmembrane region of human CD8 is depicted as amino acids 312-333 of SEQ ID NO 2. In one or more embodiments, the amino acid sequence of the intracellular domain of human 41BB is as shown in amino acids 334-381 of SEQ ID NO 2. In one or more embodiments, the amino acid sequence of the intracellular domain of human CD3 ζ is as shown in SEQ ID NO 2, amino acids 382-492.

In one or more embodiments, the coding sequence for the signal peptide preceding the coding sequence for the anti-CD 30 single chain antibody is as set forth in nucleotide sequences 1-63 of SEQ ID NO. 1. In one or more embodiments, the light chain variable region encoding sequence of the anti-CD 30 single chain antibody is as shown in SEQ ID NO. 1, nucleotide sequences 64-414. In one or more embodiments, the coding sequence of the heavy chain variable region of the anti-CD 30 single chain antibody is as shown in the nucleotide sequence of 460-792 of SEQ ID NO. 1. In one or more embodiments, the coding sequence for the human CD8 α hinge region is as set forth in nucleotide sequence 793-933 of SEQ ID NO: 1. In one or more embodiments, the coding sequence for the transmembrane region of human CD8 is as shown in nucleotide sequence 934-999 of SEQ ID NO 1. In one or more embodiments, the coding sequence of the intracellular region of human 41BB is as shown in the nucleotide sequence at positions 1000-1143 of SEQ ID NO. 1. In one or more embodiments, the coding sequence for the intracellular domain of human CD3 ζ is as set forth in nucleotide sequences SEQ ID No. 1, position 1144-1476.

in a second aspect, the invention provides a fusion protein selected from the group consisting of:

(1) A coding sequence of a fusion protein comprising an anti-CD 30 single-chain antibody, a human CD8 α hinge region, a human CD8 transmembrane region, a human 41BB intracellular region and a human CD3 zeta intracellular region which are linked in sequence; and

(2) a fusion protein derived from (1) by substituting, deleting or adding one or more amino acids in the amino acid sequence defined in (1) and retaining the activity of activated T cells;

Preferably, the anti-CD 30 single-chain antibody is anti-CD 30 monoclonal antibody BER-H2.

In one or more embodiments, the fusion protein further comprises a signal peptide at the N-terminus of the anti-CD 30 single chain antibody. In one or more embodiments, the amino acid sequence of the signal peptide is as set forth in amino acids 1-21 of SEQ ID NO 2. In one or more embodiments, the light chain variable region of the anti-CD 30 single chain antibody has the amino acid sequence as shown in amino acids 22-138 of SEQ ID NO. 1. In one or more embodiments, the amino acid sequence of the heavy chain variable region of the anti-CD 30 single chain antibody can be shown as amino acids 154-264 of SEQ ID NO. 1. In one or more embodiments, the amino acid sequence of the human CD8 α hinge region is depicted as amino acids 265-311 of SEQ ID NO 1. In one or more embodiments, the amino acid sequence of the transmembrane region of human CD8 is depicted as amino acids 312-333 of SEQ ID NO 1. In one or more embodiments, the amino acid sequence of the intracellular domain of human 41BB is as shown in amino acids 334-381 of SEQ ID NO: 1. In one or more embodiments, the amino acid sequence of the intracellular domain of human CD3 ζ is as set forth in amino acids 382-492 of SEQ ID NO: 1.

In a third aspect, the invention provides a nucleic acid construct comprising a polynucleotide sequence as described herein.

In one or more embodiments, the nucleic acid construct is a vector. In one or more embodiments, the nucleic acid construct is a retroviral vector comprising a replication initiation site, a 3 'LTR, a 5' LTR, a polynucleotide sequence described herein, and optionally a selectable marker.

in a fourth aspect, the invention provides a retrovirus containing a nucleic acid construct as described herein, preferably containing the vector, more preferably containing the retroviral vector.

In a fifth aspect, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a nucleic acid construct as described herein, or infected with a retrovirus as described herein, or stably expressing a fusion protein as described herein.

in a sixth aspect, the invention provides a pharmaceutical composition comprising a genetically modified T cell as described herein.

in a seventh aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct or retrovirus as described herein in the preparation of an activated T cell.

In an eighth aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct, retrovirus, or genetically modified T cell as described herein, or a pharmaceutical composition thereof, in the manufacture of a medicament for the treatment of a CD 30-mediated disease.

In one or more embodiments, the CD 30-mediated disease is hodgkin's lymphoma

Drawings

FIG. 1 is a schematic representation of a CD30-CAR retroviral expression vector (CD30-41BBz)

Detailed Description

The present invention provides a Chimeric Antigen Receptor (CAR) that targets CD 30. The CAR comprises fragments of a sequentially linked anti-CD 30 single chain antibody, human CD8 α hinge region, human CD8 transmembrane region, human 41BB intracellular region, human CD3 ζ intracellular region.

anti-CD 30 single chain antibodies suitable for use in the present invention may be derived from a variety of anti-CD 30 monoclonal antibodies known in the art.

Optionally, the light chain variable region and the heavy chain variable region may be linked together by a linker sequence. In certain embodiments, the monoclonal antibody is a monoclonal antibody having the clone number BER-H2. In certain embodiments, the light chain variable region of the anti-CD 30 single chain antibody has the amino acid sequence shown as amino acid residues 22-138 of SEQ ID NO. 2. In other embodiments, the heavy chain variable region of the anti-CD 30 single chain antibody has the amino acid sequence as shown in amino acid residues 154-264 of SEQ ID NO: 2.

The amino acid sequence of the human CD8 alpha hinge region suitable for use in the present invention can be shown as amino acids 265 and 311 of SEQ ID NO. 2.

the human CD8 transmembrane region suitable for use in the present invention can be the various human CD8 transmembrane region sequences commonly used in the art for CARs. In certain embodiments, the amino acid sequence of the transmembrane region of human CD8 is depicted as amino acids 312-333 of SEQ ID NO 2.

The 41BB suitable for use in the present invention can be any of the various 41 BBs known in the art for use in CARs. As an illustrative example, the present invention uses the 41BB shown in the amino acid sequence at position 334-381 of SEQ ID NO. 2.

The intracellular domain of human CD3 ζ suitable for use in the present invention may be various intracellular domains of human CD3 ζ conventionally used in CARs in the art. In certain embodiments, the amino acid sequence of the intracellular domain of human CD3 ζ is as set forth in amino acids 382-492 of SEQ ID NO 2.

The above-mentioned portions forming the fusion protein of the present invention, such as the light chain variable region and the heavy chain variable region of the anti-CD 30 single-chain antibody, the human CD8 α hinge region, the human CD8 transmembrane region, 41BB, and the human CD3 ζ intracellular region, may be directly linked to each other, or may be linked by a linker sequence. The linker sequence may be one known in the art to be suitable for use with antibodies, for example, a G and S containing linker sequence. Typically, the linker contains one or more motifs which repeat back and forth. For example, the motif may be GGGS, GGGGS, SSSSG, GSGSA and GGSGG. Preferably, the motifs are adjacent in the linker sequence with no intervening amino acid residues between the repeats. The linker sequence may comprise 1, 2, 3, 4 or 5 repeat motifs. The linker may be 3 to 25 amino acid residues in length, for example 3 to 15, 5 to 15, 10 to 20 amino acid residues. In certain embodiments, the linker sequence is a polyglycine linker sequence. The number of glycines in the linker sequence is not particularly limited, and is usually 2 to 20, such as 2 to 15, 2 to 10, 2 to 8. In addition to glycine and serine, other known amino acid residues may be contained in the linker, such as alanine (a), leucine (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q), and the like.

In certain embodiments, the amino acid sequence of a CAR of the invention is as set forth in amino acids 22-492 of SEQ ID NO 2 or as set forth in amino acids 1-492 of SEQ ID NO 2.

It will be appreciated that in gene cloning procedures it is often necessary to design appropriate cleavage sites which will introduce one or more irrelevant residues at the end of the expressed amino acid sequence without affecting the activity of the sequence of interest. In order to construct a fusion protein, facilitate expression of a recombinant protein, obtain a recombinant protein that is automatically secreted outside of a host cell, or facilitate purification of a recombinant protein, it is often necessary to add some amino acids to the N-terminus, C-terminus, or other suitable regions within the recombinant protein, for example, including, but not limited to, suitable linker peptides, signal peptides, leader peptides, terminal extensions, and the like. Thus, the amino-terminus or the carboxy-terminus of the fusion protein of the invention (i.e., the CAR) may also contain one or more polypeptide fragments as protein tags. Any suitable label may be used herein. For example, the tag may be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, ε, B, gE, and Ty 1. These tags can be used to purify proteins.

The invention also includes a CAR as represented by the amino acid sequence at positions 22-495 of SEQ ID NO. 2, or a mutant of the CAR as represented by SEQ ID NO. 2. These mutants include: an amino acid sequence that has at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to the CAR and retains the biological activity (e.g., activating T cells) of the CAR. Sequence identity between two aligned sequences can be calculated using, for example, BLASTp from NCBI.

Mutants also include: an amino acid sequence having one or several mutations (insertions, deletions or substitutions) in the amino acid sequence depicted in positions 22-492 of SEQ ID NO:2, the amino acid sequence depicted in positions 1-492 of SEQ ID NO:2 or the amino acid sequence depicted in SEQ ID NO:2, while still retaining the biological activity of the CAR. The number of mutations usually means within 1-10, such as 1-8, 1-5 or 1-3. The substitution is preferably a conservative substitution. For example, conservative substitutions with amino acids of similar or similar properties are not typically used in the art to alter the function of a protein or polypeptide. "amino acids with similar or analogous properties" include, for example, families of amino acid residues with analogous side chains, including amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine tryptophan, histidine). Thus, substitution of one or more sites with another amino acid residue from the same side chain species in the polypeptide of the invention will not substantially affect its activity.

The present invention includes polynucleotide sequences encoding the fusion proteins of the present invention. The polynucleotide sequences of the invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The invention also includes degenerate variants of the polynucleotide sequences encoding the fusion proteins, i.e., nucleotide sequences which encode the same amino acid sequence but differ in nucleotide sequence.

The polynucleotide sequences described herein can generally be obtained by PCR amplification. Specifically, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the relevant sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order. For example, in certain embodiments, the polynucleotide sequence encoding the fusion proteins described herein is as set forth in nucleotides 64 to 1476 of SEQ ID NO. 1, or as set forth in nucleotides 1 to 1476 of SEQ ID NO. 1.

The invention also relates to nucleic acid constructs comprising the polynucleotide sequences described herein, and one or more control sequences operably linked to these sequences. The polynucleotide sequences of the invention can be manipulated in a variety of ways to ensure expression of the fusion protein (CAR). The nucleic acid construct may be manipulated prior to insertion into the vector, depending on the type of expression vector or requirements. Techniques for altering polynucleotide sequences using recombinant DNA methods are known in the art.

The control sequence may be an appropriate promoter sequence. The promoter sequence is typically operably linked to the coding sequence of the protein to be expressed. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention. The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

In certain embodiments, the nucleic acid construct is a vector. Expression of a polynucleotide sequence of the invention is typically achieved by operably linking the polynucleotide sequence to a promoter and incorporating the construct into an expression vector. The vector may be suitable for replication and integration into eukaryotic cells. Typical cloning vectors contain transcriptional and translational terminators, initiation sequences, and promoters that may be used to regulate the expression of the desired nucleic acid sequence.

the polynucleotide sequences of the present invention can be cloned into many types of vectors. For example, it can be cloned into plasmids, phagemids, phage derivatives, animal viruses and cosmids. Further, the vector is an expression vector. The expression vector may be provided to the cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and Molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses.

Generally, suitable vectors comprise an origin of replication, a promoter sequence, a convenient restriction enzyme site, and one or more selectable markers that function in at least one organism (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193).

For example, in certain embodiments, the invention uses a retroviral vector that contains a replication initiation site, a 3 'LTR, a 5' LTR, polynucleotide sequences described herein, and optionally a selectable marker.

An example of a suitable promoter is the immediate early Cytomegalovirus (CMV) promoter sequence. The promoter sequence is a strong constitutive promoter sequence capable of driving high level expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is elongation growth factor-1 α (EF-1 α). However, other constitutive promoter sequences may also be used, including, but not limited to, the simian virus 40(SV40) early promoter, the mouse mammary cancer virus (MMTV), the Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, the MoMuLV promoter, the avian leukemia virus promoter, the EB virus immediate early promoter, the rous sarcoma virus promoter, and human gene promoters such as, but not limited to, the actin promoter, myosin promoter, heme promoter, and creatine kinase promoter. Further, inducible promoters are also contemplated. The use of an inducible promoter provides a molecular switch that is capable of turning on expression of a polynucleotide sequence operably linked to the inducible promoter during periods of expression and turning off expression when expression is undesirable. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter.

To assess the expression of the CAR polypeptide or portion thereof, the expression vector introduced into the cells can also comprise either or both of a selectable marker gene or a reporter gene to facilitate identification and selection of expressing cells from a population of cells sought to be transfected or infected by the viral vector. In other aspects, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in a host cell. Useful selectable markers include, for example, antibiotic resistance genes, such as neo and the like.

Reporter genes are used to identify potentially transfected cells and to evaluate the functionality of regulatory sequences. After the DNA has been introduced into the recipient cell, the expression of the reporter gene is assayed at an appropriate time. Suitable reporter genes may include genes encoding luciferase, β -galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein. Suitable expression systems are well known and can be prepared using known techniques or obtained commercially.

Methods for introducing and expressing genes into cells are known in the art. The vector may be readily introduced into a host cell by any method known in the art, for example, mammalian, bacterial, yeast or insect cells. For example, the expression vector may be transferred into a host cell by physical, chemical or biological means.

physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Chemical means of introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads; and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

Biological methods for introducing polynucleotides into host cells include the use of viral vectors, particularly retroviral vectors, which have become the most widely used method for inserting genes into mammalian, e.g., human, cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, and the like. Many virus-based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The selected gene can be inserted into a vector and packaged into a retroviral particle using techniques known in the art. The recombinant virus can then be isolated and delivered to the subject cells in vivo or ex vivo. Many retroviral systems are known in the art. In some embodiments, an adenoviral vector is used. Many adenoviral vectors are known in the art. In one embodiment, a lentiviral vector is used.

Thus, in certain embodiments, the invention also provides a retrovirus for activating T cells, the virus comprising a retroviral vector as described herein and corresponding packaging genes, such as gag, pol and vsvg.

T cells suitable for use in the present invention may be of various types from various sources. For example, T cells may be derived from PBMCs of B cell malignancy patients.

In certain embodiments, after T cells are obtained, activation may be stimulated with an appropriate amount (e.g., 30-80 ng/ml, such as 50ng/ml) of CD3 antibody prior to culturing in an appropriate amount (e.g., 30-80 IU/ml, such as 50IU/ml) of IL2 medium for use.

Thus, in certain embodiments, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a retroviral vector as described herein, or infected with a retrovirus as described herein, or prepared by a method as described herein, or stably expressing a fusion protein as described herein.

The CAR-T cells of the invention can undergo robust in vivo T cell expansion and sustained at high levels in the blood and bone marrow for extended amounts of time, and form specific memory T cells. Without wishing to be bound by any particular theory, the CAR-T cells of the invention can differentiate into a central memory-like state in vivo upon encountering and subsequently depleting target cells expressing a surrogate antigen.

The invention also includes a class of cell therapies in which T cells are genetically modified to express a CAR described herein, and the CAR-T cells are injected into a recipient in need thereof. The injected cells are capable of killing tumor cells of the recipient. Unlike antibody therapy, CAR-T cells are able to replicate in vivo, resulting in long-term persistence that can lead to sustained tumor control.

The anti-tumor immune response elicited by the CAR-T cells can be an active or passive immune response. Additionally, the CAR-mediated immune response can be part of an adoptive immunotherapy step, in which the CAR-T cells induce an immune response specific for the antigen-binding portion in the CAR.

Thus, the diseases that can be treated with the CARs, their coding sequences, nucleic acid constructs, expression vectors, viruses, and CAR-T cells of the invention are preferably CD 30-mediated diseases.

The CAR-modified T cells of the invention can be administered alone or as a pharmaceutical composition in combination with diluents and/or with other components such as relevant cytokines or cell populations. Briefly, a pharmaceutical composition of the invention may comprise CAR-T cells as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include buffers such as neutral buffered saline, sulfate buffered saline, and the like; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; a protein; polypeptides or amino acids such as glycine; an antioxidant; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and a preservative.

The pharmaceutical compositions of the present invention may be administered in a manner suitable for the disease to be treated (or prevented). The amount and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease.

the precise amount of a composition of the invention to be administered may be determined by a physician considering the age, weight, tumor size, extent of infection or metastasis and individual differences in the condition of the patient (subject) when referring to an "immunologically effective amount", "anti-tumor effective amount", "tumor-inhibiting effective amount", or "therapeutic amount" it is generally noted that a pharmaceutical composition comprising T cells as described herein may be administered at a dose of 10 ⁴ to 10 ⁹ cells/kg body weight, preferably at a dose of 10 ⁵ to 10 ⁶ cells/kg body weight.

Administration of the subject composition may be carried out in any convenient manner, including by spraying, injection, swallowing, infusion, implantation or transplantation. The compositions described herein can be administered to a patient subcutaneously, intradermally, intratumorally, intranodal, intraspinally, intramuscularly, by intravenous injection, or intraperitoneally. In one embodiment, the T cell composition of the invention is administered to a patient by intradermal or subcutaneous injection. In another embodiment, the T cell composition of the invention is preferably administered by intravenous injection. The composition of T cells can be injected directly into the tumor, lymph node or site of infection.

In some embodiments of the invention, the CAR-T cells of the invention or compositions thereof can be combined with other therapies known in the art. Such therapies include, but are not limited to, chemotherapy, radiation therapy, and immunosuppressive agents. For example, treatment may be combined with radiation or chemotherapeutic agents known in the art for the treatment of CD30 mediated diseases.

Herein, "anti-tumor effect" refers to a biological effect that can be represented by a reduction in tumor volume, a reduction in tumor cell number, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer.

"patient," "subject," "individual," and the like are used interchangeably herein and refer to a living organism, such as a mammal, that can elicit an immune response. Examples include, but are not limited to, humans, dogs, cats, mice, rats, and transgenic species thereof.

The invention adopts the gene sequence of an anti-CD 30 antibody (particularly scFV derived from clone number BER-H2), searches the gene sequence information of a human CD8 alpha hinge region, a human CD8 transmembrane region, a human 41BB intracellular region and a human CD3 zeta intracellular region from NCBI GenBank database, synthesizes a gene fragment of a chimeric antigen receptor anti-CD 30scFv-CD8 hinge region-CD 8TM-41BB-CD3 zeta in a whole gene, and inserts the gene fragment into a retroviral vector. The recombinant plasmid packages the virus in 293T cells, infects T cells, and causes the T cells to express the chimeric antigen receptor. The invention realizes the transformation method of the T lymphocyte modified by the chimeric antigen receptor gene based on a retrovirus transformation method. The method has the advantages of high transformation efficiency, stable expression of exogenous genes, and capability of shortening the time for in vitro culture of T lymphocytes to reach clinical level number. On the surface of the transgenic T lymphocyte, the transformed nucleic acid is expressed by transcription and translation.

The present invention is described in further detail by referring to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Accordingly, the present invention should in no way be construed as limited to the following examples, but rather should be construed to include any and all variations which become apparent in light of the teachings provided herein. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art.

Example 1: determination of the sequence of the CD30-scFv-CD8 alpha-41 BB-CD3 zeta Gene

The sequence information of human CD8 alpha hinge region, human CD8 alpha transmembrane region, 41BB intracellular region and human CD3 zeta intracellular region gene is searched from NCBI website database, the cloning number of the anti-CD 30 single-chain antibody is BER-H2, and the sequences are subjected to codon optimization on the website http:// sg.

The sequences are connected in sequence by adopting overlapping PCR according to the sequences of anti-CD 30scFv, human CD8 alpha hinge region gene, human CD8 alpha transmembrane region gene, 41BB intracellular region gene and human CD3 zeta intracellular region gene, and different enzyme cutting sites are introduced at the connection positions of the sequences to form complete CD30-CAR gene sequence information.

The nucleotide sequence of the CAR molecule was double-digested with NotI (NEB) and EcoRI (NEB), inserted into the NotI-EcoRI site of the retrovirus RV by T4 ligase (NEB) and transformed into competent E.coli (DH 5. alpha.).

The recombinant plasmid is sent to Shanghai Biotechnology Limited for sequencing, and the sequencing result is compared with the fitted CD30CAR sequence to verify whether the sequence is correct. The sequencing primer is as follows:

And (3) sense: AGCATCGTTCTGTGTTGTCTC (SEQ ID NO: 3);

Antisense: TGTTTGTCTTGTGGCAATACAC (SEQ ID NO: 4).

After the sequencing is correct, plasmids are extracted and purified by using a plasmid purification kit of Qiagen company, and 293T cells are transfected by a plasmid calcium phosphate method for purifying the plasmids to carry out a retrovirus packaging experiment.

The plasmid map constructed in this example is shown in FIG. 1.

Example 2: retroviral packaging

1. on day 1, 293T cells should be less than 20 passages, but not overgrown, plated at 0.6X 10 ⁶ cells/ml, 10ml DMEM medium added into a 10cm dish, cells are mixed well, and cultured overnight at 37 ℃;

2. On day 2, transfection was carried out with a fusion degree of 293T cells of about 90% (usually, plating for about 14-18 hours), plasmid complexes were prepared with amounts of each plasmid of 12.5ug of RV skeleton, 10ug of Gag-pol, 6.25ug of VSVG, ₂ 250ul of CaCl, H ₂ O1 ml, and a total volume of 1.25ml, and HBS equivalent to the plasmid complex was added to the other tube, and the mixture was gently added to a 293T dish while vortexing the plasmid complex for 20 seconds, incubated at 37 ℃ for 4 hours, the medium was removed, washed once with PBS, and fresh medium was added again.

3. Day 4: after transfection for 48h, the supernatant was collected, filtered through a 0.45um filter, dispensed and stored at-80 ℃, and preheated fresh DMEM medium was added continuously.

Example 3: retroviral infection of human T cells

1. Separating with Ficcol separating medium (tertiary Tianjin ocean) to obtain purer CD3+ T cells, adjusting cell density to 1 × 10 ⁶/mL with medium containing 5% AB serum X-VIVO (LONZA), inoculating the cells at 1 ml/well into anti-human 50ng/ml CD3 antibody (Beijing Hoigai Haiyuan) and 50ng/ml CD28 antibody (Beijing Hoigai Haiyuan), adding 100IU/ml interleukin 2 (Beijing double Lut), stimulating to culture for 48 hours, and infecting with the virus prepared in example 3;

2. every other day after T cell activation culture, the plates were plated in 24-well plates with 250. mu.l/well in Retronectin (Takara) coated non-tissue-treated plates diluted in PBS to a final concentration of 15. mu.g/ml. Protected from light and kept at 4 ℃ overnight for use.

3. After two days of T cell activation culture, 2 coated 24-well plates were removed, the coating solution was aspirated away, and HBSS containing 2% BSA was added and blocked at room temperature for 30 min. The volume of blocking solution was 500. mu.l per well, and the blocking solution was aspirated and the plate washed twice with HBSS containing 2.5% HEPES.

4. the virus solution prepared in example 3 was added to wells 2ml of virus solution per well, centrifuged at 32 ℃ and 2000g for 2 h.

5. Discarding supernatant, adding 1 × 10 ⁶ activated T cells per well of 24-well plate, adding IL-2200 IU/ml in T cell culture medium at 1000g at 30 deg.C, and centrifuging for 10 min.

6. After centrifugation, the plates were incubated at 37 ℃ in a 5% CO ₂ incubator.

7. 24h after infection, the cell suspension was aspirated and centrifuged at 1200rpm, 4 ℃ for 7 min.

8. after the cells were infected, the cell density was observed every day, and the cells were expanded by adding a T cell culture medium containing IL-2100 IU/ml at an appropriate timing so that the density of the T cells was maintained at about 5X 10 ⁵/ml.

Thus, CART cells each infected with the retrovirus shown in example 2, respectively, were obtained, and named CD30CART cells (expressing the CD30CAR of example 1).

Sequence listing

<110> Shanghai Hengrunheng Dasheng Biotech Co., Ltd

<120> chimeric antigen receptor targeting CD30 and uses thereof

<141> 2018-06-01

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1485

<212> DNA

<213> Artificial sequence (Homo sapiens)

<400> 1

atntnvrsna tggctctgcc tgtgaccgcc ctgctgctgc ctctggctct gctgctgcac 60

gccgctcggc ctcagatcca gctgcagcag tctggacctg aggtggtgaa gcctggggct 120

tcagtgaaga tatcctgcaa ggcttctggc tacaccttca ctgactacta tataacctgg 180

gtgaagcaga agcctggaca gggacttgag tggattggat ggatttatcc tggaagcggt 240

aatactaagt acaatgagaa gttcaagggc aaggccacat tgactgtaga cacatcctcc 300

agcacagcct tcatgcagct cagcagcctg acatctgagg acactgctgt ctatttctgt 360

gcgaactatg gtaactactg gtttgcttac tggggccaag ggactcaggt cactgtctct 420

gcaggcggcg ggggttctgg tggcggcggc agcggcggtg gaggatcaga cattgtgctg 480

acccaatctc cagcttcttt ggctgtgtct ctagggcaga gggccaccat ctcctgcaag 540

gccagccaaa gtgttgattt tgatggtgat agttatatga actggtacca acagaaacca 600

ggacagccac ccaaagtcct catctatgct gcatccaatc tagaatctgg gatcccagcc 660

aggtttagtg gcagtgggtc tgggacagac ttcaccctca acatccatcc tgtggaggag 720

gaggatgctg caacctatta ctgtcagcaa agtaatgagg atccgtggac gttcggtgga 780

ggcaccaagc tggaaatcaa aactacaact ccagcaccca gaccccctac acctgctcca 840

actatcgcaa gtcagcccct gtcactgcgc cctgaagcct gtcgccctgc tgccggggga 900

gctgtgcata ctcggggact ggactttgcc tgtgatatct acatctgggc gcccttggcc 960

gggacttgtg gggtccttct cctgtcactg gttatcaccc tttactgcag gttcagtgtc 1020

gtgaagagag gccggaagaa gctgctgtac atcttcaagc agcctttcat gaggcccgtg 1080

cagactaccc aggaggaaga tggatgcagc tgtagattcc ctgaagagga ggaaggaggc 1140

tgtgagctga gagtgaagtt ctcccgaagc gcagatgccc cagcctatca gcagggacag 1200

aatcagctgt acaacgagct gaacctggga agacgggagg aatacgatgt gctggacaaa 1260

aggcggggca gagatcctga gatgggcggc aaaccaagac ggaagaaccc ccaggaaggt 1320

ctgtataatg agctgcagaa agacaagatg gctgaggcct actcagaaat cgggatgaag 1380

ggcgaaagaa ggagaggaaa aggccacgac ggactgtacc aggggctgag tacagcaaca 1440

aaagacacct atgacgctct gcacatgcag gctctgccac caaga 1485

<210> 2

<211> 492

<212> PRT

<213> Artificial sequence (Homo sapiens)

<400> 2

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Ala Pro Gly Ile Gly Leu Gly Gly Ser Gly Pro Gly Val

20 25 30

Val Leu Pro Gly Ala Ser Val Leu Ile Ser Cys Leu Ala Ser Gly Thr

35 40 45

Thr Pro Thr Ala Thr Thr Ile Thr Thr Val Leu Gly Leu Pro Gly Gly

50 55 60

Gly Leu Gly Thr Ile Gly Thr Ile Thr Pro Gly Ser Gly Ala Thr Leu

65 70 75 80

Thr Ala Gly Leu Pro Leu Gly Leu Ala Thr Leu Thr Val Ala Thr Ser

85 90 95

Ser Ser Thr Ala Pro Met Gly Leu Ser Ser Leu Thr Ser Gly Ala Thr

100 105 110

Ala Val Thr Pro Cys Ala Ala Thr Gly Ala Thr Thr Pro Ala Thr Thr

115 120 125

Gly Gly Gly Thr Gly Val Thr Val Ser Ala Gly Gly Gly Gly Ser Gly

130 135 140

Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Ile Val Leu Thr Gly Ser

145 150 155 160

Pro Ala Ser Leu Ala Val Ser Leu Gly Gly Ala Ala Thr Ile Ser Cys

165 170 175

Leu Ala Ser Gly Ser Val Ala Pro Ala Gly Ala Ser Thr Met Ala Thr

180 185 190

Thr Gly Gly Leu Pro Gly Gly Pro Pro Leu Val Leu Ile Thr Ala Ala

195 200 205

Ser Ala Leu Gly Ser Gly Ile Pro Ala Ala Pro Ser Gly Ser Gly Ser

210 215 220

Gly Thr Ala Pro Thr Leu Ala Ile His Pro Val Gly Gly Gly Ala Ala

225 230 235 240

Ala Thr Thr Thr Cys Gly Gly Ser Ala Gly Ala Pro Thr Thr Pro Gly

245 250 255

Gly Gly Thr Leu Leu Gly Ile Leu Thr Thr Thr Pro Ala Pro Ala Pro

260 265 270

Pro Thr Pro Ala Pro Thr Ile Ala Ser Gly Pro Leu Ser Leu Ala Pro

275 280 285

Gly Ala Cys Ala Pro Ala Ala Gly Gly Ala Val His Thr Ala Gly Leu

290 295 300

Ala Pro Ala Cys Ala Ile Thr Ile Thr Ala Pro Leu Ala Gly Thr Cys

305 310 315 320

Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Thr Cys Ala Pro Ser

325 330 335

Val Val Leu Ala Gly Ala Leu Leu Leu Leu Thr Ile Pro Leu Gly Pro

340 345 350

Pro Met Ala Pro Val Gly Thr Thr Gly Gly Gly Ala Gly Cys Ser Cys

355 360 365

Ala Pro Pro Gly Gly Gly Gly Gly Gly Cys Gly Leu Ala Val Leu Pro

370 375 380

Ser Ala Ser Ala Ala Ala Pro Ala Thr Gly Gly Gly Gly Ala Gly Leu

385 390 395 400

Thr Ala Gly Leu Ala Leu Gly Ala Ala Gly Gly Thr Ala Val Leu Ala

405 410 415

Leu Ala Ala Gly Ala Ala Pro Gly Met Gly Gly Leu Pro Ala Ala Leu

420 425 430

Ala Pro Gly Gly Gly Leu Thr Ala Gly Leu Gly Leu Ala Leu Met Ala

435 440 445

Gly Ala Thr Ser Gly Ile Gly Met Leu Gly Gly Ala Ala Ala Gly Leu

450 455 460

Gly His Ala Gly Leu Thr Gly Gly Leu Ser Thr Ala Thr Leu Ala Thr

465 470 475 480

Thr Ala Ala Leu His Met Gly Ala Leu Pro Pro Ala

485 490

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (Homo sapiens)

<400> 4

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence (Homo sapiens)

<400> 4

tgtttgtctt gtggcaatac ac 22

Claims

1. A polynucleotide sequence selected from the group consisting of:

(2) (1) the complement of the polynucleotide sequence.

2. The polynucleotide sequence of claim 1,

The coding sequence of the signal peptide before the coding sequence of the anti-CD 30 single-chain antibody is shown as the 1 st to 63 rd nucleotide sequences of SEQ ID NO 1; and/or

The coding sequence of the light chain variable region of the anti-CD 30 single-chain antibody is shown as the nucleotide sequence of the 64 th to 414 th positions of SEQ ID NO. 1; and/or

The coding sequence of the heavy chain variable region of the anti-CD 30 single-chain antibody is shown as the nucleotide sequence at 460-792 site of SEQ ID NO. 1; and/or

the coding sequence of the human CD8 alpha hinge region is shown as the nucleotide sequence of the 793-position 933 of SEQ ID NO 1; and/or

the coding sequence of the human CD8 transmembrane region is shown as the nucleotide sequence at the 934-position 999 position of SEQ ID NO. 1; and/or

The coding sequence of the human 41BB intracellular region is shown as the nucleotide sequence of the 1000 th and 1143 rd positions of SEQ ID NO. 1; and/or

The coding sequence of the intracellular region of human CD3 zeta is shown in the nucleotide sequence at position 1144-1476 of SEQ ID NO. 1.

3. A fusion protein selected from the group consisting of:

4. the fusion protein of claim 3, wherein the fusion protein has one or more of the following characteristics:

The fusion protein also comprises a signal peptide at the N end of the anti-CD 30 single-chain antibody, preferably, the amino acid sequence of the signal peptide is shown as the amino acids 1-21 of SEQ ID NO. 2;

The amino acid sequence of the light chain variable region of the anti-CD 30 single-chain antibody is shown as amino acids 22-138 of SEQ ID NO 2;

The amino acid sequence of the heavy chain variable region of the anti-CD 30 single-chain antibody can be shown as the amino acid 154-264 of SEQ ID NO 2;

The amino acid sequence of the human CD8 alpha hinge region is shown as the 265 rd and 311 th amino acids of SEQ ID NO. 2;

The amino acid sequence of the transmembrane region of the human CD8 is shown as the amino acid at the 312-333 position of SEQ ID NO. 2;

The amino acid sequence of the human 41BB intracellular domain is shown as the amino acid 334-381 of SEQ ID NO 2;

The amino acid sequence of the intracellular domain of human CD3 ζ is shown as amino acids 382-492 of SEQ ID NO: 2.

5. A nucleic acid construct comprising the polynucleotide sequence of any one of claims 1-2;

Preferably, the nucleic acid construct is a vector;

More preferably, the nucleic acid construct is a retroviral vector comprising a replication initiation site, a 3 'LTR, a 5' LTR, and a polynucleotide sequence according to any one of claims 1-2.

6. A retrovirus containing the nucleic acid construct of claim 5, preferably containing the vector, more preferably containing the retroviral vector.

7. A genetically modified T-cell or a pharmaceutical composition comprising a genetically modified T-cell, wherein the cell comprises a polynucleotide sequence according to any one of claims 1 to 2, or comprises a nucleic acid construct according to claim 5, or is infected with a retrovirus according to claim 6, or stably expresses a fragment of a fusion protein according to any one of claims 3 to 4.

8. Use of a polynucleotide sequence according to any one of claims 1 to 2, a fusion protein according to any one of claims 3 to 4, a nucleic acid construct according to claim 5 or a retrovirus according to claim 6 in the preparation of an activated T cell.

9. Use of the polynucleotide sequence of any one of claims 1-2, the fusion protein of any one of claims 3-4, the nucleic acid construct of claim 5, the retrovirus of claim 6, or the genetically modified T-cell of claim 7, or a pharmaceutical composition thereof, in the preparation of a medicament for treating a CD 30-mediated disease;

Preferably, the CD 30-mediated disease is hodgkin's lymphoma.