CN107964549B

CN107964549B - Chimeric antigen receptor targeting CD22 and uses thereof

Info

Publication number: CN107964549B
Application number: CN201610913527.2A
Authority: CN
Inventors: 黄飞; 金涛; 王海鹰; 何凤; 史子啸
Original assignee: Shanghai Hrain Biotechnology Co ltd
Current assignee: Shanghai Hengrun Dasheng biopharmaceutical Co.,Ltd.
Priority date: 2016-10-20
Filing date: 2016-10-20
Publication date: 2020-12-08
Anticipated expiration: 2036-10-20
Also published as: CN107964549A

Abstract

The present invention relates to chimeric antigen receptors targeting CD22 and uses thereof. In particular, the invention provides a polynucleotide sequence selected from: (1) a polynucleotide sequence comprising the coding sequence of a single chain antibody against CD22, the coding sequence of a human CD8 α hinge region, the coding sequence of a human CD8 transmembrane region, the coding sequence of a human 41BB intracellular region, the coding sequence of a human CD3 ζ intracellular region, and optionally the coding sequence of a fragment of EGFR comprising extracellular domain III and extracellular domain IV, linked in sequence; and (2) the complement of the polynucleotide sequence of (1). The invention also provides a related fusion protein, a vector containing the coding sequence, and applications of the fusion protein, the coding sequence and the vector.

Description

Chimeric antigen receptor targeting CD22 and uses thereof

Technical Field

The invention belongs to the field of chimeric antigen receptors, and particularly relates to a CD 22-targeted chimeric antigen receptor and application thereof.

Background

Chimeric Antigen Receptor-T cell (CAR-T) T cell refers to a T cell that is genetically modified to recognize a specific Antigen of interest in an MHC non-limiting manner and to continuously activate expanded T cells. The international cell therapy association (interna) in 2012 indicates that biological immune cell therapy has become a fourth means for treating tumors besides surgery, radiotherapy and chemotherapy, and will become a necessary means for treating tumors in the future. CAR-T cell back-infusion therapy is the most clearly effective form of immunotherapy in current tumor therapy. A large number of studies show that the CAR-T cells can effectively recognize tumor antigens, cause specific anti-tumor immune response and remarkably improve the survival condition of patients.

Chimeric Antigen Receptors (CARs) are a core component of CAR-T, conferring on T cells the ability to recognize tumor antigens in an HLA-independent manner, which enables CAR-engineered T cells to recognize a broader range of targets than native T cell surface receptor TCRs. The basic design of a CAR includes a tumor-associated antigen (TAA) binding region (usually the scFV fragment from the antigen binding region of a monoclonal antibody), an extracellular hinge region, a transmembrane region, and an intracellular signaling region. The choice of antigen of interest is a key determinant for the specificity, efficacy of the CAR and safety of the genetically engineered T cells themselves.

With the continuous development of Chimeric Antigen Receptor T cell (CAR-T) technology, CAR-T can be divided into four generations.

The first generation CAR-T cells consist of an extracellular binding domain-single chain antibody (scFV), a transmembrane domain (TM), and an intracellular signaling domain-Immunoreceptor Tyrosine Activation Motif (ITAM), wherein the chimeric antigen receptor portions are linked as follows: scFv-TM-CD3 ζ. Although some specific cytotoxicity could be seen in the first generation CARs, it was found to be less effective when summarized in 2006 in clinical trials. The reason for this is because the first generation of CAR-T cells are rapidly depleted in the patient and have so poor persistence that CAR-T cells already apoptotic when they have not yet come into contact with a large number of tumor cells can elicit an anti-tumor cytotoxic effect, but rather less cytokine secretion, but their short survival time in vivo fails to elicit a persistent anti-tumor effect [ chieric g2D-modified T cells inhibition system T-cell lymphoma growth in a manner invasion multiple cytokines and cytotoxic pathways, Cancer research.2007, 67 (22): 11029 vs 11036).

Optimization of T cell activation signaling regions in CAR design of second generation CAR-T cells remains a hotspot of research. Complete activation of T cells relies on dual signaling and cytokine action. Wherein the first signal is a specific signal initiated by the recognition of an antigen peptide-MHC complex on the surface of an antigen presenting cell by the TCR; the second signal is a co-stimulatory signal. Second generation CARs have emerged as early as 1998 (Finney HM et al, J Immunol., 1998; 161 (6): 2791-7). The 2 nd generation CAR adds a costimulatory molecule in the intracellular signal peptide region, namely the costimulatory signal is assembled into the CAR, and can better provide an activation signal for CAR-T cells, so that the CAR can simultaneously activate the costimulatory molecule and the intracellular signal after identifying tumor cells, double activation is realized, and the proliferation and secretion capacity of the T cells and the anti-tumor effect can be obviously improved. The first well-studied T cell costimulatory signal receptor was CD28, which was capable of binding to a B7 family member on the surface of target cells. Co-stimulation of CD28 promotes T cell proliferation, IL-2 synthesis and expression, and enhances T cell resistance to apoptosis. Costimulatory molecules such as CD134(OX40) and 41BB (4-1BB) are subsequently presented to increase cytotoxicity and proliferative activity of T cells, maintain T cell responses, prolong T cell survival, and the like. Such second generation CARs produced unexpected results in subsequent clinical trials, with shaking frequently triggered since 2010 based on clinical reports of second generation CARs, with complete remission rates of up to 90% and above, especially for relapsed, refractory ALL patients.

The third generation CAR signal peptide region is integrated with more than 2 costimulatory molecules, so that the T cells can be continuously activated and proliferated, cytokines can be continuously secreted, and the capability of the T cells in killing tumor cells is more remarkable, namely, the new generation CAR can obtain stronger anti-tumor response. Most typically, U Pen Carl June is added with a 41BB stimulating factor under the action of CD28 stimulating factor.

Fourth generation CAR-T cells are supplemented with cytokines or co-stimulatory ligands, for example fourth generation CARs can produce IL-12, which can modulate the immune microenvironment-increase the activation of T cells, while activating innate immune cells to act to eliminate target antigen negative cancer cells, thus achieving a bi-directional regulatory effect [ chimielewski M, Abken h. the four generation of CARs, Expert Opin Biol ther, 2015; 15(8): 1145-54 ].

CD22 is widely expressed in acute lymphoblastic leukemia (BCP-ALL) which is a precursor of B cells, expressing CD22 antigen in 109 of 111 cases studied, with an expression rate of greater than 90%. Lars Nitschke reported that CD22 belongs to the sialic acid-binding immunoglobulin-like lectin (Siglecs) family. This family of proteins is expressed only in cells of the immune system, and all cell types in the autoimmune and adaptive immune systems express at least one Siglecs family protein. B cells express two members of this family, one of which is CD22 and the other is Siglec-G. Most Siglecs carry tyrosine immunoreceptor dependent Inhibitory Structures (ITIMs), which negatively regulate immunity. The tyrosine residues on the ITIMs are phosphorylated by Src family protein kinases, which results in binding sites for SH2(Src homology 2) -containing molecules. The most important SH2 domains of SHP1(SHP, SH2-domain stabilizing protein kinase) and SHP2 contain proteins that, when recruited to receptors containing ITIMs, cause dephosphorylation of intracellular material and inhibit several signaling pathways. For example, CD22 inhibits the BCR (B-cell receptor) induced calcium signaling pathway in normal B cells by recruiting SHP-1 to its own ITIMs. CD22 binds to ligands with α 2-6 coupled sialic acid. This binding directly regulates the binding of CD22 and BCR, thereby modulating the inhibitory function of CD22, which can regulate B cell migration and the threshold of BCR signaling.

Nitscheke reported that CD22 was 140kDa in length, possessed seven immunoglobulin-like domains, and was specifically expressed in B cell lines, starting from the pre-B cell (pre-B cell) stage. CD22 is present in various stages of B cells, including activated B cells and memory B cells; but lack expression in terminally differentiated plasma cells. The broad spectrum expression of CD22 in B cell development makes it an attractive molecule to target B cells.

Indeed, CD22 therapeutic antibodies have been synthesized and used clinically, and David j reports that epratuzumab, one of them, was successfully used clinically for the treatment of non-hodgkin lymphoma and systemic immune diseases such as systemic lupus erythematosus. An immunotoxin conjugated to the CD22 antibody reported simultaneously to CD22 was also used clinically in the treatment of acute lymphoma leukemia and achieved some efficacy. Mansfield E reports that a B cell-targeting Immunotoxin (Immunotoxin) has been successfully used in the treatment of B cell leukemias and lymphomas. These studies all demonstrate the feasibility and safety of treating B cell lymphomas by targeting CD22 without the adverse consequences of off-target effects.

The long-term presence of CD22CAR T cells has the disadvantage of having a surveillance effect on the disease, and the disadvantage of causing long-term defects in B cells. In addition to the signaling domain of the CAR itself, other factors can affect the lifespan of the CAR T, such as the cell culture system, the mode of gene transfer, the promoter of gene expression, the function and phenotype of the infused T cells, as well as the age of the patient, the type of disease affected, and the treatment regimen that has been experienced. One advantage of CAR-T cells is that they are active drugs, and once infused, physiological mechanisms regulate T cell balance, memory formation, and antigen-driven expansion. However, this treatment is not complete and T cells can miss the target and attack other tissues or expand too much beyond what is needed for treatment. Given that CAR-T cells have been included in the standard therapeutic range, it is very useful to design patient or drug-controlled turn-on or turn-off mechanisms to regulate the presence of CAR-T cells. For technical reasons, the shutdown mechanism is more easily applied to T cells. As one of them, the iCas9 system is under clinical study. When the cell expresses the iCas9, the small molecule compound can induce the iCas9 precursor molecule to form a dimer and activate an apoptosis pathway, thereby achieving the purpose of removing the cell. Small molecule AP1903 has been used to induce iCas9 dimers and clear T cells in graft versus host disease, demonstrating the feasibility of this approach (Making cutter clinical antibiotic candidates for adaptive T-cell therapy. clin Cancer Res. 2016Apr15; 22(8): 1875-84).

Disclosure of Invention

In a first aspect, the present invention provides a polynucleotide sequence selected from the group consisting of:

(1) a polynucleotide sequence comprising the coding sequence of a single chain antibody against CD22, the coding sequence of a human CD8 α hinge region, the coding sequence of a human CD8 transmembrane region, the coding sequence of a human 41BB intracellular region, the coding sequence of a human CD3 ζ intracellular region, and optionally the coding sequence of a fragment of EGFR comprising extracellular domain III and extracellular domain IV, linked in sequence; and

(2) (1) the complement of the polynucleotide sequence.

In one or more embodiments, the polynucleotide sequence further comprises a coding sequence for a signal peptide prior to the coding sequence for the anti-CD 22 single chain antibody. In one or more embodiments, the amino acid sequence of the signal peptide is as set forth in amino acids 1-21 of SEQ ID NO 2. In one or more embodiments, the heavy chain variable region of the anti-CD 22 single chain antibody has the amino acid sequence as set forth in amino acids 22-145 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the light chain variable region of the anti-CD 22 single chain antibody is shown as amino acids 161-267 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the human CD8 α hinge region is depicted as amino acids 268-314 of SEQ ID NO 2. In one or more embodiments, the amino acid sequence of the transmembrane region of human CD8 is depicted as amino acids 315-336 of SEQ ID NO 2. In one or more embodiments, the amino acid sequence of the intracellular domain of human 41BB is as shown in amino acids 337-384 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the intracellular domain of human CD3 ζ is as set forth in amino acids 385-495 of SEQ ID NO: 2. In one or more embodiments, the fragment of EGFR contains or consists of the extracellular domain III, the extracellular domain IV, and the transmembrane region of EGFR. In one or more embodiments, the fragment of EGFR comprises or consists of the amino acid sequence at position 310-646 of human EGFR. In one or more embodiments, the amino acid sequence of the fragment of EGFR is as set forth in amino acids 544-878 of SEQ ID NO 2. In one or more embodiments, the polynucleotide sequence further comprises a coding sequence for a GM-CSF receptor alpha chain signal peptide disposed N-terminal to the EGFR fragment. In one or more embodiments, the amino acid sequence of the signal peptide of the α chain of the GM-CSF receptor is as shown in amino acids 522-543 of SEQ ID NO: 2. In one or more embodiments, the polynucleotide sequence further comprises a coding sequence for a linker sequence linking the GM-CSF receptor alpha chain signal peptide to the intracellular domain of human CD3 ζ. In one or more embodiments, the amino acid sequence of the linker sequence is as depicted in amino acids 496-521 of SEQ ID NO 2.

In one or more embodiments, the coding sequence for the signal peptide preceding the coding sequence for the anti-CD 22 single chain antibody is as set forth in nucleotide sequences 1-63 of SEQ ID NO. 1. In one or more embodiments, the coding sequence for the heavy chain variable region of the anti-CD 22 single chain antibody is as shown in SEQ ID NO. 1, nucleotide sequences 64-435. In one or more embodiments, the coding sequence of the light chain variable region of the anti-CD 22 single-chain antibody is shown as the 481-801 nucleotide sequence of SEQ ID NO. 1. In one or more embodiments, the coding sequence for the human CD8 α hinge region is as set forth in nucleotide sequence Nos. 802-942 of SEQ ID NO: 1. In one or more embodiments, the coding sequence for the transmembrane region of human CD8 is as shown in nucleotide sequence 943-1008 of SEQ ID NO 1. In one or more embodiments, the coding sequence of the intracellular region of human 41BB is as shown in the nucleotide sequence 1009-1152 of SEQ ID NO: 1. In one or more embodiments, the coding sequence for the intracellular region of human CD3 ζ is as set forth in nucleotide sequences 1153-1485 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the linker sequence linking the signal peptide of the α chain of the GM-CSF receptor to the intracellular domain of human CD3 ζ is shown in SEQ ID NO:1, nucleotide sequence 1486-1563. In one or more embodiments, the coding sequence for the signal peptide of the α chain of the GM-CSF receptor is as shown in the nucleotide sequence 1564-1629 of SEQ ID NO: 1. In one or more embodiments, the coding sequence of the fragment of EGFR is as shown in nucleotide sequences 1630-2634 of SEQ ID NO 1. In one or more embodiments, the polynucleotide sequence encodes the amino acid sequence shown as positions 1-495 of SEQ ID NO. 2, or the amino acid sequence shown as positions 22-878 of SEQ ID NO. 2, or the amino acid sequence shown as SEQ ID NO. 2. In one or more embodiments, the polynucleotide sequence comprises or consists of the nucleotide sequence shown in SEQ ID NO. 1, positions 1-1485 of SEQ ID NO. 1, positions 64-1485 of SEQ ID NO. 1, or positions 64-2634 of SEQ ID NO. 1, or the nucleotide sequence shown in SEQ ID NO. 1, positions 1-1485 of SEQ ID NO. 1, positions 64-1485 of SEQ ID NO. 1, or the nucleotide sequence shown in positions 64-2634 of SEQ ID NO. 1.

In a second aspect, the invention provides a fusion protein selected from the group consisting of:

(1) a fusion protein comprising an anti-CD 22 single chain antibody, a human CD8 α hinge region, a human CD8 transmembrane region, a human 41BB intracellular region, and a human CD3 ζ intracellular region, linked in sequence, and optionally, a fragment of EGFR comprising extracellular domain III and extracellular domain IV; and

(2) a fusion protein derived from (1) by substituting, deleting or adding one or more amino acids in the amino acid sequence of the fusion protein defined in (1) and retaining the activity of activated T cells;

preferably, the anti-CD 22 single chain antibody is anti-CD 22 monoclonal antibody 32716.

In one or more embodiments, the fusion protein further comprises a signal peptide at the N-terminus of the anti-CD 22 single chain antibody. In one or more embodiments, the amino acid sequence of the signal peptide is as set forth in amino acids 1-21 of SEQ ID NO 2. In one or more embodiments, the heavy chain variable region of the anti-CD 22 single chain antibody has the amino acid sequence as shown in amino acids 22-145 of SEQ ID NO. 1. In one or more embodiments, the amino acid sequence of the light chain variable region of the anti-CD 22 single chain antibody can be shown as amino acids 161-267 of SEQ ID NO: 1. In one or more embodiments, the amino acid sequence of the human CD8 α hinge region is depicted as amino acids 268-314 of SEQ ID NO 1. In one or more embodiments, the amino acid sequence of the transmembrane region of human CD8 is depicted as amino acids 315-336 of SEQ ID NO: 1. In one or more embodiments, the amino acid sequence of the intracellular domain of human 41BB is as shown in amino acids 337-384 of SEQ ID NO. 1. In one or more embodiments, the amino acid sequence of the intracellular domain of human CD3 ζ is as set forth in amino acids 385-495 of SEQ ID NO: 1. In one or more embodiments, the fragment of EGFR contains or consists of the extracellular domain III, the extracellular domain IV, and the transmembrane region of EGFR. In one or more embodiments, the EGFR fragment comprises or consists of the amino acid sequence at position 310-646 of human EGFR. In one or more embodiments, the amino acid sequence of the EGFR fragment is as set forth in amino acids 544-878 of SEQ ID NO 1. In one or more embodiments, the fusion protein further comprises a GM-CSF receptor alpha chain signal peptide disposed N-terminal to the EGFR fragment. In one or more embodiments, the amino acid sequence of the signal peptide of the α chain of the GM-CSF receptor is as shown in amino acids 522-543 of SEQ ID NO: 2. In one or more embodiments, the fusion protein further comprises a linker sequence linking the GM-CSF receptor alpha chain signal peptide to the intracellular domain of human CD3 ζ. In one or more embodiments, the amino acid sequence of the linker sequence is as depicted in amino acids 496-521 of SEQ ID NO 2. In one or more embodiments, the amino acid sequence of the fusion protein is as set forth in amino acids 22-495 of SEQ ID NO. 2 or as set forth in amino acids 22-878 of SEQ ID NO. 2, or as set forth in SEQ ID NO. 2.

In a third aspect, the invention provides a nucleic acid construct comprising a polynucleotide sequence as described herein.

In one or more embodiments, the nucleic acid construct is a vector. In one or more embodiments, the nucleic acid construct is a retroviral vector comprising a replication initiation site, a 3 'LTR, a 5' LTR, pis packaging signal, woodchuck hepatitis virus post-transcriptional regulatory elements, polynucleotide sequences described herein, and optionally a selectable marker.

In a fourth aspect, the invention provides a retrovirus containing a nucleic acid construct as described herein, preferably containing the vector, more preferably containing the retroviral vector.

In a fifth aspect, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a nucleic acid construct as described herein, or infected with a retrovirus as described herein, or stably expressing a fusion protein as described herein and optionally a fragment of EGFR comprising extracellular domain III, extracellular domain IV and optionally a transmembrane region.

In a sixth aspect, the invention provides a pharmaceutical composition comprising a genetically modified T cell as described herein.

In a seventh aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct or retrovirus as described herein in the preparation of an activated T cell.

In an eighth aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct, retrovirus, or genetically modified T cell as described herein, or a pharmaceutical composition thereof, in the manufacture of a medicament for the treatment of a CD 22-mediated disease.

In one or more embodiments, the CD 22-mediated disease is non-hodgkin's lymphoma and acute lymphoma leukemia.

Drawings

FIG. 1 is a schematic representation of an RV-CD22-BBz retroviral expression vector. SP: a signal peptide; VL: a light chain variable region; and Lk: linker (G4S) 3; VH: a heavy chain variable region; h: a CD8 a hinge region; TM: the CD8 transmembrane region; WPRE: a woodchuck hepatitis virus post-transcriptional regulatory element for increasing the stability of viral transcripts.

FIG. 2 is a partial sequencing peak plot of the RV-CD22-BBz retrovirus expression plasmid.

FIG. 3 is a schematic diagram of RV-CD22-BBz-tEGFR retroviral expression vectors. SP: a signal peptide; VL: a light chain variable region; and Lk: linker (G4S) 3; VH: a heavy chain variable region; h: a CD8 a hinge region; TM: the CD8 transmembrane region; 2A: a P2A peptide; WPRE: woodchuck hepatitis virus posttranscriptional regulatory element.

FIG. 4 is a partial sequencing peak plot of the RV-CD22-BBz-tEGFR retrovirus expression plasmid.

FIG. 5 shows the expression efficiency of CD22-BBz-tEGFR CART by retrovirus-infected T cells for 72 hours by flow cytometry.

Figure 6 shows target cell CD22 expression by flow cytometry.

FIG. 7 shows CD107a expression in 5-day-old prepared CD22-BBz-tEGFR CART cells co-cultured with target cells for 5 hours.

FIG. 8 shows INF γ secretion by 5-hour coculture of 5-day-old CD22-BBz-tEGFR CART cells with target cells.

FIG. 9 shows the killing effect on tumor cells after 5-day preparation of CD22-BBz-tEGFR CART cells co-cultured with target cells for 5 hours.

Detailed Description

The present invention provides a Chimeric Antigen Receptor (CAR) that targets CD 22. The CAR comprises an anti-CD 22 single chain antibody, a human CD8 α hinge region, a human CD8 transmembrane region, a human 41BB intracellular region, a human CD3 ζ intracellular region, and optionally, an EGFR fragment comprising extracellular domain III and extracellular domain IV, connected in sequence.

anti-CD 22 single chain antibodies suitable for use in the present invention may be derived from a variety of anti-CD 22 monoclonal antibodies known in the art. Optionally, the heavy chain variable region and the light chain variable region may be linked together by a linker sequence. Such single chain antibodies that may be exemplified include, but are not limited to, single chain antibodies with clone numbers HA22, BL22, and m 971. In certain embodiments, the monoclonal antibody is the monoclonal antibody having clone number m 971. In certain embodiments, the heavy chain variable region of the anti-CD 22 single chain antibody has the amino acid sequence shown as amino acid residues 22-145 of SEQ ID NO. 2. In other embodiments, the light chain variable region of the anti-CD 22 single chain antibody has the amino acid sequence as shown in amino acid residues 161-267 of SEQ ID NO: 2.

The amino acid sequence of the human CD8 alpha hinge region suitable for use in the present invention can be shown as amino acids 268 and 314 of SEQ ID NO 2.

The human CD8 transmembrane region suitable for use in the present invention can be the various human CD8 transmembrane region sequences commonly used in the art for CARs. In certain embodiments, the amino acid sequence of the transmembrane region of human CD8 is depicted as amino acids 315 and 336 of SEQ ID NO 2.

The 41BB suitable for use in the present invention can be any of the various 41 BBs known in the art for use in CARs. As an illustrative example, the present invention uses the 41BB shown in the amino acid sequence 337-384 of SEQ ID NO. 2.

The intracellular domain of human CD3 ζ suitable for use in the present invention may be various intracellular domains of human CD3 ζ conventionally used in CARs in the art. In certain embodiments, the amino acid sequence of the intracellular domain of human CD3 ζ is as set forth in amino acids 385-495 of SEQ ID NO 2.

The above-mentioned portions forming the fusion protein of the present invention, such as the light chain variable region and the heavy chain variable region of the anti-CD 22 single-chain antibody, the human CD8 α hinge region, the human CD8 transmembrane region, 41BB, and the human CD3 ζ intracellular region, may be directly linked to each other, or may be linked by a linker sequence. The linker sequence may be one known in the art to be suitable for use with antibodies, for example, a G and S containing linker sequence. Typically, the linker contains one or more motifs which repeat back and forth. For example, the motif may be GGGS, GGGGS, SSSSG, GSGSA and GGSGG. Preferably, the motifs are adjacent in the linker sequence with no intervening amino acid residues between the repeats. The linker sequence may comprise 1, 2,3, 4 or 5 repeat motifs. The linker may be 3 to 25 amino acid residues in length, for example 3 to 15, 5 to 15, 10 to 20 amino acid residues. In certain embodiments, the linker sequence is a polyglycine linker sequence. The number of glycines in the linker sequence is not particularly limited, and is usually 2 to 20, such as 2 to 15, 2 to 10, 2 to 8. In addition to glycine and serine, other known amino acid residues may be contained in the linker, such as alanine (a), leucine (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q), and the like. As an example, the linker may consist of the amino acid sequence of any one of SEQ ID NO 7-18. In certain embodiments, the anti-CD 22 single chain antibody of the invention consists of (GGGGS) between the light chain variable region and the heavy chain variable region_nAnd (b) connecting, wherein n is an integer of 1-5.

In certain embodiments, the amino acid sequence of the CAR of the invention is as set forth in amino acids 22-495 of SEQ ID No. 2 or as set forth in amino acids 1-495 of SEQ ID No. 2. In certain embodiments, the CAR of the invention further comprises in its amino acid sequence an extracellular domain III and extracellular domain IV-containing fragment of EGFR, as described below, a signal peptide thereof, and a linker sequence. Thus, in certain embodiments, the amino acid sequence of the CAR of the invention is as set forth in amino acids 22-878 of SEQ ID NO. 2, or as set forth in SEQ ID NO. 2.

It will be appreciated that in gene cloning procedures it is often necessary to design appropriate cleavage sites which will introduce one or more irrelevant residues at the end of the expressed amino acid sequence without affecting the activity of the sequence of interest. In order to construct a fusion protein, facilitate expression of a recombinant protein, obtain a recombinant protein that is automatically secreted outside of a host cell, or facilitate purification of a recombinant protein, it is often necessary to add some amino acids to the N-terminus, C-terminus, or other suitable regions within the recombinant protein, for example, including, but not limited to, suitable linker peptides, signal peptides, leader peptides, terminal extensions, and the like. Thus, the amino-terminus or the carboxy-terminus of the fusion protein of the invention (i.e., the CAR) may also contain one or more polypeptide fragments as protein tags. Any suitable label may be used herein. For example, the tag may be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, B, gE and Ty 1. These tags can be used to purify proteins.

The invention also includes a CAR represented by the amino acid sequence at positions 22-495 of SEQ ID NO. 2, a CAR represented by the amino acid sequence at positions 22-878 of SEQ ID NO. 2, a CAR represented by the amino acid sequence at positions 1-495 of SEQ ID NO. 2, or a mutant of the CAR represented by SEQ ID NO. 2. These mutants include: an amino acid sequence that has at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to the CAR and retains the biological activity (e.g., activating T cells) of the CAR. Sequence identity between two aligned sequences can be calculated using, for example, BLASTp from NCBI.

Mutants also include: an amino acid sequence having one or several mutations (insertions, deletions or substitutions) in the amino acid sequence shown in positions 22-495 of SEQ ID NO 2, the amino acid sequence shown in positions 22-878 of SEQ ID NO 2, the amino acid sequence shown in positions 1-495 of SEQ ID NO 2 or the amino acid sequence shown in SEQ ID NO 2, while still retaining the biological activity of the CAR. The number of mutations usually means within 1-10, such as 1-8, 1-5 or 1-3. The substitution is preferably a conservative substitution. For example, conservative substitutions with amino acids of similar or similar properties are not typically used in the art to alter the function of a protein or polypeptide. "amino acids with similar or analogous properties" include, for example, families of amino acid residues with analogous side chains, including amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine tryptophan, histidine). Thus, substitution of one or more sites with another amino acid residue from the same side chain species in the polypeptide of the invention will not substantially affect its activity.

The present invention includes polynucleotide sequences encoding the fusion proteins of the present invention. The polynucleotide sequences of the invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The invention also includes degenerate variants of the polynucleotide sequences encoding the fusion proteins, i.e., nucleotide sequences which encode the same amino acid sequence but differ in nucleotide sequence.

The polynucleotide sequences described herein can generally be obtained by PCR amplification. Specifically, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the relevant sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order. For example, in certain embodiments, the polynucleotide sequence encoding the fusion protein described herein is as set forth in nucleotides 64-1485 of SEQ ID NO. 1 or as set forth in nucleotides 1-1485 of SEQ ID NO. 1.

In certain embodiments, the polynucleotide sequences of the invention further comprise nucleotide sequences encoding fragments of EGFR.

The EGFR suitable for use in the present invention may be an EGFR known in the art, e.g., from human. EGFR contains N-terminal extracellular domains I and II, extracellular domain III, extracellular domain IV, transmembrane, juxtamembrane domain and tyrosine kinase domain. The present invention preferably uses a truncated EGFR ("tfegfr", i.e., a fragment of EGFR as described herein), particularly a truncated EGFR that does not include its intracellular regions (membrane proximal domain and tyrosine kinase domain). In certain embodiments, EGFR that does not include an intracellular region may be further truncated to include no extracellular domains I and II. Thus, in certain embodiments, the EGFR used in the present invention contains or consists of the extracellular domain III, the extracellular domain IV and the transmembrane region of EGFR. In certain embodiments, the tEGFR comprises or consists of the amino acid sequence at positions 310 and 646 of the human EGFR, wherein the amino acid sequence at positions 310 and 480 is the extracellular domain III of the human EGFR, the amino acid sequence at positions 481 and 620 is the extracellular domain IV of the human EGFR, and the amino acid sequence at positions 621 and 646 is the transmembrane region of the human EGFR. In certain embodiments, the extracellular domains III and IV of the amino acid sequence of tEGFR are the amino acid sequences as shown in amino acids 544-855 of SEQ ID NO: 2. In certain embodiments, the transmembrane region of the tEGFR is represented by amino acids 856-878 of SEQ ID NO 2.

To promote the expression of tEGFR, a leader sequence may also be placed at its N-terminus. In certain embodiments, the invention uses a signal peptide from the α chain of the GM-CSF receptor ("GMCSFR"). In certain embodiments, the amino acid sequence of the signal peptide is as set forth in amino acids 522-543 of SEQ ID NO. 2.

In addition, the signal peptide and the coding sequence for tEGFR can be linked to the coding sequence for the intracellular domain of human CD3 ζ in the CAR of the invention by the coding sequence for the P2A polypeptide. In one or more embodiments, the amino acid sequence of the P2A peptide is depicted as amino acids 496-521 of SEQ ID NO 2.

Thus, in certain embodiments, a polynucleotide sequence of the invention comprises a coding sequence for a CAR of the invention, a coding sequence for a P2A polypeptide, a coding sequence for a signal peptide from the α chain of the GM-CSF receptor, and a coding sequence for tfegfr. In certain embodiments, the polynucleotide of the invention has the sequence shown as nucleotides 64-2634 of SEQ ID NO. 1 or as shown in SEQ ID NO. 1.

The invention also relates to nucleic acid constructs comprising the polynucleotide sequences described herein, and one or more control sequences operably linked to these sequences. The polynucleotide sequences of the invention can be manipulated in a variety of ways to ensure expression of the fusion proteins (CAR and/or tfegfr). The nucleic acid construct may be manipulated prior to insertion into the vector, depending on the type of expression vector or requirements. Techniques for altering polynucleotide sequences using recombinant DNA methods are known in the art.

The control sequence may be an appropriate promoter sequence. The promoter sequence is typically operably linked to the coding sequence of the protein to be expressed. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention. The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

In certain embodiments, the nucleic acid construct is a vector. Expression of a polynucleotide sequence of the invention is typically achieved by operably linking the polynucleotide sequence to a promoter and incorporating the construct into an expression vector. The vector may be suitable for replication and integration into eukaryotic cells. Typical cloning vectors contain transcriptional and translational terminators, initiation sequences, and promoters that may be used to regulate the expression of the desired nucleic acid sequence.

The polynucleotide sequences of the present invention can be cloned into many types of vectors. For example, it can be cloned into plasmids, phagemids, phage derivatives, animal viruses and cosmids. Further, the vector is an expression vector. The expression vector may be provided to the cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and Molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses.

Generally, suitable vectors comprise an origin of replication, a promoter sequence, a convenient restriction enzyme site, and one or more selectable markers that function in at least one organism (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193).

For example, in certain embodiments, the invention uses a retroviral vector that contains a replication initiation site, a 3 'LTR, a 5' LTR, pis packaging signal, woodchuck hepatitis virus post-transcriptional regulatory elements, a multiple cloning site, polynucleotide sequences described herein, and optionally a selectable marker.

An example of a suitable promoter is the immediate early Cytomegalovirus (CMV) promoter sequence. The promoter sequence is a strong constitutive promoter sequence capable of driving high level expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is elongation growth factor-1 α (EF-1 α). However, other constitutive promoter sequences may also be used, including, but not limited to, the simian virus 40(SV40) early promoter, the mouse mammary cancer virus (MMTV), the Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, the MoMuLV promoter, the avian leukemia virus promoter, the EB virus immediate early promoter, the rous sarcoma virus promoter, and human gene promoters such as, but not limited to, the actin promoter, myosin promoter, heme promoter, and creatine kinase promoter. Further, inducible promoters are also contemplated. The use of an inducible promoter provides a molecular switch that is capable of turning on expression of a polynucleotide sequence operably linked to the inducible promoter during periods of expression and turning off expression when expression is undesirable. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter.

To assess the expression of the CAR polypeptide or portion thereof, the expression vector introduced into the cells can also comprise either or both of a selectable marker gene or a reporter gene to facilitate identification and selection of expressing cells from a population of cells sought to be transfected or infected by the viral vector. In other aspects, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in a host cell. Useful selectable markers include, for example, antibiotic resistance genes, such as neo and the like.

Reporter genes are used to identify potentially transfected cells and to evaluate the functionality of regulatory sequences. After the DNA has been introduced into the recipient cell, the expression of the reporter gene is assayed at an appropriate time. Suitable reporter genes may include genes encoding luciferase, β -galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein. Suitable expression systems are well known and can be prepared using known techniques or obtained commercially.

Methods for introducing and expressing genes into cells are known in the art. The vector may be readily introduced into a host cell by any method known in the art, for example, mammalian, bacterial, yeast or insect cells. For example, the expression vector may be transferred into a host cell by physical, chemical or biological means.

Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Chemical means of introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads; and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

Biological methods for introducing polynucleotides into host cells include the use of viral vectors, particularly retroviral vectors, which have become the most widely used method for inserting genes into mammalian, e.g., human, cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, and the like. Many virus-based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The selected gene can be inserted into a vector and packaged into a retroviral particle using techniques known in the art. The recombinant virus can then be isolated and delivered to the subject cells in vivo or ex vivo. Many retroviral systems are known in the art. In some embodiments, an adenoviral vector is used. Many adenoviral vectors are known in the art. In one embodiment, a lentiviral vector is used.

Thus, in certain embodiments, the invention also provides a retrovirus for activating T cells, the virus comprising a retroviral vector as described herein and corresponding packaging genes, such as gag, pol and vsvg.

T cells suitable for use in the present invention may be of various types from various sources. For example, T cells may be derived from PBMCs of B cell malignancy patients.

In certain embodiments, after T cells are obtained, activation may be stimulated with an appropriate amount (e.g., 30-80 ng/ml, such as 50ng/ml) of CD3 antibody prior to culturing in an appropriate amount (e.g., 30-80 IU/ml, such as 50IU/ml) of IL2 medium for use.

Thus, in certain embodiments, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a retroviral vector as described herein, or infected with a retrovirus as described herein, or prepared by a method as described herein, or stably expressing a fusion protein as described herein and optionally a tfegfr.

The CAR-T cells of the invention can undergo robust in vivo T cell expansion and sustained at high levels in the blood and bone marrow for extended amounts of time, and form specific memory T cells. Without wishing to be bound by any particular theory, the CAR-T cells of the invention can differentiate into a central memory-like state in vivo upon encountering and subsequently depleting target cells expressing a surrogate antigen.

The invention also includes a class of cell therapies in which T cells are genetically modified to express a CAR and optionally a tfegfr as described herein, and the CAR-T cells are injected into a recipient in need thereof. The injected cells are capable of killing tumor cells of the recipient. Unlike antibody therapy, CAR-T cells are able to replicate in vivo, resulting in long-term persistence that can lead to sustained tumor control.

The anti-tumor immune response elicited by the CAR-T cells can be an active or passive immune response. Additionally, the CAR-mediated immune response can be part of an adoptive immunotherapy step, in which the CAR-T cells induce an immune response specific for the antigen-binding portion in the CAR.

Thus, the diseases that can be treated with the CARs, their coding sequences, nucleic acid constructs, expression vectors, viruses, and CAR-T cells of the invention are preferably CD 22-mediated diseases, preferably non-hodgkin's lymphoma and acute lymphoma leukemia.

The CAR-modified T cells of the invention can be administered alone or as a pharmaceutical composition in combination with diluents and/or with other components such as relevant cytokines or cell populations. Briefly, a pharmaceutical composition of the invention may comprise CAR-T cells as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include buffers such as neutral buffered saline, sulfate buffered saline, and the like; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; a protein; polypeptides or amino acids such as glycine; an antioxidant; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and a preservative.

The pharmaceutical compositions of the present invention may be administered in a manner suitable for the disease to be treated (or prevented). The amount and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease.

When referring to an "immunologically effective amount", "an anti-tumor effective amount", "a tumor-inhibiting effective amount", or a "therapeutic amount", the precise amount of the composition of the invention to be administered can be determined by a physician, taking into account the age, weight, tumor size, extent of infection or metastasis, and individual differences in the condition of the patient (subject). It can be generally pointed out that: pharmaceutical compositions comprising T cells described herein can be in the range of 10⁴To 10⁹Dosage of individual cells/kg body weight, preferably 10⁵To 10⁶Dosage of individual cells/kg body weight. The T cell composition may also be administered multiple times at these doses. Cells can be administered by using infusion techniques well known in immunotherapy (see, e.g., Rosenberg et al, New Eng.J.of Med.319:1676, 1988). Optimal dosages and treatment regimens for a particular patient can be readily determined by those skilled in the medical arts by monitoring the patient for signs of disease and adjusting the treatment accordingly.

Administration of the subject composition may be carried out in any convenient manner, including by spraying, injection, swallowing, infusion, implantation or transplantation. The compositions described herein can be administered to a patient subcutaneously, intradermally, intratumorally, intranodal, intraspinally, intramuscularly, by intravenous injection, or intraperitoneally. In one embodiment, the T cell composition of the invention is administered to a patient by intradermal or subcutaneous injection. In another embodiment, the T cell composition of the invention is preferably administered by intravenous injection. The composition of T cells can be injected directly into the tumor, lymph node or site of infection.

In some embodiments of the invention, the CAR-T cells of the invention or compositions thereof can be combined with other therapies known in the art. Such therapies include, but are not limited to, chemotherapy, radiation therapy, and immunosuppressive agents. For example, treatment may be combined with radiation or chemotherapeutic agents known in the art for the treatment of CD22 mediated diseases.

Herein, "anti-tumor effect" refers to a biological effect that can be represented by a reduction in tumor volume, a reduction in tumor cell number, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer.

"patient," "subject," "individual," and the like are used interchangeably herein and refer to a living organism, such as a mammal, that can elicit an immune response. Examples include, but are not limited to, humans, dogs, cats, mice, rats, and transgenic species thereof.

The invention adopts the gene sequence of an anti-CD 22 antibody (particularly scFv derived from clone number m 971), searches the gene sequence information of a human CD8 alpha hinge region, a human CD8 transmembrane region, a human 41BB intracellular region and a human CD3 zeta intracellular region from an NCBI GenBank database, synthesizes gene segments of a chimeric antigen receptor anti-CD 22scFv-CD8 hinge region-CD 8TM-41BB-CD3 zeta and anti-CD 22scFv-CD8 hinge region-CD 8TM-41BB-CD3 zeta-GMCSFR leader sequence-tEGFR in a whole gene manner, and inserts the gene segments into a retroviral vector. The recombinant plasmid packages the virus in 293T cells, infects T cells, and causes the T cells to express the chimeric antigen receptor. The invention realizes the transformation method of the T lymphocyte modified by the chimeric antigen receptor gene based on a retrovirus transformation method. The method has the advantages of high transformation efficiency, stable expression of exogenous genes, and capability of shortening the time for in vitro culture of T lymphocytes to reach clinical level number. On the surface of the transgenic T lymphocyte, the transformed nucleic acid is expressed by transcription and translation. The CAR-T cell prepared by the invention has strong killing function on specific tumor cells, and the killing efficiency exceeds 80% under the condition that the effective target ratio is 10: 1. Furthermore, the CARs of the invention also carry a tEGFR module, the spatial conformation of which is tightly bound to the pharmaceutical grade anti-EGFR monoclonal antibody cetuximab, which can serve as a marker on the cell surface, while also being suitable for in vivo tracking of T cells (detectable by flow and immunohistochemistry); it may also be cleared in vivo by tuximab, i.e., tuximab may be added when the CAR of the invention is not desired to function, safely and effectively controlling the CAR-T cells to function in vivo. Thus, the CARs of the invention also have in vivo tracing and safety switching functions.

The present invention is described in further detail by referring to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Accordingly, the present invention should in no way be construed as limited to the following examples, but rather should be construed to include any and all variations which become apparent in light of the teachings provided herein. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art.

The NT cells used in the examples were untransfected T cells of the same origin as in example 4, and used as control cells. Raji and K562 were derived from ATCC cell banks. The expression level of CD22 in Raji cells was detected by using CD22 antibody. As shown in fig. 6, the expression level of CD22 in Raji cells was 99.9%.

Example 1: determination of the sequence of the CD22-scFv-CD8 alpha-CD 28-41BB-CD3 zeta Gene

The sequence information of human CD8 alpha hinge region, human CD8 alpha transmembrane region, 41BB intracellular region and human CD3 zeta intracellular region gene is searched from NCBI website database, the cloning number of the anti-CD 22 single-chain antibody is m971, and the sequences are subjected to codon optimization on website http:// sg.

The sequences are connected in sequence by adopting overlapping PCR according to the sequences of anti-CD 22scFv, human CD8 alpha hinge region gene, human CD8 alpha transmembrane region gene, 41BB intracellular region gene and human CD3 zeta intracellular region gene, and different enzyme cutting sites are introduced at the connection positions of the sequences to form complete CD22CAR gene sequence information.

The nucleotide sequence of the CAR molecule was double-digested with NotI (NEB) and EcoRI (NEB), inserted into the NotI-EcoRI site of the retrovirus MSCV (Addgene) by T4 ligase (NEB) and transformed into competent E.coli (DH 5. alpha.).

The recombinant plasmid is sent to Shanghai Biotechnology Limited for sequencing, and the sequencing result is compared with the fitted CD22CAR sequence to verify whether the sequence is correct. The sequencing primer is as follows:

and (3) sense: AGCATCGTTCTGTGTTGTCTC (SEQ ID NO: 3);

antisense: TGTTTGTCTTGTGGCAATACAC (SEQ ID NO: 4).

After the sequencing is correct, plasmids are extracted and purified by using a plasmid purification kit of Qiagen company, and 293T cells are transfected by a plasmid calcium phosphate method for purifying the plasmids to carry out a retrovirus packaging experiment.

The plasmid map constructed in this example is shown in FIG. 1. FIG. 2 shows a partial sequencing peak plot of the retroviral expression plasmid.

Example 2: determination of the sequence of the CD22CAR-GMCSFR leader-tEGFR Gene

The gene sequence information of the human EGFR extracellular region is searched from an NCBI website database, and the sequence is subjected to codon optimization on a website http:// sg. idtdna. com/site, so that the coding sequence is more suitable for human cell expression under the condition of unchanging an encoding amino acid sequence.

The sequences are connected in sequence by adopting overlapping PCR according to the CD22CAR, the GMCSFR leader sequence and the tEGFR of the embodiment 1, and different enzyme cutting sites are introduced at the joints of the sequences to form complete CD22CAR-GMCSFR leader sequence-tEGFR gene sequence information.

The recombinant plasmid is sent to Shanghai Biotechnology Limited company for sequencing, and the sequencing result is compared with the sequence of the synthesized CD22CAR-GMCSFR leader sequence-tEGFR to verify whether the sequence is correct. The sequencing primer is as follows:

and (3) sense: AGCATCGTTCTGTGTTGTCTC (SEQ ID NO: 5);

antisense: TGTTTGTCTTGTGGCAATACAC (SEQ ID NO: 6).

The plasmid map constructed in this example is shown in FIG. 3. FIG. 4 shows a partial sequencing peak plot of the retroviral expression plasmid.

Example 3: retroviral packaging

1. Day 1: 293T cells should be less than 20 passages, but not overgrown. At 0.6X 10⁶Cells/ml were plated, 10ml of DMEM medium was added to a 10cm dish, the cells were mixed well and cultured overnight at 37 ℃.

2. Day 2: the 293T cell fusion degree reaches about 90%, and transfection is carried out (generally, the plate laying time is about 14-18 h); preparing plasmid complex, wherein the amount of each plasmid is 12.5ug of MSCV skeleton, 10ug of Gag-pol, 6.25ug of VSVg, and CaCl₂250ul，H₂O1 ml, the total volume is 1.25 ml; in another tube, an equal volume of HBS to plasmid complex was added, and the plasmid complex was vortexed for 20 seconds. The mixture was gently added to 293T dishes, incubated at 37 ℃ for 4h, medium removed, washed once with PBS, and re-added to the pre-warmed fresh medium.

3. Day 4: after transfection for 48h, the supernatant was collected, filtered through a 0.45um filter, dispensed and stored at-80 ℃, and preheated fresh DMEM medium was added continuously.

Example 4: retroviral infection of human T cells

1. Separating with Ficcol separation solution (tertiary sea of Tianjin) to obtain relatively pure CD3+ T cells, and adjusting cell density to 1 × 10 with medium containing 5% AB serum X-VIVO (LONZA)⁶and/mL. The cells were inoculated at 1 ml/well with anti-human 50ng/ml CD3 antibody (Beijing Hokkimeiyuan) and 50ng/ml CD28 antibody (Beijing Hokkimeiyuan), and 100IU/ml interleukin 2 (Beijing double-Lut) was added to stimulate and culture for 48 hours, and then infected with the virus prepared in example 3;

2. every other day after T cell activation culture, the plates were plated in 24-well plates with 250. mu.l/well in Retronectin (Takara) coated non-tissue-treated plates diluted in PBS to a final concentration of 15. mu.g/ml. Protected from light and kept at 4 ℃ overnight for use.

3. After two days of T cell activation culture, 2 coated 24-well plates were removed, the coating solution was aspirated away, and HBSS containing 2% BSA was added and blocked at room temperature for 30 min. The volume of blocking solution was 500. mu.l per well, and the blocking solution was aspirated and the plate washed twice with HBSS containing 2.5% HEPES.

4. The virus solution prepared in example 3 was added to wells 2ml of virus solution per well, centrifuged at 32 ℃ and 2000g for 2 h.

5. The supernatant was discarded, and activated T cells were added to each well of a 24-well plate at 1X 10⁶The volume is 1ml, and the culture medium is T cell culture medium added with IL-2200 IU/ml. Centrifuge at 30 ℃ for 10min at 1000 g.

6. After centrifugation, the plates were placed at 37 ℃ in 5% CO₂Culturing in an incubator.

7. 24h after infection, the cell suspension was aspirated and centrifuged at 1200rpm, 4 ℃ for 7 min.

8. After the cells are infected, the density of the cells is observed every day, and a T cell culture solution containing IL-2100 IU/ml is supplemented at a proper time to maintain the density of the T cells at 5 x 10⁵Cells were expanded at around/ml.

Thus, CART cells infected with the retroviruses shown in example 3, respectively, were obtained, and named CD 22-bbzccart cells (expressing the CD22CAR of example 1) and CD 22-BBz-tfegfr CART cells (expressing the CD22CAR and tfegfr of example 2), respectively.

Example 5: flow cytometry for detecting proportion of infected T lymphocytes and expression of surface CAR protein

The CAR-T cells and NT cells (control) prepared in example 4 were collected by centrifugation 72 hours after infection, washed 1 time with PBS, the supernatant was discarded, the corresponding antibody was added and washed with PBS 30min in the dark, resuspended, and finally detected by flow cytometry. CAR + was detected by anti-mouse IgG F (ab') antibody (Jackson Immunoresearch).

The results are shown in fig. 5. FIG. 5 shows that the expression efficiency of CD22-BBz-tEGFR CAR + reaches 42.6% 72 hours after T cells are infected with the retrovirus prepared in example 3.

Example 6: detection of CD107a expression following coculture of CAR-T cells with target cells

1. A V-bottom 96-well plate is taken, and 2X 10 CART or NT cells prepared in example 4 are added into each well⁵And 2X 10 of target cells (Raji) or control cells (K562)⁵Each cell was resuspended in 100ul of IL-2-free X-VIVO complete medium, BD Golgistop (containing Brazilian aurin, 1. mu.l of BD Golgistop was added to 1ml of the medium), 2ul of CD107a antibody (1:50) was added to each well, incubated at 37 ℃ for 5 hours, and the cells were collected.

2. The samples were centrifuged to remove the medium, washed once with PBS, 400g, and centrifuged at 4 ℃ for 5 minutes. The supernatant was discarded, an appropriate amount of specific surface antibody (CD107a antibody, Biolegend) was added to each tube, the volume was resuspended at 100. mu.l, and incubated on ice for 30 minutes in the absence of light.

3. Cells were washed 1 time with 3mL PBS per tube and centrifuged at 400g for 5 min. The supernatant was carefully aspirated.

4. The appropriate amount of PBS was resuspended and CD107a was detected by flow cytometry.

The results are shown in fig. 7. FIG. 7 shows that the percentage of CD107a secretion by CD22-BBz-tEGFR CART cells in Raji cells positive for CD8 is 42.6% and the percentage of CD107a secretion by CD22-BBz-tEGFR cells in Raji cells positive for CD4 is 46.8%.

Example 7: INF-gamma secretion assay after co-culture of CAR-T cells with target cells

1. The prepared CAR-T cells were taken and resuspended in Lonza medium, and the cell concentration was adjusted to 1X 10⁶/mL。

2. The experimental group contained 2X 10 target cells (Raji) or negative control cells (K562) per well⁵CD 22-BBz-tEGFRCRAR-T cell 2X 10⁵200. mu.l of Lonza medium without IL-2. Mix well and add to 96-well plate. Simultaneously adding BD GolgiPlug (containing Brazilian gold leaf trefoil glycoside, adding 1 μ l BD GolgiPlug to 1ml cell culture medium), mixing well, and incubating at 37 deg.C for 5-6 hr. Cells were collected as experimental groups.

3. Cells were washed 1 time with 1mL of PBS per tube and centrifuged at 300g for 5 minutes. The supernatant was carefully aspirated or decanted.

After washing the cells with PBS, 250. mu.l/EP tube fixation/permeation solution was added and incubated at 4 ℃ for 20 minutes to fix the cells and rupture the membranes. Cells were washed 2 times 1 mL/time with 1 XBD Perm/WashTM buffer.

5. Staining with intracellular factor, taking appropriate amount of IFN-gamma cytokine fluorescent antibody or negative control, and performing with BDPerm/Wash^TMThe buffer was diluted to 50. mu.l. Resuspending the fixed and disrupted cells thoroughly with the antibody dilution, incubating at 4 ℃ in the dark for 30min, 1 XBD Perm/Wash^TMCells were washed 2 times with 1 mL/time buffer and then resuspended in PBS.

6. And (4) detecting by using a flow cytometer.

The results are shown in FIG. 8. The results showed that the percentage of INF- γ secretion by CD22-BBz-tEGFR CART cells in Raji cells positive for CD8 was 24.1%, and the percentage of INF- γ secretion by CD22-BBz-tEGFR cells in Raji cells positive for CD4 was 11.9%, respectively.

Example 8: detection of tumor-specific cell killing after Co-culture of CAR-T cells with target cells

K562 cells (negative control cells as target cells without CD19 target protein) were resuspended in serum-free medium (1640) adjusted to a cell concentration of 1X 10⁶Perml, the fluorescent dye BMQC (2,3,6, 7-tetrahydro-9-bromomethyl-1H, 5H quinolizino (9,1-gh) coumarin) was added to a final concentration of 5. mu.M.

2. Mixing, and incubating at 37 deg.C for 30 min.

3. Centrifugation was carried out at 1500rpm for 5min at room temperature, the supernatant was discarded and the cells resuspended in cytotoxic medium (phenol red-free 1640+ 5% AB serum) and incubated for 60min at 37 ℃.

4. Fresh cytotoxic Medium cells were washed twice and resuspended in fresh cytotoxic Medium at a density of 1X 10⁶/ml。

Raji cells (containing CD22 target protein, as target cells) were suspended in PBS containing 0.1% BSA at a concentration of 1X 10⁶/ml。

6. The fluorescent dye CFSE (carboxyfluorescein diacetate succinimidyl ester) was added to a final concentration of 1. mu.M.

7. Mixing, and incubating at 37 deg.C for 10 min.

8. After the incubation was completed, FBS in an equal volume to the cell suspension was added and incubated at room temperature for 2min to terminate the labeling reaction.

9. Cells were washed and resuspended in fresh cytotoxic medium at a density of 1X 10⁶/ml。

10. Effector T cells were washed and suspended in cytotoxic medium at a concentration of 5X 10⁶/ml。

11. In all experiments, cytotoxicity of effector T cells infected with CD 22-BBz-tfegfr CAR (CAR-T cells) was compared to cytotoxicity of negative control effector T cells (NTs) infected with control CAR or not infected, and these effector T cells were from the same patient.

CD 22-BBz-tfegfr CAR-T and negative control effector T cells, according to T cell: target cells were cultured in 5ml sterile test tubes (BD Biosciences) at a ratio of 10:1, 2:1, with two wells per group. In each co-culture group, the target cells were Raji cells (50. mu.l) and the negative control cells were K562 cells (50. mu.l) of 50,000. A panel was set up to contain only Raji target cells and K562 negative control cells.

13. The co-cultured cells were incubated at 37 ℃ for 4 h.

14. After incubation was complete, cells were washed with PBS and immediately followed by rapid addition of 7-AAD (7-amino actinomycin D) at the concentrations recommended by the instructions and incubation on ice for 30 min.

15. The Flow-type detection is directly carried out without cleaning, and the data is analyzed by Flow Jo.

16. Analysis using 7AAD negative live cell gating, the proportion of live Raji target cells and live K562 negative control cells after co-culture of T cells and target cells was determined:

a) for each set of co-cultured T cells and target cells,

survival percent of target cells is Raji viable cell number/K562 viable cell number;

b) the% cytotoxic killer cells is 100-the% calibrated target cell survival, i.e. (ratio of Raji viable cell number when no effector cells were present-Raji viable cell number when effector cells were present)/K562 viable cell number.

The results are shown in fig. 9. The results show that CD22-BBz-tEGFR at an effective target ratio of 10:1

The killing rate of CAR-T cells on Raji cells is 90%.

Claims

1. A polynucleotide, the sequence of which is selected from the group consisting of:

(1) comprises a polynucleotide sequence of a coding sequence of an anti-CD 22 single-chain antibody, a coding sequence of a human CD8 alpha hinge region, a coding sequence of a human CD8 transmembrane region, a coding sequence of a human 41BB intracellular region, a coding sequence of a human CD3 zeta intracellular region and a coding sequence of a fragment of EGFR containing an extracellular domain III and an extracellular domain IV, which are connected in sequence, wherein the amino acid sequence of the heavy chain variable region of the anti-CD 22 single-chain antibody is shown as amino acids 22-145 in SEQ ID NO. 2, the amino acid sequence of the light chain variable region of the anti-CD 22 single-chain antibody is shown as amino acids 161-267 in SEQ ID NO. 2, the amino acid sequence of the human CD8 alpha hinge region is shown as amino acid 268-314 in SEQ ID NO. 2, the amino acid sequence of the human CD8 transmembrane region is shown as amino acid 315-336 in SEQ ID NO. 2, the amino acid sequence of the human 41BB intracellular region is shown as amino acid 337 in 384-337 in SEQ ID NO. 2, the amino acid sequence of the intracellular region of the human CD3 zeta is shown as the amino acids 385-495 of SEQ ID NO. 2, and the amino acid sequence of the EGFR fragment is shown as the amino acids 544-878 of SEQ ID NO. 2; and

(2) (1) the complement of the polynucleotide sequence.

2. The polynucleotide of claim 1,

the polynucleotide sequence further comprises a coding sequence of a signal peptide before the coding sequence of the anti-CD 22 single-chain antibody.

3. The polynucleotide of claim 2, wherein the amino acid sequence of said signal peptide is as set forth in amino acids 1-21 of SEQ ID No. 2.

4. The polynucleotide of claim 1, wherein said polynucleotide further comprises a coding sequence for a GM-CSF receptor alpha chain signal peptide disposed N-terminal to said EGFR fragment.

5. The polynucleotide of claim 4, wherein the amino acid sequence of the signal peptide of the α chain of the GM-CSF receptor is as shown in amino acids 522-543 of SEQ ID NO. 2.

6. The polynucleotide of claim 4, wherein said polynucleotide further comprises a coding sequence for a linker sequence linking said GM-CSF receptor alpha chain signal peptide to said intracellular domain of human CD3 ζ.

7. The polynucleotide of claim 6, wherein the amino acid sequence of the linker sequence is as set forth in amino acids 496-521 of SEQ ID No. 2.

8. The polynucleotide of claim 2, wherein the coding sequence for said signal peptide preceding the coding sequence for said anti-CD 22 single chain antibody is as set forth in nucleotide sequence nos. 1-63 of SEQ ID No. 1.

9. The polynucleotide of claim 1,

the coding sequence of the heavy chain variable region of the anti-CD 22 single-chain antibody is shown as the nucleotide sequence of 64 th to 435 th positions of SEQ ID NO. 1;

the coding sequence of the light chain variable region of the anti-CD 22 single-chain antibody is shown as the 481 st 801 th nucleotide sequence of SEQ ID NO. 1;

the coding sequence of the human CD8 alpha hinge region is shown as the nucleotide sequence at the 802-942 position of SEQ ID NO. 1;

the coding sequence of the human CD8 transmembrane region is shown as the nucleotide sequence of 943-1008 of SEQ ID NO. 1;

the coding sequence of the human 41BB intracellular region is shown as the nucleotide sequence 1009-1152 of SEQ ID NO. 1;

the coding sequence of the intracellular region of human CD3 zeta is shown as the nucleotide sequence of 1153-1485 of SEQ ID NO. 1;

the coding sequence of the EGFR fragment is shown as the nucleotide sequence of 1630-2634 of SEQ ID NO 1; or

The polynucleotide encodes an amino acid sequence shown as 1 st to 495 th positions of SEQ ID NO. 2, or an amino acid sequence shown as 22 nd to 878 th positions of SEQ ID NO. 2, or an amino acid sequence shown as SEQ ID NO. 2; or

The polynucleotide comprises a nucleotide sequence shown in SEQ ID NO. 1 and 1 st to 1485 of SEQ ID NO. 1, a nucleotide sequence shown in 64 th to 1485 th of SEQ ID NO. 1 or a nucleotide sequence shown in 64 th to 2634 th of SEQ ID NO. 1, or consists of a nucleotide sequence shown in 1 st to 1485 of SEQ ID NO. 1 and SEQ ID NO. 1, a nucleotide sequence shown in 64 th to 1485 th of SEQ ID NO. 1 or a nucleotide sequence shown in 64 th to 2634 th of SEQ ID NO. 1.

10. The polynucleotide of claim 4, wherein the coding sequence for the signal peptide of the α chain of the GM-CSF receptor is as shown in nucleotide sequence 1564-1629 of SEQ ID NO. 1.

11. The polynucleotide of claim 6, wherein the coding sequence of said linker sequence linking said signal peptide of the α chain of the GM-CSF receptor and the intracellular domain of human CD3 ζ is as shown in nucleotide sequences 1486-1563 of SEQ ID NO: 1.

12. A fusion protein, which comprises an anti-CD 22 single-chain antibody, a human CD8 alpha hinge region, a human CD8 transmembrane region, a human 41BB intracellular region, a human CD3 zeta intracellular region, and a fusion protein containing fragments of an extracellular domain III and an extracellular domain IV of EGFR which are connected in sequence, wherein the amino acid sequence of the heavy chain variable region of the anti-CD 22 single-chain antibody is shown as amino acids 22-145 of SEQ ID NO. 1, the amino acid sequence of the light chain variable region of the anti-CD 22 single-chain antibody is shown as amino acids 161-267 of SEQ ID NO. 1, the amino acid sequence of the human CD8 alpha hinge region is shown as amino acids 268-314 of SEQ ID NO. 1, the amino acid sequence of the human CD8 transmembrane region is shown as amino acids 315-336 of SEQ ID NO. 1, the amino acid sequence of the human 41BB intracellular region is shown as amino acids 337-384 of SEQ ID NO. 1, the amino acid sequence of the intracellular region of human CD3 zeta is shown as amino acids 385-495 of SEQ ID NO. 1, and the amino acid sequence of the EGFR fragment is shown as amino acids 544-878 of SEQ ID NO. 1.

13. The fusion protein of claim 12, further comprising a signal peptide at the N-terminus of the anti-CD 22 single chain antibody.

14. The fusion protein of claim 13, wherein the signal peptide has the amino acid sequence shown as amino acids 1-21 of SEQ ID No. 2.

15. The fusion protein of claim 12, further comprising a GM-CSF receptor alpha chain signal peptide disposed N-terminal to the EGFR fragment.

16. The fusion protein of claim 15, wherein the amino acid sequence of the α chain signal peptide of GM-CSF receptor is represented by amino acids 522-543 of SEQ ID NO. 2.

17. The fusion protein of claim 15, further comprising a linker sequence linking the GM-CSF receptor alpha chain signal peptide to the intracellular domain of human CD3 ζ.

18. The fusion protein of claim 17, wherein the amino acid sequence of the linker sequence is as set forth in amino acids 496-521 of SEQ ID NO 2.

19. The fusion protein of claim 12, wherein the amino acid sequence of the fusion protein is as set forth in amino acids 22-495 of SEQ ID NO 2, or as set forth in amino acids 22-878 of SEQ ID NO 2, or as set forth in amino acids 1-495 of SEQ ID NO 2, or as set forth in SEQ ID NO 2.

20. A nucleic acid construct comprising the polynucleotide of any one of claims 1-11.

21. The nucleic acid construct of claim 20, wherein said nucleic acid construct is a vector.

22. The nucleic acid construct of claim 20, wherein the nucleic acid construct is a retroviral vector comprising a replication initiation site, a 3 'LTR, a 5' LTR, pis packaging signal, woodchuck hepatitis virus post-transcriptional regulatory elements, and the polynucleotide of any one of claims 1-11.

23. A retrovirus comprising the polynucleotide of any one of claims 1-11.

24. A genetically modified T-cell or a pharmaceutical composition comprising a genetically modified T-cell, wherein the cell comprises the polynucleotide of any one of claims 1-11, or comprises the nucleic acid construct of any one of claims 20-22, or is infected with the retrovirus of claim 23, or stably expresses the fusion protein of any one of claims 12-19 and a fragment of EGFR comprising extracellular domain III, extracellular domain IV, and optionally a transmembrane region.

25. Use of the polynucleotide of any one of claims 1-11, the fusion protein of any one of claims 12-19, the nucleic acid construct of any one of claims 20-22, or the retrovirus of claim 23 in the preparation of a reagent comprising an activated T cell.

26. Use of the polynucleotide of any one of claims 1-11, the fusion protein of any one of claims 12-19, the nucleic acid construct of any one of claims 20-22, the retrovirus of claim 23, or the genetically modified T-cell of claim 24, or a pharmaceutical composition thereof, in the preparation of a medicament for treating a CD 22-mediated disease.

27. The use of claim 26, wherein the CD 22-mediated disease is non-hodgkin's lymphoma or acute lymphoma leukemia.