CN108715616A - The Chimeric antigen receptor method and purposes of targeting humanized mesothelin - Google Patents

Abstract

The present invention relates to Chimeric antigen receptors of targeting humanized mesothelin and application thereof.Specifically, the present invention provides a kind of polynucleotide sequence, it is selected from：(1) contain the coded sequence of sequentially connected anti-mesothelin single-chain antibody, the coded sequence of people's CD8 α hinge areas, the coded sequence of people's CD8 transmembrane regions, the coded sequence of people's CD28 intracellular regions, the coded sequence of people's 41BB intracellular regions, the coded sequence of people's CD3 ζ intracellular regions, optional EGFR III containing extracellular domain and extracellular domain IV segment coded sequence；(2) complementary series of (1) described polynucleotide sequence.The present invention also provides the purposes of relevant fusion protein, the carrier containing the coded sequence and the fusion protein, coded sequence, carrier.It has the function of tracing in vivo and safety switch to CART cells prepared by the present invention with tEGFR components.Meso (M912) -28BBz-tEGFR CAR-T cells prepared by the present invention have specific tumor cell strong killing ability, and CD107a expression and IFN γ secretion are higher.

Description

The Chimeric antigen receptor method and purposes of targeting humanized mesothelin

Technical field

The invention belongs to Chimeric antigen receptor fields, and in particular to target Chimeric antigen receptor of mesothelin and application thereof.

Background technology

Cancer of pancreas (Pancreatic Carcinoma) is clinically common alimentary system malignant tumour, is more common in 50 years old Above crowd.Its incidence has apparent regional disparity, and incidence has been in American-European countries in trend is gradually increasing in recent years 4th common malignant tumour occupies the 2nd of the alimentary tract cancer cause of the death, is only second to colorectal cancer, incidence of occult, early symptom Without specificity, Resection Rate is low.In the process of tumor development, very polygenic activation and its expression of product are played Important role, in it is not completely clear in exact molecular mechanism, with modern image and the hair at full speed of endoscopic technic Exhibition clarifies a diagnosis oneself without too big difficulty, but at this time mostly to some symptom and signs and the more apparent cancer of pancreas of Findings Oneself loses best opportunity of operation, and more difficult for the diagnosis of some early stage patients.Therefore seek new treatment means, for cancer of pancreas Treatment be the task of top priority.

In terms of the research of the metastasis and invasion of tumour, mesothelin (Mesothelin) is also the hot spot of current research. Chang in 1996 etc. clones the antigen of monoclonal antibody identification using Cervical Cancer HeLa Cells, and research finds that the antigen exists In normal rnesothelial cells, therefore it is named as Mesothelin.The main reason for tumor patient survival rates low poor prognosis with it Infiltration metastasis is related, and the infiltration metastasis Mechanism Study of tumour is current hot and difficult issue.Mesothelin gene codes are a kind of The precursor protein of 69kDa, the processed embrane-associated protein (i.e. Mesothelin) for forming a 40kDa and a 3lkDa are referred to as For the segment that falls off of megakaryocyte-potentiating factor MPF.Mesothelin height is expressed in kinds of tumors tissue, in serum of ovarian cancer patients Mesothelin mRNA and the expression of protein level height, tissue section strain, which shows to have in Nonviscous protein oophoroma, 66% is in Mesothelin is positive；It being found in the detection of mesothelioma of pleura, 15 cases for being diagnosed as epithelial mesothelioma are all positive, and 4 The sarcomatous celiothelioma of example is all negative；The researchs such as Argani are reported, in the primary pancreatic carcinoma of excision, Immunohistochemical Method detection Showing 60 has 54 strong positives, and surrounding normal pancreatic tissue is then without Mesothelin reactivities；In other entity tumors In analysis, official's neck, head, neck, vagina, lung and oesophagus squamous carcinoma frozen section in can find mesothelin immunocompetence, adenocarcinoma of lung, Carcinoma of endometrium, borderline synovial sarcoma and desmoplastic small round cell tumor have a small amount of mesothelin to express, in mammary gland Cancer, thyroid cancer, clear-cell carcinoma, bladder move only a little in cell cancer, black cancer and liver cancer or do not have Mesothelin tables It reaches.The biological function of Mesothelin is not yet clear.Pastan etc. constructs a kind of Mesothelin mutant mouses, this A little mutant mouses and the wild-type mice of compatriot grow and breed identical, and the platelet count of the two does not have statistics Difference；There is researches show that Mesothelin to be combined energy mediate cell adhesion with CA 125, thus researchers are also considered as CA 125 It may play an important role in the transfer diffusion of oophoroma with Mesothelin；In addition, there is research also to show Mesothelin bases The expression of cause is adjusted by the signal of interest approach such as Wnt, and such as in oophoroma and cancer of pancreas, Wnt signal transduction pathways continue Activation promotes Mesothelin expression to increase.Although.The function and its carcinogenesis of Mesothelin is still up for further bright Really, but its distribution in the normal tissue it is limited and in the feature of certain tumor tissues height expression, thus Mesothelin can Targeting as tumor specific antibody treatment.

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cell refers to being repaiied through gene After decorations, specific purpose antigen, and the T cell of continuous activation amplification can be identified with MHC non-limiting ways.It is 2012 international thin Born of the same parents, which treat association annual meeting middle finger and go out biological immune cell therapy, has become operation, radiotherapy, the 4th kind for the treatment of tumour outside chemotherapy Means, and future tumors will be become and treat essential means.Chimeric antigen receptor (CAR) is the core component of CAR-T, assigns T Mode non-dependent cell HLA identifies the ability of tumour antigen, this so that the T cell being transformed by CAR is thin compared to natural T Cellular surface receptor TCR can identify wider target.The basic engineering of CAR includes a tumor associated antigen (tumor- Associated antigen, TAA) combined area (the scFv sections for being typically derived from monoclonal antibody antigen calmodulin binding domain CaM), one Extracellular hinge area, a transmembrane region and an intracellular signal area.The selection of target antigen for the specificity of CAR, validity with And all it is crucial determinant for the genetic modification T cell safety of itself.

Have 10 in the anti-Mesothelin CAR-T cell therapy clinical tests of ClinicalTrials.gov registrations at present , mainly for malignant tumours such as cancer of pancreas, oophoroma, pleuroma, lung cancer and breast cancer.Carry out in the University of Pennsylvania I phase clinical researches in, patient is that the state of an illness further developed after receiving first-line treatment, and expression of tumor tissue Mesothelin, they receive the T cell treatment for turning CAR mRNA winks.In two generations CAR of this Mesothelin specificity, have There are CD3 ξ and 4-1BB costimulating factor structural domains.The CAR T survival periods of these Mesothelin specificity are short, in two patients In show antitumor action, it is seen that the antigen that Mesothelin can be identified as CAR T cells and turns mRNA's in wink Mode is also feasible.The I phase clinical researches that another University of Pennsylvania carries out use slow-virus transfection Mesothelin specific Cs AR.This research for starting from July, 2014 is the malignant pancreatic cancer, epithelial for resistance to chemotherapy Oophoroma and Malignant Epithelium mesothelioma of pleura.In the early stage result of study of 6 patients, 4 patients are transfused 28 in CAR T cells Stable disease after it.CAR T cells infusion does not cause acute side reaction, and turns compared to mRNA winks, slow-virus transfection structure The durations of CAR T cells get a promotion.

Development by clinical test and the analysis to test result, it is thin that researchers fight Mesothelin CAR-T The defect of born of the same parents' therapy in the application has deeper understanding, overcomes presence so as to further carry out targetedly research The problem of.It is to obtain therapeutic efficiency in view of in treatment of solid tumors, promoting CAR-T cells to enter tumor tissues in maximum efficiency Important guarantee.Chemokines CC CL2, University of Pennsylvania Carl June researchs can be largely secreted according to pleural mesothelium oncocyte Group devises while expressing the anti-Mesothelin CAR-T cells of CCL2 receptors CCR2, to pass through the work of CCL2/CCR2 Lethal effect is efficiently played with chemotactic CAR-T cells to tumor tissues.Si Long-Caitlin Cancer center then compares in malignant pleural tumor Compared with the effect of infusion and Systemic infusion CAR T cells in thoracic cavity, it is found that infusion can make cell duration strong in thoracic cavity, swell Tumor accumulated inside is more, plays better antitumor action.Si Long-Caitlin Cancer center will be with regard to the peace of this kind of infusion Full property further carries out clinical research.

It is active medicine that one big advantage of CAR-T cells, which is them, once input, physiological mechanism can regulate and control the flat of T cells Weighing apparatus, memory are formed and the amplification of antigen driving.However, this treatment is not perfect enough, T cell can miss the target and attack other groups It knits or amplification amount is excessively high, needed for treatment.It has been included into standard care range in view of CAR-T cells, has designed patient or drug Controllable startup or shutdown mechanism is highly useful come the presence for regulating and controlling CAR-T cells.Due to technical reason, shutdown mechanism It is more easy to be applied to T cell.As one of them, iCas9 systems are just in clinical research.Cell is used when expressing iCas9 Micromolecular compound can induce iCas9 precursor molecules and form dimer, apoptosis pathway be activated, to realize the mesh of scavenger-cell 's.In graft versus host disease(GVH disease), small molecule AP1903 has been used for inducing iCas9 dimers and removes T cell, shows this Feasibility (the Clin Cancer Res.2016 Apr 15 of kind method；22(8):1875-84.).

In addition, also make CAR-T cells using the scavenging antibody clinically used while expressing these antibody needles To albumen, such as tEGFR, treatment-related toxic reaction generate or treat after the completion of, by giving antibody drug Remove corresponding CAR-T cells (Sci Transl Med 2015； 7：275ra22.).

The present invention is to the four generation CAR of the targeting Mesothelin of structure, and the present invention is using humanization Mesothelin (M912), M912 is separated from the libraries Fab of people, for recombination mesothelin.ScFv, Fab and the IgG1 of M912 Antibody can specifically bind people's mesothelin and recombination mesothelin, and have high-affinity.M912 is the targeting of first report The monoclonal antibody of the full humanization of mesothelin has treatment and diagnostic effect to tumour.The present invention carries out CART cells Modification, that is, introduce safety switch i.e. tEGFR structures, it can both make to be carried out in CAR-T cell bodies well by tracer, heavier What is wanted is that this structure can be as the safety switch of CAR-T cells：Appropriate Xidan can be added by being not desired to when it plays a role resists, safety The CAR-T cells for Mesothelin target spots of effective control infusion play a role in vivo.The present invention is clinical trial It lays a good foundation with clinical treatment.

Accumulation with CAR-T cell therapy experiences and constantly improve, application in entity tumor increasingly by All circles pay close attention to.In such circumstances, we will quicken one's step, and utilize itself existing working foundation, R&D team, medical team Shen It please carry out clinical test, CAR-T cell therapies is pushed to be fast forwarded through on the road of solid tumor.

Invention content

First aspect present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from：

(1) contain the coded sequence of sequentially connected anti-mesothelin single-chain antibody, the coded sequence of people's CD8 α hinge areas, people The coded sequence of CD8 transmembrane regions, the coded sequence of people's CD28 intracellular regions, the coded sequence of people's 41BB intracellular regions, people's CD3 ζ intracellulars The coded sequence of the segment of the coded sequence in area, the III containing extracellular domain of optional EGFR and extracellular domain IV；With

(2) complementary series of (1) described polynucleotide sequence.

In one or more embodiments, the signal peptide before the coded sequence of the anti-mesothelin single-chain antibody Coded sequence such as SEQ ID NO:Shown in 1 1-63 nucleotide sequences.In one or more embodiments, it is described it is anti-between The coded sequence of skin element single-chain antibody such as SEQ ID NO:Shown in 1 64-792 nucleotide sequences.Implement in one or more In scheme, the coded sequence such as SEQ ID NO of the people CD8 α hinge areas and CD8 transmembrane regions:1 793-999 nucleotides sequences Shown in row.In one or more embodiments, the coded sequence such as SEQ ID NO of the people CD28 intracellular regions:1 1000- Shown in 1122 nucleotide sequences.In one or more embodiments, the coded sequence such as SEQ of the people 41BB intracellular regions ID NO:Shown in 1 1123-1266 nucleotide sequences.In one or more embodiments, the people CD3 ζ intracellular regions Coded sequence such as SEQ ID NO:Shown in 1 1267-1599 nucleotide sequences.It is described in one or more embodiments The coded sequence of the segment of EGFR such as SEQ ID NO:Shown in 1 1758-2751 nucleotide sequences.

Second aspect of the present invention provides a kind of fusion protein, and the fusion protein is selected from：

(1) contain sequentially connected anti-mesothelin single-chain antibody, people CD8 α hinge areas, people CD8 transmembrane regions, people's CD28 intracellulars Area, the fusion protein of people 41BB intracellular regions and people's CD3 ζ intracellular regions and optional EGFR III containing extracellular domain and extracellular knot The coded sequence of the segment of structure domain IV；With

(2) it is lived in the amino acid sequence that (1) limits by replacing, missing or adding one or several amino acid and retaining Change the active fusion protein derived from (1) of T cell；

Preferably, the anti-mesothelin monoclonal antibody M912.

In one or more embodiments, code sequence of the polynucleotide sequence in the anti-mesothelin single-chain antibody Arrange the preceding also coded sequence containing signal peptide.In one or more embodiments, the amino acid sequence such as SEQ of the signal peptide ID NO:Shown in 2 1-21 amino acids.In one or more embodiments, the amino acid of the anti-mesothelin single-chain antibody Sequence such as SEQ ID NO:Shown in 2 22-264 amino acids.In one or more embodiments, the people CD8 α hinge areas With the amino acid sequence such as SEQ ID NO of CD8 transmembrane regions:Shown in 2 265-333 amino acids.In one or more embodiment party In case, the amino acid sequence such as SEQ ID NO of the people CD28 intracellular regions:Shown in 2 334-375 amino acids.At one or In multiple embodiments, the amino acid sequence such as SEQ ID NO of the people 41BB intracellular regions:2 376-422 amino acids institutes Show.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:2 423-533 Shown in amino acids.In one or more embodiments, the segment of the EGFR contains extracellular domain III, the born of the same parents of EGFR Extracellular portion IV and transmembrane region, or be made of the extracellular domain III, extracellular domain IV and transmembrane region of EGFR.One In a or multiple embodiments, the segment of the EGFR contains the 310-646 amino acids sequences of Human epidermal growth factor receptor, or by people The 310-646 amino acids sequences of EGFR form.In one or more embodiments, the amino of the segment of the EGFR Acid sequence such as SEQ ID NO:Shown in 2 582-916 amino acids.

Third aspect present invention provides a kind of nucleic acid constructs, and the nucleic acid constructs contains polynucleotides as described herein Sequence.

In one or more embodiments, the nucleic acid constructs is carrier.In one or more embodiments, institute It is retroviral vector to state nucleic acid constructs, contains replication origin, 3 ' LTR, 5 ' LTR, pis packaging signals, digestion position Point, groundhog hepatitis virus posttranscriptional regulatory element, polynucleotide sequence as described herein, and optional selectable mark Note.

Fourth aspect present invention provides a kind of retrovirus, and the retrovirus contains nucleic acid construct as described herein Object preferably comprises the carrier, the further preferably described retroviral vector.

Fifth aspect present invention provides a kind of T cell of genetic modification, and the cell contains polynucleotides as described herein Sequence, or contain nucleic acid constructs as described herein, or retrovirus as described herein has been infected, or stablize expression this paper institutes The III containing extracellular domain of the fusion protein and optional EGFR stated, the segment of extracellular domain IV and optional transmembrane region.

Sixth aspect present invention provides a kind of pharmaceutical composition of the T cell containing genetic modification as described herein.

Seventh aspect present invention provides polynucleotide sequence, fusion protein, nucleic acid constructs or reverse transcription as described herein Application of the virus in the T cell for preparing activation.

Eighth aspect present invention offer polynucleotide sequence as described herein, fusion protein, nucleic acid constructs, reverse transcription disease Purposes of the T cell or its pharmaceutical composition of poison or genetic modification in the drug for preparing the disease that treatment mesothelin mediates.

In one or more embodiments, the disease that the mesothelin mediates is oophoroma, mesothelioma of pleura, pancreas The squamous carcinoma of cancer and uterine neck, head, neck, vagina, lung and oesophagus.In one or more embodiments, what the mesothelin mediated Disease is malignant pleural mesothelioma, cancer of pancreas, oophoroma and lung cancer.

Description of the drawings

Fig. 1：MSCV-Meso-tEGFR retrovirus expression vectors (RV-Meso-tEGFR) schematic diagram. SP：Signal Peptide；VL：Light chain variable region；Lk：Connector (G₄S)₃；VH：Heavy chain variable region；H：CD8 α hinge areas；TM：CD8 transmembrane regions；WPRE：Soil Dial murine hepatitis virus posttranscriptional regulatory element.

Fig. 2：The part sequencing result peak of MSCV-Meso-tEGFR retrovirus expression vectors (RV-Meso-tEGFR) Value figure.

Fig. 3 is the RV-Meso-tEGFR CART expression in 72 hours of FCM results show retroviral infection T cell Efficiency.

Fig. 4 is RV-Meso-tEGFR CART cells and the target cell 4 hours CD107a degranulations of co-cultivation for preparing 5 days Effect detection.

Fig. 5 is the secretion inspection of the RV-Meso-tEGFR CART cells and target cell 4 hours IFN γs of co-cultivation that prepare 5 days It surveys.

Specific implementation mode

The present invention provides a kind of Chimeric antigen receptor (CAR) of targeting humanized mesothelin.The CAR contains sequentially connected Anti- mesothelin single-chain antibody, people CD8 α hinge areas, people CD8 transmembrane regions, people CD28 intracellular regions, people 41BB intracellular regions, people CD3 ζ born of the same parents The segment of inner region, the III containing extracellular domain of optional EGFR and extracellular domain IV.

Various anti-mesothelin monoclonals well known in the art can be derived from by being suitable for the invention anti-mesothelin single-chain antibody Antibody.

Therefore, in certain embodiments, it is suitable for the invention anti-mesothelin single-chain antibody and contains specific recognition people Mesothelin.Optionally, the light chain variable region and heavy chain variable region can be linked together by joint sequence.What can be illustrated is this kind of Single-chain antibody includes but not limited to YP218Fv-PE38, YP223, SS1, M912.In certain embodiments, the monoclonal is anti- Body is M912.

Form the fusion protein of the present invention, such as light chain variable region and heavy chain variable region, people CD8 of anti-mesothelin single-chain antibody α hinge areas, people CD8 transmembrane regions, people CD28 intracellular regions, 41BB and people's CD3 ζ intracellular regions etc., can be directly connected between each other, or It can be connected by joint sequence.Joint sequence can be the joint sequence suitable for antibody well known in the art, such as containing G and S Joint sequence.In general, connector contains the front and back motif repeated of one or more.For example, the motif can be GGGS, GGGGS, SSSSG, GSGSA and GGSGG.Preferably, which is adjacent in joint sequence, and amino is not inserted between repetition Sour residue.Joint sequence can include that 1,2,3,4 or 5 repetition motif forms.The length of connector can be 3~25 amino Sour residue, such as 3~15,5~15,10~20 amino acid residues.In certain embodiments, joint sequence is more glycine Joint sequence.The quantity of glycine is not particularly limited in joint sequence, usually 2~20, such as 2~15,2~10,2~8 It is a.Except glycine and serine come, other known amino acid residue, such as alanine (A), leucine are also contained in connector (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q) etc..

It should be understood that in gene cloning operation, it is often necessary to design suitable restriction enzyme site, this certainly will be in expressed ammonia Base acid sequence end introduces one or more incoherent residues, and this has no effect on the activity of aim sequence.In order to build Fusion protein, the expression for promoting recombinant protein obtain the recombinant protein being secreted into automatically outside host cell or are conducive to recombinant protein Purifying, it is often necessary to it is other suitable in the ends N-, the ends C- or the albumen of recombinant protein to be added to some amino acid In region, it may for example comprise but be not limited to, suitable joint peptide, signal peptide, leader peptide, end extend etc..Therefore, of the invention The aminoterminal or c-terminus of fusion protein (the i.e. described CAR) can also contain one or more polypeptide fragments, as protein tag. Any suitable label may be used to herein.For example, the label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out albumen pure Change.

The present invention also includes SEQ ID NO:CAR, SEQ ID NO shown in 2 22-533 amino acids sequences:2 22- CAR, SEQ ID NO shown in 916 amino acids sequences:CAR or SEQ ID NO shown in 2 1-533 amino acids sequences:2 Shown in CAR mutant.These mutant include：With the CAR at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity simultaneously retain the biological activity of the CAR (as activation T is thin Born of the same parents) amino acid sequence.The sequence identity between the sequence of BLASTp two comparisons of calculating of such as NCBI can be used.

Mutant further includes：In SEQ ID NO:2 amino acid sequence, SEQ ID NO shown in 22-533:2 22- Amino acid sequence shown in 916, SEQ ID NO:2 amino acid sequence or SEQ ID NO shown in 1-533:Shown in 2 There are one or several biological activities for being mutated (insertion, deletion or substitution) while still retaining the CAR in amino acid sequence Amino acid sequence.Several mutation are often referred within 1-10, such as 1-8,1-5 or 1-3.Substitution is preferred It is conservative replaces.For example, in the art, when carrying out conservative replaces with amino acid similar in performance, usually not The function of protein or polypeptide can be changed." amino acid similar in performance " includes for example, the amino with similar side chain The family of sour residue, these families include the amino acid (such as lysine, arginine, histidine) with basic side chain, have The amino acid (such as aspartic acid, glutamic acid) of acid side-chain, amino acid (such as the sweet ammonia with uncharged polar side chain Acid, asparagine, glutamine, serine, threonine, tyrosine, cysteine), the amino acid (example with non-polar sidechain Such as alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), have β-branch side The amino acid (such as threonine, valine, isoleucine) of chain and amino acid (such as tyrosine, phenylpropyl alcohol with aromatic side chain Propylhomoserin, tryptophan, histidine).Therefore, in polypeptide of the present invention one is replaced with another amino acid residue from the same side chain class A or several sites, will not be in substantially influences its activity.

The present invention includes encoding the polynucleotide sequence of fusion protein of the present invention.The present invention polynucleotide sequence can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be it is single-stranded or Double-strand.DNA can be coding strand or noncoding strand.The present invention also includes the degeneracy of the polynucleotide sequence of encoding fusion protein Variant encodes identical amino acid sequence but the different nucleotide sequence of nucleotide sequence.

Polynucleotide sequence as described herein can usually use PCR amplification method to obtain.Specifically, can be public according to institute herein The nucleotide sequence opened, especially open reading frame sequence carry out design primer, the commercially available libraries cDNA are used in combination or by art technology The libraries cDNA prepared by conventional method known to personnel expand as template and obtain related sequence.When sequence is longer, usually need Twice or multiple PCR amplification, then the segment that each time amplifies is stitched together by proper order again.For example, In certain embodiments, the polynucleotide sequence such as SEQ ID NO of fusion protein described herein are encoded:1 63-1599 cores Shown in thuja acid, or such as SEQ ID NO:Shown in 1 1-1599 nucleotide.

In certain embodiments, polynucleotide sequence of the invention also includes the nucleotides sequence of the segment of coding EGFR Row.

It is suitable for the invention the EGFR that EGFR can be well known in the art, such as the EGFR from people.EGFR contains the ends N End extracellular domain I and II, extracellular domain III, extracellular domain IV, transmembrane region, membrane-proximal region structural domain and tyrosine-kinase Enzyme domains.Present invention preferably uses truncated EGFR (" tEGFR ", i.e., the segments of EGFR as described herein), do not wrap especially Include the truncated EGFR of its intracellular region (membrane-proximal region structural domain and tyrosine kinase domain).In certain embodiments, also It does not include extracellular domain I and II that further can further be truncated to the EGFR not including intracellular region.Therefore, certain In embodiment, the tEGFR that the present invention uses contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or It is made of the extracellular domain III, extracellular domain IV and transmembrane region of EGFR.In certain embodiments, the tEGFR contains There are the 310-646 amino acids sequences of Human epidermal growth factor receptor, or is made of the 310-646 amino acids sequences of Human epidermal growth factor receptor, wherein the 310-480 amino acids sequences are that the extracellular domain III, 481-620 of Human epidermal growth factor receptor are the extracellular domain IV of Human epidermal growth factor receptor, the 621-646 amino acids are the transmembrane region of Human epidermal growth factor receptor.

To promote the expression of tEGFR, can also targeting sequencing be set in its N-terminal.In certain embodiments, the present invention uses Signal peptide from GM-CSF receptors (" GMCSFR ") α chains.In certain embodiments, the amino acid sequence of the signal peptide is such as SEQ ID NO:Shown in 2 560-581 amino acids.

It in addition to this, can be by the coded sequences of T2A polypeptides by the coded sequence of the signal peptide and tEGFR and the present invention The coded sequence of people CD3 ζ intracellular regions is connected in CAR.In one or more embodiments, the amino acid sequence of the T2A peptides Such as SEQ ID NO:Shown in 2 534-559 amino acids.

The present invention also relates to nucleic acid constructs, which contains polynucleotide sequence as described herein, Yi Jiyu One or more regulating and controlling sequences of these series of operations connection.Polynucleotide sequence of the present invention can in many ways by Operation is to ensure the expression of the fusion protein (CAR and/or tEGFR).It can basis before nucleic acid constructs is inserted into carrier Difference or the requirement of expression vector and nucleic acid constructs is operated.Change polynucleotide sequence using recombinant DNA method Technology be known in the art.

Regulating and controlling sequence can be suitable promoter sequence.Promoter sequence is usually grasped with the coded sequence of albumen to be expressed The property made connection.Promoter can any nucleotide sequence of transcriptional activity be shown in selected host cell, including dash forward Become, truncated and hybrid promoter, and can be from coding and the homologous or heterologous extracellular or intracellular polypeptide of the host cell Gene obtain.Regulating and controlling sequence can also be suitable transcription terminator sequences, be identified by host cell to terminate the sequence of transcription Row.Terminator sequence is connect with 3 ' end effectors of the nucleotide sequence for encoding the polypeptide.Have in the host cell of selection Any terminator of function can be used in the present invention.Regulating and controlling sequence can also be suitable targeting sequencing, to host cell translation The non-translational region of important mRNA.5 ' ends of targeting sequencing and the nucleotide sequence for encoding the polypeptide are operatively connected.It is selecting Functional any terminator can be used in the present invention in the host cell selected.

In certain embodiments, the nucleic acid constructs is carrier.Usually pass through the more of the present invention that are operably connected Nucleotide sequence is incorporated to expression vector to promoter, and by construct, realizes the expression of polynucleotide sequence of the present invention.The carrier Can be suitable for replicating and integrating eukaryocyte.Typical cloning vector includes that can be used for adjusting it is expected nucleic acid sequence expression Transcription and translation terminator, homing sequence and promoter.

The polynucleotide sequence of the present invention can be cloned into the carrier of many types.For example, plasmid, phagocytosis can be cloned into Grain, phage-derived object, animal virus and clay.Further, carrier is expression vector.Expression vector can be with viral vectors Form is supplied to cell.Viral vector technology be well known in the present art and such as Sambrook etc. (2001, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, New York) It is described in other virology and molecular biology manual.The virus that can be used as carrier includes but not limited to reverse transcription disease Poison, adenovirus, adeno-associated virus, herpesviral and slow virus.

In general, suitable carrier is included in the replication orgin to work at least one organism, promoter sequence, conveniently Restriction enzyme sites and one or more selectable label (for example, WO 01/96584； WO01/29058；And United States Patent (USP) Number 6,326,193).

For example, in certain embodiments, the present invention uses retroviral vector, the retroviral vector to contain multiple Initiation site processed, 3 ' LTR, 5 ' LTR, pis packaging signals, restriction enzyme site, groundhog hepatitis virus posttranscriptional regulatory element, herein The polynucleotide sequence, and optional selectable label.The groundhog hepatitis virus posttranscriptional regulatory element can The stability of enhanced virus transcript.

One example of suitable promoter is instant early stage cytomegalovirus (CMV) promoter sequence.The promoter sequence Row are can to drive the strong constitutive promoter sequence for being operably coupled to any polynucleotide sequence high level expression thereon Row.Another example of suitable promoter is -1 α of the elongation growth factor (EF-1 α).It is also possible, however, to use other composing types open Promoter sequences, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer viral (MMTV), people are immune scarce It is instant to fall into long end repetition (LTR) promoter of virus (HIV), MoMuLV promoters, avian leukosis virus promoter, Epstein-Barr virus Early promoter, Rous sarcoma virus promoter and people's gene promoter, such as, but not limited to actin promoter, Myosin promoter, ferroheme promoter and creatine kinase promoter.Further, it also contemplates for starting using induction type Son.The use of inducible promoter provides molecular switch, and the induction type that is operably connected can be opened when expressing in the time limit The expression of the polynucleotide sequence of promoter, and expression is being closed when expression is undesirable.The example of inducible promoter Including but not limited to metallothionein promoter, Glucocorticoid promoter, progesterone promoter and tetracycline promoter.

In order to assess the expression of CAR polypeptides or part thereof, the expression vector for being introduced into cell also may include selectable mark Any of gene or reporter or both are remembered, in order to from the cell mass for seeking to be transfected or infect by viral vectors Middle identification and selection expression cell.In other respects, selectable label can be carried on independent section of DNA and be used for corotation Contaminate program.The flank of selectable label and both reporters can all have regulatory sequence appropriate, so as in host It is expressed in cell.Useful selectable marker includes such as antibiotics resistance gene, such as neo etc..

Reporter is used to identify the cell of potential transfection and the functionality for evaluating regulatory sequence.DNA by After introducing recipient cell, the expression of reporter is measured under the suitable time.Suitable reporter may include encoding The base of luciferase, beta galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase or Green Fluorescent Protein gene Cause.Suitable expression system is well known and prepares using known technology or commercially obtain.

The method that gene is introduced cell and gene expression is entered to cell is well known in the art.Carrier can by Any method in this field is easily introduced into host cell, for example, mammal, bacterium, yeast or insect cell.For example, Expression vector can be transferred to host cell by physics, chemistry or biological means.

The physical method that polynucleotides are introduced to host cell includes calcium phosphate precipitation, lipofection, particle bombardment, micro- Injection, electroporation etc..The biological method that interested polynucleotides are introduced to host cell includes being carried using DNA and RNA Body.Include dispersion system of colloid by the chemical means that polynucleotides introduce host cell, such as macromolecular complex, nanometre glue Capsule, microballoon, pearl；With the system based on lipid, including oil in water emulsion, micella, mixed micelle and liposome.

The biological method that polynucleotides are introduced to host cell includes using viral vectors, especially retrovirus vector Body, this has become the most widely used method that gene is inserted into mammal such as people's cell.Other viral vectors can source From slow virus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus etc..Many has been developed based on virus System, for gene transfer to be entered mammalian cell.For example, retrovirus provides the convenience for gene delivery system Platform.By the gene insertion vector of selection and it is packaged into retroviral particle using technology as known in the art.It should Recombinant virus then can be detached and be transferred in vivo or in vitro subject cell.Many retroviral systems are in the art It is known.In some embodiments, using adenovirus vector.Many adenovirus vectors are well known in the art.? In one embodiment, slow virus carrier is used.

Therefore, in certain embodiments, the present invention also provides the retrovirus for activating T cell, which contains There are retroviral vector as described herein and corresponding packaging gene, such as gag, pol and vsvg.

Therefore, in certain embodiments, the present invention provides a kind of T cell of genetic modification, the T cell of the genetic modification Containing polynucleotide sequence as described herein, or contain retroviral vector as described herein, or has infected as described herein Retrovirus, or be prepared using method described herein, or stablize and express fusion protein as described herein and optional tEGFR。

The CAR-T cells of the present invention can undergo firm internal T cell and extend and be held with high level in blood and marrow Continue extended time quantum, and forms specific memory T cell.Be not intended to be fettered by any specific theory, encounter and with Afterwards eliminate expression Surrogate antigen target cell after, CAR-T cells of the invention can differentiation in vivo at center remember sample state.

The invention also includes a kind of cell therapy, wherein T cell is expressed CAR as described herein by genetic modification and is appointed TEGFR the and CAR-T cells of choosing are needed by injection in its recipient.The tumour that the cell of injection can kill recipient is thin Born of the same parents.Unlike antibody therapy, CAR-T cells can replicate in vivo, generate the long-term persistence that continued tumor can be caused to control.

The anti-tumor immune response caused by CAR-T cells can be active or passive immunity response.In addition, what CAR was mediated Immune response can be a part for adoptive immunotherapy step, and wherein CAR-T cells induction is to the antigen-binding portion thereof in CAR The immune response of specificity.

Therefore, CAR, its coded sequence, nucleic acid constructs, expression vector, virus and the CAR-T that the present invention can be used are thin The disease of born of the same parents' treatment is preferably the disease that mesothelin mediates.

Specifically, herein, " disease that mesothelin mediates " especially includes various types of oophoromas, mesothelioma of pleura The squamous carcinoma of (such as epithelial mesothelioma), cancer of pancreas and uterine neck, head, neck, vagina, lung and oesophagus.In certain embodiments, The disease that the mesothelin mediates is malignant pleural mesothelioma, cancer of pancreas, oophoroma and lung cancer.

The T cell of the CAR- modifications of the present invention can be administered alone or as pharmaceutical composition and diluent and/or and its Such as relevant cell factor of his component or cell mass combine application.Briefly, pharmaceutical composition of the invention may include as CAR-T cells as described herein, with one or more pharmacy or physiologically acceptable carriers, diluent or excipient are combined. Such composition may include buffer solution such as neutral buffered saline, sulfate buffered saline etc.；Carbohydrate such as Portugal Grape sugar, mannose, sucrose or glucan, mannitol；Protein；Polypeptide or amino acid such as glycine；Antioxidant；Chelating agent Such as EDTA or glutathione；Adjuvant (for example, aluminium hydroxide)；And preservative.

The mode that the pharmaceutical composition of the present invention can be suitable for the disease of (or prevention) to be treated is applied.The quantity of application It will be determined by such factor with frequency, such as the illness of patient and the type of patient disease and severity.

When pointing out " effective quantity in immunology ", " antitumor effective quantity ", " tumour-inhibition effective quantity " or " therapeutic dose ", The precise volume of the present composition to be administered can be determined that the age of consideration patient (object), weight, tumour are big by doctor The individual difference of small, infection or metastasis degree and illness.It can usually point out：Include the pharmaceutical composition of T cell described herein It can be with 10⁴To 10⁹The dosage of a cell/kg weight, preferably 10⁵To 10⁶The dosage of a cell/kg weight.T cell composition It can also be with these dosage multiple applications.Cell can be by using well known injection technique in immunotherapy (see for example Rosenberg etc., New Eng.J. of Med.319:1676,1988) it applies.Optimal dose for specific patient and treatment Scheme can simultaneously therefore adjustment for the treatment of be readily determined by medical domain technical staff by monitoring the disease indication of patient.

The application of object composition object can carry out in any convenient manner, including by spray-on process, inject, swallow, defeated Liquid, implantation or transplanting.Compositions described herein can by subcutaneous, intradermal, tumor, in knot, in spinal cord, intramuscular, pass through vein It is administered to patient in interior injection or peritonaeum.In one embodiment, T cell composition of the invention passes through intradermal or subcutaneous note It penetrates and is administered to patient.In another embodiment, T cell composition of the invention is preferably applied by being injected intravenously.T is thin The composition of born of the same parents can be injected directly into tumour, lymph node or infection position.

In some embodiments of the present invention, CAR-T cells of the invention or combinations thereof object can with it is known in the art Other therapies combine.The therapy includes but not limited to chemotherapy, radiotherapy and immunosuppressor.For example, in combination with well known in the art Treatment mesothelin mediate disease radiotherapy or chemotheraping preparation treated.

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restrictive, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including since introduction provided herein will become apparent from any and whole variation. Method used in embodiment and reagent, unless otherwise stated, for the method and reagent of this field routine.

Embodiment 1：The determination of Meso CAR-tEGFR gene orders

Anti- Mesothelin heavy chain of antibody and chain variable region gene sequence information are searched from NCBI site databases (M912), sequence is in website http:Codon optimization is carried out on //sg.idtdna.com/site, is ensured in coded amino acid sequence Arrange it is constant in the case of be more suitable for human cell expression.

Each gene nucleotide and amino acid sequence information are shown in (SEQUNCE ID NO.1-2)

Above-mentioned sequence is attached successively, different restriction enzyme sites is introduced in each sequence junction, is formed complete MesothelinCAR-tEGFR gene sequence informations, abbreviation Meso CAR-tEGFR in this patent.

Embodiment 2：Include the structure of the viral vectors of the nucleic acid sequence of CAR molecules

By the nucleotide sequence of the CAR molecules prepared in embodiment 1 through NotI (NEB) and EcoRI (NEB) double digestion, warp The sites NotI-EcoRI of retrovirus RV carriers are inserted into T4 ligases (NEB) connection, are transformed into competence E.coli (DH5 α), recombinant plasmid is served Hai Sheng works Bioisystech Co., Ltd to be sequenced, by sequencing result and the Meso CAR- being fitted to Whether tEGFR sequence alignments are correct to verify sequence.Sequencing primer is：

Sense sequences:AGCATCGTTCTGTGTTGTCTC(SEQUNCE ID NO.3)

Antisense sequences:TGTTTGTCTTGTGGCAATACAC(SEQUNCE ID NO.4)

After being sequenced correctly, simultaneously plasmid purification is extracted using the plasmid purification kit of Qiagen companies, plasmid purification Plasmid calcium phosphate method transfects 293T cells and carries out retrovirus Packaging experimentation.

The plasmid map obtained constructed by the present embodiment is as shown in Figure 1.Fig. 2 shows the portion of the retrovirus expression plasmid Divide sequencing result peak value figure.

Embodiment 3：Retrovirus is packed

1. 293T cells should be less than for 20 generations in the 1st day, do not cover with excessively.With 0.6*10^6cells/ml bed boards, 10cm Ware adds the DMEM culture mediums of 10ml, mixes well cell, 37 degree of overnight incubations.

It is transfected (being typically bed board 14-18h or so) 2. the 2nd day 293T cell fusion degree reaches 90% or so；Prepare Plasmid composite, it is 12.5ug that the amount of various plasmids, which is Retro backbone (MSCV), and Gag-pol 10ug, VSVg are 6.25ug CaCl₂250ul, H₂O is that 1ml total volumes are 1.25ml；Addition is with plasmid composite isometric in another pipe HBS, be vortexed concussion 20s when adding plasmid composite.Softly mixture is added to along side in 293T wares, 37 degree of cultures 4h removes culture medium, and PBS is washed one time, rejoins the fresh culture of preheating.

3. the 4th day：Packing is stored in -80 degree after collecting supernatant after transfection 48h and being filtered with 0.45um filters, continues to add The fresh DMEM medium of preheating.

Embodiment 4：The T cell of retroviral infection people

1. purer CD3+T cells are obtained with Ficcol separating liquids (oceans Tianjin Hao) separation, with the X- of serum containing 5%AB It is 1 × 10 that VIVO (LONZA) culture medium, which adjusts cell density,⁶/mL.Cell is inoculated into advance with the holes 1ml/ with anti-human 50ng/ Ml CD3 antibody (Beijing is with vertical Hai Yuan) and 50ng/ml 41BB antibody (Beijing is with vertical Hai Yuan), add the white thin of 100IU/ml Born of the same parents' interleukin 2 (the double aigrets in Beijing), restrovirus infection in 48 hours is cultivated in stimulation.

After 2.T cell activation cultures every other day, PBS is diluted to the Retronectin (Takara) of final concentration of 15 μ g/ml Non-tissue treated culture plates are coated with, 24 orifice plates are per 250 μ l of hole.It is protected from light, 4 DEG C spare overnight.

The culture of 3.T cell activations two days later, takes out 2 pieces of 24 orifice plates being coated with, and coating buffer is abandoned in suction, is added containing 2%BSA's HBSS room temperatures close 30min.Confining liquid volume is per 500 μ l of hole, and confining liquid is abandoned in suction, with the HBSS board-washings containing 2.5%HEPES Twice.

4. in virus liquid adding holes, 2ml virus liquids being added per hole, 32 DEG C, 2000g, centrifuge 2h.

5. discarding supernatant liquid, the T cell 1 × 10 after activation is added per hole for 24 orifice plates⁶A, volume 1ml, culture medium is that T is thin IL-2 200IU/ml are added in born of the same parents' culture medium.30 DEG C, 1000g, centrifuge 10min.

6. after centrifugation, culture plate is placed in 37 DEG C, is cultivated in 5%CO2 incubators.

7. after infection for 24 hours, cell suspension is sucked out, 1200rpm, 4 DEG C, 7min is centrifuged.

8. after cell infection, the density of cell is observed daily, adds the T cell culture solution of the 100IU/ml containing IL-2 in due course, The density of T cell is set to maintain 5 × 10⁵/ ml or so, makes cell expand.

Embodiment 5：The ratio of T lymphocytes and the expression of surface C AR albumen after flow cytomery infection

72 hours CAR-T cells and NT cells (control group) after infecting are collected by centrifugation respectively, PBS is abandoned after washing 1 time Clearly, PBS after corresponding antibody is protected from light 30min is added to wash, is resuspended, last flow cytomery CAR positive rates.

The present embodiment result shows in Fig. 3, the retroviral infection T cells being prepared using embodiment 3 72 hours Afterwards, the expression efficiency of Meso (m912)-tEGFR CAR+ is up to 43.52%.

Embodiment 6：CD107a detection of expression after CAR-T cells are co-cultured with target cell

1. taking one piece of 96 orifice plate of the bottoms V, add CART/NT cells 2*10 per hole⁵A and target cell (K562-meso)/control is thin Born of the same parents (K562) 2*10⁵It is a, the X-VIVO complete mediums for being free of IL-2 for 100ul are resuspended, BD GolgiStop are added and (contain Often 1 μ l BD GolgiStop are added in 1ml culture mediums in monesin), 2ul CD107a antibody (1 is added per hole:50), 37 DEG C It is incubated 4 hours, collects cell.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C centrifuge 5 minutes.Supernatant is abandoned, often pipe adds Enter appropriate specific surfaces antibody CD3, CD4, CD8, resuspension volume 100ul is protected from light incubation 30 minutes on ice.

3. the PBS cleanings cell per effective 3mL 1 time, 400g is centrifuged 5 minutes.Carefully suck supernatant.

4. appropriate PBS is resuspended, flow cytomery CD3, CD4, CD8, CD107a.

Display is in Fig. 4.Fig. 4 is shown, after Meso (m912)-tEGFR CART cells are co-cultured with K562-meso cells The percentage that CD107a is expressed in CD8 positive cells is respectively 56.4%.

Embodiment 7：INF- γ secretions detect after CAR-T cells are co-cultured with target cell (K562-meso)

1, the CAR-T cells that Example 4 prepares, are resuspended in Lonza culture mediums, adjustment cell concentration be 1 × 10⁶/mL。

2, the culture plate of positive controls adds CD28 monoclonal antibodies 500ng/ml to be coated with using CD3 monoclonal antibodies 500ng/mL in advance, training It supports in base and does not add IL-2.It is added after mixing well in 24 orifice plates, per hole 1mL cell suspensions.BD GolgiPlug are added simultaneously (containing BFA, 1 μ l BD GolgiPlug are added in every 1ml cell culture mediums), after mixing well, 37 DEG C are incubated 5-6 hours.It collects Cell is compareed as CAR-T cell positives.

3, experimental group is per hole cell containing K562-meso+ 2 × 10⁵It is a, CD19-CAR-T cells 2 × 10⁵A, 200 μ l are free of The Lonza culture mediums of IL-2.It is added after mixing well in 96 orifice plates.BD GolgiPlug are added simultaneously and (contain BFA, every 1ml is thin 1 μ l BD GolgiPlug are added in born of the same parents' culture medium), after mixing well, 37 DEG C are incubated 5-6 hours.Cell is collected, as experiment Group.

4, the PBS cleanings cell per effective 1mL 1 time, 300g is centrifuged 5 minutes.Carefully suck or outwell supernatant.

5, after PBS washes cell, 250 μ l/EP pipes is added and fix/penetrating fluid, 4 DEG C are incubated 20 minutes to fix cell and break Film.With 1 × BD Perm/Wash^TMBuffer solution for cleaning cell 2 times, 1mL/ times.

6, intracellular factor dyeing is carried out, appropriate IFN-γ cell factor fluorescence antibody or negative control is taken, uses BDPerm/ Wash^TMBuffer solution is diluted to 50 μ l.The cell for having fixed rupture of membranes is fully resuspended with this antibody diluent, 4 DEG C are protected from light incubation 30min, 1 × BD Perm/Wash^TMThe cleaning cell 2 times of buffer solution 1mL/ times, is then resuspended with PBS.

7, flow cytomery.

Fig. 5 shows the secretion situation of INF- γ after the CAR-T cells and the target cell that prepare 3 days co-culture 5 hours.CAR- T cell is largely activated (18.8%) with CAR-T cells after target cell secretion.

Sequence table

<110>The Shanghai bio tech ltd Heng Run Da Sheng

<120>The Chimeric antigen receptor method and purposes of targeting humanized mesothelin

<141> 2018-04-27

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2751

<212> DNA

<213>People (Homo sapiens)

<220>

<221> primer_bind

<222> (2828)..(5590)

<400> 1

atggctctgc ctgtgaccgc cctgctgctg cctctggctc tgctgctgca cgccgctcgg 60

cctggatccc aggtgcagct gcaggaatct ggccctggcc tcgtgaagcc cagcgagaca 120

ctgagcctga cctgtaccgt gtctggcggc tctgtgtcca gcggcagcta ctactggtcc 180

tggatcagac agccccctgg caagggcctg gaatggatcg gctacatcta ctacagcggc 240

tccaccaact acaaccccag cctgaagtcc agagtgacca tcagcgtgga caccagcaag 300

aaccagttct ccctgaagct gagcagcgtg acagccgccg ataccgccgt gtactactgt 360

gccagagagg gcaagaacgg cgccttcgac atctggggcc agggcacaat ggtcaccgtg 420

tcatctggtg gaggaggatc tgggggaggc ggaagcggag gcggcggatc tgatattcag 480

atgacccaga gccccagcag cctgagcgcc tctgtgggcg acagagtgac aattacctgc 540

cgggccagcc agagcatcag cagctacctg aactggtatc agcagaagcc cggcaaggcc 600

cccaaactgc tgatctacgc cgccagctct ctgcagtctg gcgtgcccag cagattttcc 660

ggctctggca gcggcaccga cttcaccctg accatctcta gcctgcagcc cgaggacttc 720

gccacctact actgccagca gagctacagc acccccctga cctttggcgg aggcaccaag 780

gtggaaatca agacgacaac tcccgctccc cggcctccca cccctgcccc aactattgcc 840

tcccagcctc tttccttgcg ccccgaagcc tgcaggcccg cagctggggg cgctgtgcat 900

acaaggggtc tcgacttcgc atgcgacatc tacatttggg cacccttggc cgggacctgt 960

ggagtgctcc tcctcagcct ggtgatcaca ctgtactgca ggtccaaaag atctaggctg 1020

ctgcattctg attacatgaa catgacgccg cgccgccctg gtccaaccag aaagcattat 1080

cagccctatg caccccctag agactttgcc gcctatcgtt cgaagttcag tgtcgtgaag 1140

agaggccgga agaagctgct gtacatcttc aagcagcctt tcatgaggcc cgtgcagact 1200

acccaggagg aagatggatg cagctgtaga ttccctgaag aggaggaagg aggctgtgag 1260

ctgagagtga agttctcccg aagcgcagat gccccagcct atcagcaggg acagaatcag 1320

ctgtacaacg agctgaacct gggaagacgg gaggaatacg atgtgctgga caaaaggcgg 1380

ggcagagatc ctgagatggg cggcaaacca agacggaaga acccccagga aggtctgtat 1440

aatgagctgc agaaagacaa gatggctgag gcctactcag aaatcgggat gaagggcgaa 1500

agaaggagag gaaaaggcca cgacggactg taccaggggc tgagtacagc aacaaaagac 1560

acctatgacg ctctgcacat gcaggctctg ccaccaagac gagctaaacg aggctcaggc 1620

gcgacgaact ttagtttgct gaagcaagct ggggatgtag aggaaaatcc gggtcccatg 1680

ttgctccttg tgacgagcct cctgctctgc gagctgcccc atccagcctt cctcctcatc 1740

ccgcggaagg tgtgcaatgg cataggcatt ggcgagttta aagattctct gagcataaat 1800

gctacgaata ttaagcattt caagaattgt acttctatta gtggcgacct ccatattctt 1860

ccggttgcct tcaggggtga ctctttcacc cacacacctc cattggatcc acaagaactt 1920

gacatcctga agacggttaa agagattaca ggcttcctcc ttatccaagc gtggcccgag 1980

aacagaacgg acttgcacgc ctttgagaac ctcgaaataa tacggggtcg gacgaagcaa 2040

cacggccaat ttagccttgc ggttgttagt ctgaacatta cttctctcgg ccttcgctct 2100

ttgaaagaaa tcagcgacgg agatgtcatc attagtggaa acaagaacct gtgctacgcg 2160

aacacaatca actggaagaa gctcttcggt acttcaggcc aaaagacaaa gattattagt 2220

aacagaggag agaatagctg taaggctacc ggacaagttt gtcacgcctt gtgtagtcca 2280

gagggttgct ggggaccgga accaagggat tgcgtcagtt gccggaacgt gagtcgcgga 2340

cgcgagtgtg tggataagtg caatcttctg gaaggggaac cgcgagagtt tgtagaaaat 2400

tccgaatgta tacagtgtca tcccgagtgt cttccacaag caatgaatat cacatgtaca 2460

gggaggggtc ctgataactg tatccaatgt gcacactaca tagatggtcc tcactgtgta 2520

aagacgtgcc ccgccggagt aatgggtgaa aacaacaccc tcgtgtggaa gtacgccgat 2580

gccgggcatg tctgtcattt gtgtcatccc aactgcacat atggctgtac cggtcctgga 2640

ttggagggct gtccaacaaa cgggccgaaa ataccgagta tcgcaacagg catggtggga 2700

gcacttttgc ttctcctcgt tgtcgccctg ggcatcggct tgttcatgtg a 2751

<210> 2

<211> 1832

<212> PRT

<213>People (Homo sapiens)

<220>

<221> DOMAIN

<222> (1)..(916)

<400> 2

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Gly Ser Gln Val Gln Leu Gln Glu Ser Gly Pro

20 25 30

Gly Leu Val Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser

35 40 45

Gly Gly Ser Val Ser Ser Gly Ser Tyr Tyr Trp Ser Trp Ile Arg Gln

50 55 60

Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly

65 70 75 80

Ser Thr Asn Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val

85 90 95

Asp Thr Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala

100 105 110

Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg Glu Gly Lys Asn Gly Ala

115 120 125

Phe Asp Ile Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Gly

130 135 140

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln

145 150 155 160

Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val

165 170 175

Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr Leu Asn Trp

180 185 190

Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala

195 200 205

Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser

210 215 220

Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe

225 230 235 240

Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Thr Pro Leu Thr Phe Gly

245 250 255

Gly Gly Thr Lys Val Glu Ile Lys Thr Thr Thr Pro Ala Pro Arg Pro

260 265 270

Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro

275 280 285

Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu

290 295 300

Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys

305 310 315 320

Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Arg Ser Lys

325 330 335

Arg Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg

340 345 350

Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp

355 360 365

Phe Ala Ala Tyr Arg Ser Lys Phe Ser Val Val Lys Arg Gly Arg Lys

370 375 380

Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr

385 390 395 400

Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu

405 410 415

Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro

420 425 430

Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly

435 440 445

Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro

450 455 460

Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr

465 470 475 480

Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly

485 490 495

Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln

500 505 510

Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln

515 520 525

Ala Leu Pro Pro Arg Arg Ala Lys Arg Gly Ser Gly Ala Thr Asn Phe

530 535 540

Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met

545 550 555 560

Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro Ala

565 570 575

Phe Leu Leu Ile Pro Arg Lys Val Cys Asn Gly Ile Gly Ile Gly Glu

580 585 590

Phe Lys Asp Ser Leu Ser Ile Asn Ala Thr Asn Ile Lys His Phe Lys

595 600 605

Asn Cys Thr Ser Ile Ser Gly Asp Leu His Ile Leu Pro Val Ala Phe

610 615 620

Arg Gly Asp Ser Phe Thr His Thr Pro Pro Leu Asp Pro Gln Glu Leu

625 630 635 640

Asp Ile Leu Lys Thr Val Lys Glu Ile Thr Gly Phe Leu Leu Ile Gln

645 650 655

Ala Trp Pro Glu Asn Arg Thr Asp Leu His Ala Phe Glu Asn Leu Glu

660 665 670

Ile Ile Arg Gly Arg Thr Lys Gln His Gly Gln Phe Ser Leu Ala Val

675 680 685

Val Ser Leu Asn Ile Thr Ser Leu Gly Leu Arg Ser Leu Lys Glu Ile

690 695 700

Ser Asp Gly Asp Val Ile Ile Ser Gly Asn Lys Asn Leu Cys Tyr Ala

705 710 715 720

Asn Thr Ile Asn Trp Lys Lys Leu Phe Gly Thr Ser Gly Gln Lys Thr

725 730 735

Lys Ile Ile Ser Asn Arg Gly Glu Asn Ser Cys Lys Ala Thr Gly Gln

740 745 750

Val Cys His Ala Leu Cys Ser Pro Glu Gly Cys Trp Gly Pro Glu Pro

755 760 765

Arg Asp Cys Val Ser Cys Arg Asn Val Ser Arg Gly Arg Glu Cys Val

770 775 780

Asp Lys Cys Asn Leu Leu Glu Gly Glu Pro Arg Glu Phe Val Glu Asn

785 790 795 800

Ser Glu Cys Ile Gln Cys His Pro Glu Cys Leu Pro Gln Ala Met Asn

805 810 815

Ile Thr Cys Thr Gly Arg Gly Pro Asp Asn Cys Ile Gln Cys Ala His

820 825 830

Tyr Ile Asp Gly Pro His Cys Val Lys Thr Cys Pro Ala Gly Val Met

835 840 845

Gly Glu Asn Asn Thr Leu Val Trp Lys Tyr Ala Asp Ala Gly His Val

850 855 860

Cys His Leu Cys His Pro Asn Cys Thr Tyr Gly Cys Thr Gly Pro Gly

865 870 875 880

Leu Glu Gly Cys Pro Thr Asn Gly Pro Lys Ile Pro Ser Ile Ala Thr

885 890 895

Gly Met Val Gly Ala Leu Leu Leu Leu Leu Val Val Ala Leu Gly Ile

900 905 910

Gly Leu Phe Met Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu

915 920 925

Ala Leu Leu Leu His Ala Ala Ala Pro Gly Ser Gly Val Gly Leu Gly

930 935 940

Gly Ser Gly Pro Gly Leu Val Leu Pro Ser Gly Thr Leu Ser Leu Thr

945 950 955 960

Cys Thr Val Ser Gly Gly Ser Val Ser Ser Gly Ser Thr Thr Thr Ser

965 970 975

Thr Ile Ala Gly Pro Pro Gly Leu Gly Leu Gly Thr Ile Gly Thr Ile

980 985 990

Thr Thr Ser Gly Ser Thr Ala Thr Ala Pro Ser Leu Leu Ser Ala Val

995 1000 1005

Thr Ile Ser Val Ala Thr Ser Leu Ala Gly Pro Ser Leu Leu Leu Ser

1010 1015 1020

Ser Val Thr Ala Ala Ala Thr Ala Val Thr Thr Cys Ala Ala Gly Gly

1025 1030 1035 1040

Leu Ala Gly Ala Pro Ala Ile Thr Gly Gly Gly Thr Met Val Thr Val

1045 1050 1055

Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

1060 1065 1070

Ser Ala Ile Gly Met Thr Gly Ser Pro Ser Ser Leu Ser Ala Ser Val

1075 1080 1085

Gly Ala Ala Val Thr Ile Thr Cys Ala Ala Ser Gly Ser Ile Ser Ser

1090 1095 1100

Thr Leu Ala Thr Thr Gly Gly Leu Pro Gly Leu Ala Pro Leu Leu Leu

1105 1110 1115 1120

Ile Thr Ala Ala Ser Ser Leu Gly Ser Gly Val Pro Ser Ala Pro Ser

1125 1130 1135

Gly Ser Gly Ser Gly Thr Ala Pro Thr Leu Thr Ile Ser Ser Leu Gly

1140 1145 1150

Pro Gly Ala Pro Ala Thr Thr Thr Cys Gly Gly Ser Thr Ser Thr Pro

1155 1160 1165

Leu Thr Pro Gly Gly Gly Thr Leu Val Gly Ile Leu Thr Thr Thr Pro

1170 1175 1180

Ala Pro Ala Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gly Pro Leu

1185 1190 1195 1200

Ser Leu Ala Pro Gly Ala Cys Ala Pro Ala Ala Gly Gly Ala Val His

1205 1210 1215

Thr Ala Gly Leu Ala Pro Ala Cys Ala Ile Thr Ile Thr Ala Pro Leu

1220 1225 1230

Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Thr

1235 1240 1245

Cys Ala Ser Leu Ala Ser Ala Leu Leu His Ser Ala Thr Met Ala Met

1250 1255 1260

Thr Pro Ala Ala Pro Gly Pro Thr Ala Leu His Thr Gly Pro Thr Ala

1265 1270 1275 1280

Pro Pro Ala Ala Pro Ala Ala Thr Ala Ser Leu Pro Ser Val Val Leu

1285 1290 1295

Ala Gly Ala Leu Leu Leu Leu Thr Ile Pro Leu Gly Pro Pro Met Ala

1300 1305 1310

Pro Val Gly Thr Thr Gly Gly Gly Ala Gly Cys Ser Cys Ala Pro Pro

1315 1320 1325

Gly Gly Gly Gly Gly Gly Cys Gly Leu Ala Val Leu Pro Ser Ala Ser

1330 1335 1340

Ala Ala Ala Pro Ala Thr Gly Gly Gly Gly Ala Gly Leu Thr Ala Gly

1345 1350 1355 1360

Leu Ala Leu Gly Ala Ala Gly Gly Thr Ala Val Leu Ala Leu Ala Ala

1365 1370 1375

Gly Ala Ala Pro Gly Met Gly Gly Leu Pro Ala Ala Leu Ala Pro Gly

1380 1385 1390

Gly Gly Leu Thr Ala Gly Leu Gly Leu Ala Leu Met Ala Gly Ala Thr

1395 1400 1405

Ser Gly Ile Gly Met Leu Gly Gly Ala Ala Ala Gly Leu Gly His Ala

1410 1415 1420

Gly Leu Thr Gly Gly Leu Ser Thr Ala Thr Leu Ala Thr Thr Ala Ala

1425 1430 1435 1440

Leu His Met Gly Ala Leu Pro Pro Ala Ala Ala Leu Ala Gly Ser Gly

1445 1450 1455

Ala Thr Ala Pro Ser Leu Leu Leu Gly Ala Gly Ala Val Gly Gly Ala

1460 1465 1470

Pro Gly Pro Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Gly Leu

1475 1480 1485

Pro His Pro Ala Pro Leu Leu Ile Pro Ala Leu Val Cys Ala Gly Ile

1490 1495 1500

Gly Ile Gly Gly Pro Leu Ala Ser Leu Ser Ile Ala Ala Thr Ala Ile

1505 1510 1515 1520

Leu His Pro Leu Ala Cys Thr Ser Ile Ser Gly Ala Leu His Ile Leu

1525 1530 1535

Pro Val Ala Pro Ala Gly Ala Ser Pro Thr His Thr Pro Pro Leu Ala

1540 1545 1550

Pro Gly Gly Leu Ala Ile Leu Leu Thr Val Leu Gly Ile Thr Gly Pro

1555 1560 1565

Leu Leu Ile Gly Ala Thr Pro Gly Ala Ala Thr Ala Leu His Ala Pro

1570 1575 1580

Gly Ala Leu Gly Ile Ile Ala Gly Ala Thr Leu Gly His Gly Gly Pro

1585 1590 1595 1600

Ser Leu Ala Val Val Ser Leu Ala Ile Thr Ser Leu Gly Leu Ala Ser

1605 1610 1615

Leu Leu Gly Ile Ser Ala Gly Ala Val Ile Ile Ser Gly Ala Leu Ala

1620 1625 1630

Leu Cys Thr Ala Ala Thr Ile Ala Thr Leu Leu Leu Pro Gly Thr Ser

1635 1640 1645

Gly Gly Leu Thr Leu Ile Ile Ser Ala Ala Gly Gly Ala Ser Cys Leu

1650 1655 1660

Ala Thr Gly Gly Val Cys His Ala Leu Cys Ser Pro Gly Gly Cys Thr

1665 1670 1675 1680

Gly Pro Gly Pro Ala Ala Cys Val Ser Cys Ala Ala Val Ser Ala Gly

1685 1690 1695

Ala Gly Cys Val Ala Leu Cys Ala Leu Leu Gly Gly Gly Pro Ala Gly

1700 1705 1710

Pro Val Gly Ala Ser Gly Cys Ile Gly Cys His Pro Gly Cys Leu Pro

1715 1720 1725

Gly Ala Met Ala Ile Thr Cys Thr Gly Ala Gly Pro Ala Ala Cys Ile

1730 1735 1740

Gly Cys Ala His Thr Ile Ala Gly Pro His Cys Val Leu Thr Cys Pro

1745 1750 1755 1760

Ala Gly Val Met Gly Gly Ala Ala Thr Leu Val Thr Leu Thr Ala Ala

1765 1770 1775

Ala Gly His Val Cys His Leu Cys His Pro Ala Cys Thr Thr Gly Cys

1780 1785 1790

Thr Gly Pro Gly Leu Gly Gly Cys Pro Thr Ala Gly Pro Leu Ile Pro

1795 1800 1805

Ser Ile Ala Thr Gly Met Val Gly Ala Leu Leu Leu Leu Leu Val Val

1810 1815 1820

Ala Leu Gly Ile Gly Leu Pro Met

1825 1830

<210> 3

<211> 21

<212> DNA

<213>People (Homo sapiens)

<220>

<221> primer_bind

<222> (2828)..(2848)

<223>Primer

<400> 3

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213>People (Homo sapiens)

<220>

<221> primer_bind

<222> (5569)..(5591)

<223>Primer

<400> 4

tgtttgtctt gtggcaatac ac 22

Claims (9)

1. a kind of polynucleotide sequence, the polynucleotide sequence is selected from：

(1) contain the coded sequence of sequentially connected anti-mesothelin single-chain antibody, coded sequence, the people CD8 of people's CD8 α hinge areas The coded sequence of transmembrane region, the coded sequence of people's CD28 intracellular regions, the coded sequence of people's 41BB intracellular regions, people CD3 ζ intracellular regions The coded sequence of the segment of coded sequence, the III containing extracellular domain of optional EGFR and extracellular domain IV；With

(2) complementary series of (1) described polynucleotide sequence.

2. polynucleotide sequence as described in claim 1, which is characterized in that

The polynucleotide sequence also coded sequence containing signal peptide before the coded sequence of the anti-mesothelin single-chain antibody, Preferably, the polynucleotide sequence of the signal peptide such as SEQ ID NO:Shown in 1 1-63 polynucleotides；And/or

The polynucleotide sequence such as SEQ ID NO of the anti-mesothelin single-chain antibody:Shown in 1 64-792 polynucleotides；With/ Or

The people CD8 α hinge areas and the polynucleotide sequence of CD8 transmembrane regions such as SEQ ID NO:1 793-999 polynucleotides It is shown；And/or

The polynucleotide sequence of the people CD28 intracellular regions such as SEQ ID NO:Shown in 1 1000-1122 polynucleotides；With/ Or

The polynucleotide sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 1 1123-1266 polynucleotides；With/ Or

The polynucleotide sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 1 1267-1599 polynucleotides；With/ Or

The segment of the EGFR contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or the born of the same parents by EGFR Extracellular portion III, extracellular domain IV and transmembrane region composition；Preferably, the segment contains 310-646 of Human epidermal growth factor receptor Polynucleotide sequence, or be made of 310-646 polynucleotide sequences of Human epidermal growth factor receptor；It is highly preferred that the multinuclear of the segment Nucleotide sequence such as SEQ ID NO:Shown in 1 1758-2751 polynucleotides.

3. a kind of fusion protein, the fusion protein is selected from：

(1) contain sequentially connected anti-mesothelin single-chain antibody, people CD8 α hinge areas, people CD8 transmembrane regions, people CD28 intracellular regions, The III containing extracellular domain and extracellular domain of the fusion protein of people 41BB intracellular regions and people's CD3 ζ intracellular regions, optional EGFR The coded sequence of the segment of IV；With

(2) by replacing, missing or adding one or several amino acid and retaining activation T in the amino acid sequence that (1) limits The fusion protein derived from (1) of cell activity；

Preferably, the anti-mesothelin monoclonal antibody is M912.

4. fusion protein as claimed in claim 3, which is characterized in that the fusion protein has following one or more special Sign：

The fusion protein also contains signal peptide in the N-terminal of the anti-mesothelin single-chain antibody, it is preferable that the ammonia of the signal peptide Base acid sequence such as SEQ ID NO:Shown in 2 1-21 amino acids；

The amino acid sequence such as SEQ ID NO of the anti-mesothelin single-chain antibody:Shown in 2 22-264 amino acids；

The people CD8 α hinge areas and the amino acid sequence of CD8 transmembrane regions such as SEQ ID NO:2 265-333 amino acids institutes Show；

The amino acid sequence of the people CD28 intracellular regions such as SEQ ID NO:Shown in 2 334-375 amino acids；

The amino acid sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 2 376-422 amino acids；

The amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 2 423-533 amino acids；With

The segment of the EGFR contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or the born of the same parents by EGFR Extracellular portion III, extracellular domain IV and transmembrane region composition；Preferably, the segment contains 310-646 of Human epidermal growth factor receptor Amino acid sequence, or be made of the 310-646 amino acids sequences of Human epidermal growth factor receptor；It is highly preferred that the amino acid sequence of the segment Row such as SEQ ID NO:Shown in 2 582-916 amino acids.

5. a kind of nucleic acid constructs, the nucleic acid constructs contains the polynucleotide sequence described in any one of claim 1-2；

Preferably, the nucleic acid constructs is carrier；

It is highly preferred that the nucleic acid constructs is retroviral vector, contain replication origin, 3 ' LTR, 5 ' LTR, pis Packaging signal, restriction enzyme site, described in any one of groundhog hepatitis virus posttranscriptional regulatory element and claim 1-2 Polynucleotide sequence.

6. a kind of retrovirus, the retrovirus contains the nucleic acid constructs described in claim 5, preferably comprises described Carrier, the further preferably described retroviral vector.

7. the pharmaceutical composition of a kind of T cell of genetic modification or the T cell containing the genetic modification, which is characterized in that described thin Born of the same parents contain the polynucleotide sequence described in any one of claim 1-2, or containing the nucleic acid constructs described in claim 5, Or fusion protein described in any one of having infected retrovirus described in claim 6, or stablized expression claim 4 and III containing extracellular domain, the extracellular domain IV segment portions of optional EGFR.

8. the fusion egg described in any one of polynucleotide sequence, claim 3-4 described in any one of claim 1-2 In vain, the nucleic acid constructs described in claim 5 or the retrovirus described in claim 7 are in the T cell for preparing activation Using.

9. the fusion egg described in any one of polynucleotide sequence, claim 3-4 described in any one of claim 1-2 In vain, the nucleic acid constructs described in claim 5, the retrovirus described in claim 6 or the gene described in claim 7 The purposes of the T cell of modification or its pharmaceutical composition in the drug for preparing the disease that treatment mesothelin mediates；

Preferably, the disease that the mesothelin mediates is oophoroma, mesothelioma of pleura, cancer of pancreas and uterine neck, head, neck, the moon The squamous carcinoma in road, lung and oesophagus, preferably malignant pleural mesothelioma, cancer of pancreas, oophoroma and lung cancer.