CN108728459A

CN108728459A - Target the Chimeric antigen receptor of CD19 and the method and purposes of Combined expression IL-15

Info

Publication number: CN108728459A
Application number: CN201710269071.5A
Authority: CN
Inventors: 黄飞; 金涛; 王海鹰; 何凤; 史子啸
Original assignee: Shanghai Hrain Biotechnology Co Ltd
Current assignee: Shanghai Hrain Biotechnology Co Ltd
Priority date: 2017-04-24
Filing date: 2017-04-24
Publication date: 2018-11-02
Anticipated expiration: 2037-04-24
Also published as: CN108728459B

Abstract

The invention discloses a kind of Chimeric antigen receptor CD19-CD8H&TM-41BB-CD3 ζ-mbIL15 and application thereof, which is made of the heavy chain of mouse anti human CD 19 monoclonal antibody (clone FMC63) and light chain variable region (CD19scFv), people's CD8 α hinge areas and transmembrane region, people 41BB intracellular regions and people's CD3 ζ intracellular regions and IL15+IL15R α structures in series.The Chimeric antigen receptor is used for the T lymphocytes of modified human, and the T cell (CAR-T cells) after modification can be used to express the treatment of CD19 Positive Acutes/chronic lymphocytic leukemia and lymthoma.CD19 mbIL15 CAR-T cells prepared by the present invention have specific tumor cell strong killing ability.

Description

Target the Chimeric antigen receptor of CD19 and the method and purposes of Combined expression IL-15

Technical field

The invention belongs to Chimeric antigen receptor fields, and in particular to Chimeric antigen receptor of CD19 and application thereof.

Background technology

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cell refers to being repaiied through gene After decorations, specific purpose antigen, and the T cell of continuous activation amplification can be identified with MHC non-limiting ways.It is 2012 international thin Born of the same parents, which treat association annual meeting middle finger and go out biological immune cell therapy, has become operation, radiotherapy, the 4th kind for the treatment of tumour outside chemotherapy Means, and future tumors will be become and treat essential means.CAR-T cell adoptive therapies are that most clearly have in current cancer therapies The immunotherapeutic form of effect.Numerous studies show that CAR-T cells can effectively identify tumour antigen, cause the anti-of specificity Tumor immune response significantly improves the survival state of patient.

Chimeric antigen receptor (CAR) is the core component of CAR-T, assigns the non-dependent modes of T cell HLA and identifies that tumour is anti- Former ability, this enables the T cell being transformed by CAR to identify wider mesh compared to nave T cell surface receptor TCR Mark.The basic engineering of CAR includes that the combined area a tumor associated antigen (tumor-associated antigen, TAA) is (logical Often derive from the scFV sections of monoclonal antibody antigen calmodulin binding domain CaM), an extracellular hinge area, a transmembrane region and an intracellular are believed Number area.The selection of target antigen for the specificity of CAR, validity and the genetic modification T cell safety of itself all It is the determinant (Science.1986.233 (4770) of key:p.1318-21.).

As technology is or not Chimeric antigen receptor T cell (Chimeric Antigen Receptor-T cell, CAR-T) Disconnected development, CAR-T can mainly be divided into for four generations at present.

First generation CAR-T cells by extracellular combined area-single-chain antibody (single-chain fragment variable, ScFV), transmembrane region (transmembrane region, TM) and intracellular signal area --- immunoreceptor tyrosine activating motif (immunoreceptortyrosine-based activation motif, ITAM) is formed, wherein each portion of Chimeric antigen receptor Divide and is connected by following form：scFv-TM-CD3ζ.Although first generation CAR it can be seen that some specificity cytotoxicities, Have been found that curative effect is barely satisfactory when carrying out clinical test summary to it within 2006.Trace it to its cause is because of first generation CAR-T Cell will soon exhaust that persistence (persistence) is very poor in patient body, so that CAR-T cells come not yet And just this kind of CAR-T cell of apoptosis can excite antitumoral cytotoxic to imitate when touching a large amount of tumour cell It answers, but cytokine secretion is fewer, but its survival period in vivo is shorter cannot excite lasting anti-tumor effect. [ZhangT.et.al.Cancer Res2007,67(22):11029-11036.]

T cell activation signaling zone is still the hot spot of research in the optimization CAR designs of second generation CAR-T cells.T cell it is complete Full activation depends on the effect of dual signal and cell factor.Wherein the first signal is specific signals, and antigen submission is identified by TCR Antigenic Peptide-MHC the compounds of cell surface are started；Second signal is costimulatory signal.Early in 1998, there have been Two generation CAR (Finney HM et al.J Immunol.1998；161(6):2791-7.).2nd generation CAR is in intracellular signal peptide area A costimulatory molecules are added to, i.e., costimulatory signal are assembled into inside CAR, can be preferably that CAR-T cells carry For activation signals, costimulatory molecules and intracellular signal can be activated simultaneously after such CAR tumor cells, realize dual work Change, T cell proliferation secretion capacity and anti-tumor effect can be significantly improved.First T cell costimulatory signal studied in detail Receptor is CD28, it can be combined with the B7 family members of target cell surface.The costimulation of CD28 can promote the increasing of T cell It grows, the synthesis and expression of IL-2 and the ability of enhancing T cell resistance apoptosis.Then there is CD134 (OX40) and CD137 again Costimulatory molecules such as (4-1BB) maintain t cell response to improve cytotoxicity, the proliferation activity of T cell, extend T cell and deposit Live time etc..Such second generation CAR produces unexpected effect in subsequent clinical test, is based on from 2010 The clinical report of second generation CAR repeatedly causes vibrations, especially for recurrent, intractable patient ALL, complete remission rate Up to 90% or more.

Third generation CAR signal peptides area integrates 2 or more costimulatory molecules, T cell continuous activation can be made to be proliferated, cell The ability of factor continuous release, T cell killing tumor cell is more notable, i.e., CAR of new generation can get stronger antitumor Response (Pule MA et al.Mol Ther.2005,12 (5):933-941.).Most typical is exactly that UPen Carl June exist The stimulating factor of a CD137 (4-1BB) is added under the action of CD28 stimulating factors again.

The CAR-T cells of forth generation then add cell factor or costimulation ligand, such as four generation CAR can generate IL- 12, the activation of immune microenvironment-increase T cell can be adjusted, while activating inherent immunity cell that it is made to play a role and coming clearly Except the cancer cell of target antigen feminine gender, to have the function that bidirectional modulation.[Chmielewski M,Abken H.Expert Opin Biol Ther.2015；15(8):1145-54.]

CD19 is a kind of glycoprotein of the 95kDa on B cell surface, is expressed since the early stage that B cell is developed is, until its It is divided into thick liquid cell.CD19 is one of the member of immunoglobulin (Ig) superfamily, as B cell surface signal transduction compound One of component, participated in the signal transduction process of B-cell receptor.In the mouse model of CD19 defects, periphery The quantity of B cell will appear apparent reduction in lymphoid tissue, can also decline to the response of vaccine and mitogen, while with blood The attenuating of clear Ig levels.Generally, it is considered that the expression of CD19 is only limited to B cell system (B-cell lineage), it is more without being expressed in It can hemopoietic stem cell surface.It is thin that CD19 is also expressed in most of B cell lymphomas, lymphoma mantle cell, ALLs, CLLs, crinosity The surface of born of the same parents' leukaemia and a part of acute myeloid leukemia cells in children.Therefore, in the treatment to leukaemia/lymthoma, CD19 It is a kind of very valuable immunotherapeutic targets.Importantly, CD19 will not be expressed in it is most of normal thin in addition to B cell Cellular surface, including pluripotential hemopoietic stem cell, this feature allow CD19 as a kind of safe therapy target, can send out patient Raw autoimmune disease or the risk of irreversibility bone marrow toxicity damage minimize.Currently, anti-CD19 is had been developed that Antibody or scFv segments, and demonstrate in mouse model and the mankind/primate the foreground of its application.

Interleukin 15 (interleukin 15, IL-15) is a kind of cell factor found in 1994, is by 114 The glycoprotein of the 14-15KD sizes of a amino acid composition, belongs to a member in four-helix bundle cytokine family.IL-15 is being tied There is homology with interleukin 2 (interleukin 2, IL-2) on structure, receptor is by the IL-15 receptors a with high-affinity Chain, IL-2/15 receptor βs chain and public chain γ chains composition.Therefore IL-15 has the function of similar in some and IL-2, for example pierces Swash T cell activation and proliferation, enhance NK cell killing activities and B cell is promoted to generate immunoglobulin.Research finds IL- recently 15 have played important function in NK cells, the differentiation of NKT cells and enterocyte, proliferation, activation process, IL-15 with IL-17 is extremely important to the steady-state adjustment of CD8 memory t cells.Research also confirms that IL-15 passes through a kind of special " anti-submission " Mechanism come regulate and control CD8 memory t cells proliferation and NK cells life cycle, i.e., it is a kind of expression IL-15 α chain receptors cell It can be by IL-15 submissions to the cell of expression IL-15B chains and γ chains.More research shows that IL-15, which is one kind, extensive biology The powerful cell factor for learning function, in addition to there is important adjustment effect to immune system, in non-immunological systems No less important, for example important regulative is also played to skeletal muscle anabolism.

The present invention carries out this CAR the two generation CAR of the targeting CD19 of structure, costimulating factor 41BB, the present invention Modification introduces IL15 structures, and IL15 is powerful cell factor, has important adjustment effect to immune system, has The addition of this structure, the CAR-T cells of structure will have stronger strong function.

Accumulation with CAR-T cell therapy experiences and constantly improve, application in entity tumor increasingly by All circles pay close attention to.In such circumstances, we will quicken one's step, and utilize itself existing working foundation, R&D team, medical team Shen It please carry out clinical test, CAR-T cell therapies is pushed to be fast forwarded through on the road of solid tumor.

Invention content

First aspect present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from：

(1) contain the coded sequence of sequentially connected anti-CD 19 antibodies, the coded sequence of people's CD8 α hinge areas, people CD8 across The coded sequence and IL15 structured coding sequences of the coded sequence in film area, the coded sequence of people's 41BB intracellular regions, people's CD3 ζ intracellular regions The polynucleotide sequence of row；With

(2) complementary series of (1) described polynucleotide sequence.

In one or more embodiments, coded sequence of the polynucleotide sequence in the anti-CD19 single-chain antibodies The preceding also coded sequence containing signal peptide.In one or more embodiments, the amino acid sequence such as SEQ of the signal peptide ID NO:Shown in 2 1-21 amino acids.In one or more embodiments, the light chain variable of the anti-CD19 single-chain antibodies The amino acid sequence in area such as SEQ ID NO:Shown in 2 22-128 amino acids.It is described anti-in one or more embodiments The amino acid sequence of the heavy chain variable region of CD19 single-chain antibodies such as SEQ ID NO:Shown in 2 144-263 amino acids.At one Or in multiple embodiments, the amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:2 264-310 amino acids institutes Show.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the people CD8 transmembrane regions:2 311-332 Shown in amino acid.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the people 41BB intracellular regions:2 Shown in 333-380 amino acids.In one or more embodiments, the amino acid sequence such as SEQ of the people CD3 ζ intracellular regions ID NO:Shown in 2 381-491 amino acids.In one or more embodiments, the amino acid sequence of the IL-15 is such as SEQ ID NO:Shown in 2 650-912 amino acids.

In one or more embodiments, the signal peptide before the coded sequence of the anti-CD19 single-chain antibodies Coded sequence such as SEQ ID NO:Shown in 1 1-63 nucleotide sequences.In one or more embodiments, the anti-CD19 The coded sequence of the light chain variable region of single-chain antibody such as SEQ ID NO:Shown in 1 64-321 nucleotide sequences.At one or In multiple embodiments, the coded sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD19 single-chain antibodies:1 430-789 Shown in the nucleotide sequence of position.In one or more embodiments, the coded sequence such as SEQ ID of the people CD8 α hinge areas NO:Shown in 1 790-930 nucleotide sequences.In one or more embodiments, the code sequence of the people CD8 transmembrane regions Row such as SEQ ID NO:Shown in 1 931-996 nucleotide sequences.In one or more embodiments, the people 41BB born of the same parents The coded sequence of inner region such as SEQ ID NO:Shown in 1 997-1140 nucleotide sequences.In one or more embodiments, The coded sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 1 1141-1473 nucleotide sequences.At one or more In a embodiment, the coded sequence such as SEQ ID NO of the segment of the IL-15:1 1606-2736 nucleotide sequence institutes Show.

Second aspect of the present invention provides a kind of fusion protein, and the fusion protein is selected from：

(1) contain sequentially connected anti-CD19 single-chain antibodies, people CD8 α hinge areas, people CD8 transmembrane regions, people's 41BB intracellular regions With the fusion protein and IL15 structural coding sequences of people's CD3 ζ intracellular regions；With

(2) it is lived in the amino acid sequence that (1) limits by replacing, missing or adding one or several amino acid and retaining Change the active fusion protein derived from (1) of T cell；

Preferably, the anti-CD19 monoclonal antibodies FMC63.

Third aspect present invention provides a kind of nucleic acid constructs, and the nucleic acid constructs contains polynucleotides as described herein Sequence.

In one or more embodiments, the nucleic acid constructs is carrier.In one or more embodiments, institute It is retroviral vector to state nucleic acid constructs, contains replication origin, 3 ' LTR, 5 ' LTR, pis packaging signals, digestion position Point, groundhog hepatitis virus posttranscriptional regulatory element, polynucleotide sequence as described herein, and optional selectable mark Note.

Fourth aspect present invention provides a kind of retrovirus, and the retrovirus contains nucleic acid construct as described herein Object preferably comprises the carrier, the further preferably described retroviral vector.

Fifth aspect present invention provides a kind of T cell of genetic modification, and the cell contains polynucleotides as described herein Sequence, or contain nucleic acid constructs as described herein, or retrovirus as described herein has been infected, or stablize expression this paper institutes The fusion protein and optional IL-15 segment portions stated.

Sixth aspect present invention provides a kind of pharmaceutical composition of the T cell containing genetic modification as described herein.

Seventh aspect present invention provides polynucleotide sequence, fusion protein, nucleic acid constructs or reverse transcription as described herein Application of the virus in the T cell for preparing activation.

Eighth aspect present invention offer polynucleotide sequence as described herein, fusion protein, nucleic acid constructs, reverse transcription disease Purposes of the T cell or its pharmaceutical composition of poison or genetic modification in the drug for preparing the disease that treatment CD19 is mediated.

In one or more embodiments, the disease is expression CD19 Positive Acutes/chronic lymphocytic leukemia With the treatment of lymthoma.

Description of the drawings

Fig. 1：MSCV-CD19-mbIL15CAR retrovirus expression vectors (RV-CD19-IL15) schematic diagram.SP：Signal Peptide；VL：Light chain variable region；Lk：Connector (G₄S)₃；VH：Heavy chain variable region；H：CD8 α hinge areas；TM：CD8 transmembrane regions；WPRE：Soil Dial murine hepatitis virus posttranscriptional regulatory element.

Fig. 2：The part sequencing result of MSCV-CD19-mbIL15CAR retrovirus expression vectors (RV-CD19-IL15) Peak value figure.

Fig. 3：For 72 hours CD19-tEGFR and CD19- of FCM results show retroviral infection T cell MbIL15 CAR-T expression efficiencies

Fig. 4：CD19-tEGFR and CD19-mbIL15 CAR-T cells to prepare 5 days co-culture 5 hours with target cell CD107a is expressed

Fig. 5：CD19-tEGFR and CD19-mbIL15 CAR-T cells to prepare 5 days co-culture 5 hours with target cell The secretion of INF- γ

Fig. 6：CD19-tEGFR and CD19-mbIL15 CAR-T cells to prepare 5 days co-culture 16 hours with target cell Afterwards to the lethal effect of tumour cell

Specific implementation mode

The present invention provides a kind of Chimeric antigen receptor of CD19 (CAR).It is single-stranded anti-that the CAR contains sequentially connected anti-CD19 Body, people CD8 α hinge areas, people CD8 transmembrane regions, people 41BB intracellular regions, people's CD3 ζ intracellular regions and IL15 structure fragments.

Various anti-CD19 monoclonal antibodies well known in the art can be derived from by being suitable for the invention anti-CD19 single-chain antibodies.

Optionally, the light chain variable region and heavy chain variable region can be linked together by joint sequence.Can illustrate this Class single-chain antibody includes but not limited to FMC63, SJ25C1.In certain embodiments, the monoclonal antibody is that clone number is The monoclonal antibody of FMC63.

Form the fusion protein of the present invention, such as light chain variable region and heavy chain variable region, people CD8 α of anti-CD19 single-chain antibodies Hinge area, people CD8 transmembrane regions, 41BB and people's CD3 ζ intracellular regions etc., can be directly connected to, or can pass through joint sequence between each other Connection.Joint sequence can be the joint sequence suitable for antibody well known in the art, such as the joint sequence containing G and S.It is logical Often, connector contains the front and back motif repeated of one or more.For example, the motif can be GGGS, GGGGS, SSSSG, GSGSA and GGSGG.Preferably, which is adjacent in joint sequence, and amino acid residue is not inserted between repetition.Joint sequence Can include that 1,2,3,4 or 5 repetition motif forms.The length of connector can be 3~25 amino acid residues, such as 3~15, 5~15,10~20 amino acid residues.In certain embodiments, joint sequence is more glycine linlcers sequences.Joint sequence The quantity of middle glycine is not particularly limited, usually 2~20, such as 2~15,2~10,2~8.Except glycine and silk ammonia Acid comes, and other known amino acid residue, such as alanine (A), leucine (L), threonine (T), paddy are also contained in connector Propylhomoserin (E), phenylalanine (F), arginine (R), glutamine (Q) etc..

It should be understood that in gene cloning operation, it is often necessary to design suitable restriction enzyme site, this certainly will be in expressed ammonia Base acid sequence end introduces one or more incoherent residues, and this has no effect on the activity of aim sequence.In order to build Fusion protein, the expression for promoting recombinant protein obtain the recombinant protein being secreted into automatically outside host cell or are conducive to recombinant protein Purifying, it is often necessary to it is other suitable in the ends N-, the ends C- or the albumen of recombinant protein to be added to some amino acid In region, it may for example comprise but be not limited to, suitable joint peptide, signal peptide, leader peptide, end extend etc..Therefore, of the invention The aminoterminal or c-terminus of fusion protein (the i.e. described CAR) can also contain one or more polypeptide fragments, as protein tag.Appoint What suitable label may be used to herein.For example, the label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out albumen pure Change.

The present invention also includes SEQ ID NO:CAR, SEQ ID NO shown in 2 22-491 amino acids sequences:2 22- CAR, SEQ ID NO shown in 912 amino acids sequences:CAR or SEQ ID NO shown in 2 1-491 amino acids sequences:2 Shown in CAR mutant.These mutant include：With the CAR at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity simultaneously retain the biological activity of the CAR (as activation T is thin Born of the same parents) amino acid sequence.The sequence identity between the sequence of BLASTp two comparisons of calculating of such as NCBI can be used.

Mutant further includes：In SEQ ID NO:2 amino acid sequence, SEQ ID NO shown in 22-491:2 22- Amino acid sequence shown in 912, SEQ ID NO:2 amino acid sequence or SEQ ID NO shown in 1-491:Shown in 2 There are one or several biological activities for being mutated (insertion, deletion or substitution) while still retaining the CAR in amino acid sequence Amino acid sequence.Several mutation are often referred within 1-10, such as 1-8,1-5 or 1-3.Substitution is preferably Conservative replaces.For example, in the art, when carrying out conservative replaces with amino acid similar in performance, usually will not Change the function of protein or polypeptide." amino acid similar in performance " includes for example, the amino acid with similar side chain The family of residue, these families include the amino acid (such as lysine, arginine, histidine) with basic side chain, have acid The amino acid (such as aspartic acid, glutamic acid) of property side chain, amino acid (such as the sweet ammonia with uncharged polar side chain Acid, asparagine, glutamine, serine, threonine, tyrosine, cysteine), the amino acid (example with non-polar sidechain Such as alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), have β-branch side The amino acid (such as threonine, valine, isoleucine) of chain and amino acid (such as tyrosine, phenylpropyl alcohol with aromatic side chain Propylhomoserin, tryptophan, histidine).Therefore, in polypeptide of the present invention one is replaced with another amino acid residue from the same side chain class A or several sites, will not be in substantially influences its activity.

The present invention includes encoding the polynucleotide sequence of fusion protein of the present invention.The present invention polynucleotide sequence can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be it is single-stranded or Double-strand.DNA can be coding strand or noncoding strand.The present invention also includes the degeneracy of the polynucleotide sequence of encoding fusion protein Variant encodes identical amino acid sequence but the different nucleotide sequence of nucleotide sequence.

Polynucleotide sequence as described herein can usually use PCR amplification method to obtain.Specifically, can be public according to institute herein The nucleotide sequence opened, especially open reading frame sequence carry out design primer, the commercially available libraries cDNA are used in combination or by art technology The libraries cDNA prepared by conventional method known to personnel expand as template and obtain related sequence.When sequence is longer, usually need Twice or multiple PCR amplification, then the segment that each time amplifies is stitched together by proper order again.For example, In certain embodiments, the polynucleotide sequence such as SEQ ID NO of fusion protein described herein are encoded:1 64-1473 cores Shown in thuja acid, or such as SEQ ID NO:Shown in 1 1-1473 nucleotide.

The present invention also relates to nucleic acid constructs, which contains polynucleotide sequence as described herein, Yi Jiyu One or more regulating and controlling sequences of these series of operations connection.Polynucleotide sequence of the present invention can in many ways by Operation is to ensure the expression of the fusion protein (CAR and/or IL-15).It can basis before nucleic acid constructs is inserted into carrier Difference or the requirement of expression vector and nucleic acid constructs is operated.Change polynucleotide sequence using recombinant DNA method Technology be known in the art.

Regulating and controlling sequence can be suitable promoter sequence.Promoter sequence is usually grasped with the coded sequence of albumen to be expressed The property made connection.Promoter can any nucleotide sequence of transcriptional activity be shown in selected host cell, including dash forward Become, truncated and hybrid promoter, and can be from coding and the homologous or heterologous extracellular or intracellular polypeptide of the host cell Gene obtain.Regulating and controlling sequence can also be suitable transcription terminator sequences, be identified by host cell to terminate the sequence of transcription Row.Terminator sequence is connect with 3 ' end effectors of the nucleotide sequence for encoding the polypeptide.Have in the host cell of selection Any terminator of function can be used in the present invention.Regulating and controlling sequence can also be suitable targeting sequencing, to host cell translation The non-translational region of important mRNA.5 ' ends of targeting sequencing and the nucleotide sequence for encoding the polypeptide are operatively connected.It is selecting Functional any terminator can be used in the present invention in the host cell selected.

In certain embodiments, the nucleic acid constructs is carrier.Usually pass through the more of the present invention that are operably connected Nucleotide sequence is incorporated to expression vector to promoter, and by construct, realizes the expression of polynucleotide sequence of the present invention.The carrier Can be suitable for replicating and integrating eukaryocyte.Typical cloning vector includes that can be used for adjusting it is expected nucleic acid sequence expression Transcription and translation terminator, homing sequence and promoter.

The polynucleotide sequence of the present invention can be cloned into the carrier of many types.For example, plasmid, phagocytosis can be cloned into Grain, phage-derived object, animal virus and clay.Further, carrier is expression vector.Expression vector can be with viral vectors Form is supplied to cell.Viral vector technology be well known in the present art and such as Sambrook etc. (2001, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, New York) It is described in other virology and molecular biology manual.The virus that can be used as carrier includes but not limited to reverse transcription disease Poison, adenovirus, adeno-associated virus, herpesviral and slow virus.

In general, suitable carrier is included in the replication orgin to work at least one organism, promoter sequence, conveniently Restriction enzyme sites and one or more selectable label (for example, WO 01/96584；WO01/29058；And U.S. Patent number 6,326,193)。

For example, in certain embodiments, the present invention uses retroviral vector, the retroviral vector to contain multiple Initiation site processed, 3 ' LTR, 5 ' LTR, pis packaging signals, restriction enzyme site, groundhog hepatitis virus posttranscriptional regulatory element, herein The polynucleotide sequence, and optional selectable label.The groundhog hepatitis virus posttranscriptional regulatory element can The stability of enhanced virus transcript.

One example of suitable promoter is instant early stage cytomegalovirus (CMV) promoter sequence.The promoter sequence Row are can to drive the strong constitutive promoter sequence for being operably coupled to any polynucleotide sequence high level expression thereon Row.Another example of suitable promoter is -1 α of the elongation growth factor (EF-1 α).It is also possible, however, to use other composing types open Promoter sequences, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer viral (MMTV), people are immune scarce It is instant to fall into long end repetition (LTR) promoter of virus (HIV), MoMuLV promoters, avian leukosis virus promoter, Epstein-Barr virus Early promoter, Rous sarcoma virus promoter and people's gene promoter, such as, but not limited to actin promoter, Myosin promoter, ferroheme promoter and creatine kinase promoter.Further, it also contemplates for starting using induction type Son.The use of inducible promoter provides molecular switch, and the induction type that is operably connected can be opened when expressing in the time limit The expression of the polynucleotide sequence of promoter, and expression is being closed when expression is undesirable.The example of inducible promoter Including but not limited to metallothionein promoter, Glucocorticoid promoter, progesterone promoter and tetracycline promoter.

In order to assess the expression of CAR polypeptides or part thereof, the expression vector for being introduced into cell also may include selectable mark Any of gene or reporter or both are remembered, in order to from the cell mass for seeking to be transfected or infect by viral vectors Middle identification and selection expression cell.In other respects, selectable label can be carried on independent section of DNA and be used for corotation Contaminate program.The flank of selectable label and both reporters can all have regulatory sequence appropriate, so as in host It is expressed in cell.Useful selectable marker includes such as antibiotics resistance gene, such as neo etc..

Reporter is used to identify the cell of potential transfection and the functionality for evaluating regulatory sequence.DNA by After introducing recipient cell, the expression of reporter is measured under the suitable time.Suitable reporter may include encoding The base of luciferase, beta galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase or Green Fluorescent Protein gene Cause.Suitable expression system is well known and prepares using known technology or commercially obtain.

The method that gene is introduced cell and gene expression is entered to cell is well known in the art.Carrier can by Any method in this field is easily introduced into host cell, for example, mammal, bacterium, yeast or insect cell.For example, Expression vector can be transferred to host cell by physics, chemistry or biological means.

The physical method that polynucleotides are introduced to host cell includes calcium phosphate precipitation, lipofection, particle bombardment, micro- Injection, electroporation etc..The biological method that interested polynucleotides are introduced to host cell includes being carried using DNA and RNA Body.Include dispersion system of colloid by the chemical means that polynucleotides introduce host cell, such as macromolecular complex, nanometre glue Capsule, microballoon, pearl；With the system based on lipid, including oil in water emulsion, micella, mixed micelle and liposome.

The biological method that polynucleotides are introduced to host cell includes using viral vectors, especially retrovirus vector Body, this has become the most widely used method that gene is inserted into mammal such as people's cell.Other viral vectors can source From slow virus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus etc..Many has been developed based on virus System, for gene transfer to be entered mammalian cell.For example, retrovirus provides the convenience for gene delivery system Platform.By the gene insertion vector of selection and it is packaged into retroviral particle using technology as known in the art.It should Recombinant virus then can be detached and be transferred in vivo or in vitro subject cell.Many retroviral systems are in the art It is known.In some embodiments, using adenovirus vector.Many adenovirus vectors are well known in the art.? In one embodiment, slow virus carrier is used.

Therefore, in certain embodiments, the present invention also provides the retrovirus for activating T cell, which contains There are retroviral vector as described herein and corresponding packaging gene, such as gag, pol and vsvg.

It is suitable for the invention various types of T cells that T cell can be various sources.For example, T cell can derive from The PBMC of B cell malignant tumor patient.

It in certain embodiments, can be first with suitable (such as 30~80ng/ml, such as 50ng/ml) after obtaining T cell CD3 antibody stimulation activation, then containing suitable (such as 30~80IU/ml, such as 50IU/ml) IL2 culture mediums carry out It cultivates spare.

Therefore, in certain embodiments, the present invention provides a kind of T cell of genetic modification, the T cell of the genetic modification Containing polynucleotide sequence as described herein, or contain retroviral vector as described herein, or has infected as described herein Retrovirus, or be prepared using method described herein.

The CAR-T cells of the present invention can undergo firm internal T cell and extend and be held with high level in blood and marrow Continue extended time quantum, and forms specific memory T cell.Be not intended to be fettered by any specific theory, encounter and with Afterwards eliminate expression Surrogate antigen target cell after, CAR-T cells of the invention can differentiation in vivo at center remember sample state.

The invention also includes a kind of cell therapy, wherein T cell is expressed CAR as described herein and optionally by genetic modification IL-15 and CAR-T cells by injection need its recipient in.The cell of injection can kill the tumour cell of recipient. Unlike antibody therapy, CAR-T cells can replicate in vivo, generate the long-term persistence that continued tumor can be caused to control.

The anti-tumor immune response caused by CAR-T cells can be active or passive immunity response.In addition, what CAR was mediated Immune response can be a part for adoptive immunotherapy step, and wherein CAR-T cells induction is to the antigen-binding portion dtex in CAR Anisotropic immune response.

Therefore, CAR, its coded sequence, nucleic acid constructs, expression vector, virus and the CAR-T that the present invention can be used are thin The disease of born of the same parents' treatment is preferably the disease that CD19 is mediated.

The T cell of the CAR- modifications of the present invention can be administered alone or as pharmaceutical composition and diluent and/or and its Such as relevant cell factor of his component or cell mass combine application.Briefly, pharmaceutical composition of the invention may include as CAR-T cells as described herein, with one or more pharmacy or physiologically acceptable carriers, diluent or excipient are combined. Such composition may include buffer solution such as neutral buffered saline, sulfate buffered saline etc.；Carbohydrate such as Portugal Grape sugar, mannose, sucrose or glucan, mannitol；Protein；Polypeptide or amino acid such as glycine；Antioxidant；Chelating agent Such as EDTA or glutathione；Adjuvant (for example, aluminium hydroxide)；And preservative.

The mode that the pharmaceutical composition of the present invention can be suitable for the disease of (or prevention) to be treated is applied.The quantity of application It will be determined by such factor with frequency, such as the illness of patient and the type of patient disease and severity.

When pointing out " effective quantity in immunology ", " antitumor effective quantity ", " tumour-inhibition effective quantity " or " therapeutic dose ", The precise volume of the present composition to be administered can be determined that the age of consideration patient (object), weight, tumour are big by doctor The individual difference of small, infection or metastasis degree and illness.It can usually point out：Include the pharmaceutical composition of T cell described herein It can be with 10⁴To 10⁹The dosage of a cell/kg weight, preferably 10⁵To 10⁶The dosage of a cell/kg weight.T cell composition It can also be with these dosage multiple applications.Cell can be by using well known injection technique in immunotherapy (see for example Rosenberg etc., New Eng.J.of Med.319:1676,1988) it applies.Optimal dose for specific patient and treatment Scheme can simultaneously therefore adjustment for the treatment of be readily determined by medical domain technical staff by monitoring the disease indication of patient.

The application of object composition object can carry out in any convenient manner, including by spray-on process, inject, swallow, defeated Liquid, implantation or transplanting.Compositions described herein can by subcutaneous, intradermal, tumor, in knot, in spinal cord, intramuscular, pass through vein It is administered to patient in interior injection or peritonaeum.In one embodiment, T cell composition of the invention passes through intradermal or subcutaneous note It penetrates and is administered to patient.In another embodiment, T cell composition of the invention is preferably applied by being injected intravenously.T is thin The composition of born of the same parents can be injected directly into tumour, lymph node or infection position.

In some embodiments of the present invention, CAR-T cells of the invention or combinations thereof object can with it is known in the art Other therapies combine.The therapy includes but not limited to chemotherapy, radiotherapy and immunosuppressor.For example, in combination with well known in the art The radiotherapy of disease that mediates for the treatment of CD19 or chemotheraping preparation treated.

Herein, " anti-tumor effect " refers to a kind of biological effect, can be by the reduction of gross tumor volume, tumor cell number Reduction, the reduction of transfer number, the increase of life expectancy are indicated with the improvement of the relevant various physiological signs of cancer.

" patient ", " object ", " individual " etc. are used interchangeably herein, and referring to can cause the work of immune response organic Body, such as mammal.Example includes but not limited to people, dog, cat, mouse, rat and its genetically modified organism.

The present invention is using the gene order of anti-CD 19 antibodies (scFV for being specifically derived from FMC63), full genome of the present invention The genetic fragment for synthesizing Chimeric antigen receptor CD19thelin scFv-CD8H&TM-41BB-CD3 ζ-IL15, is inserted into reverse transcription Viral vectors MSCV, empty carrier MSCV can be used for recombinating introducing purpose nucleic acid sequence, that is, encode the nucleic acid sequence of CAR.Weight Group plasmid packaging virus in 293T cells, infects T cell, T cell is made to express the Chimeric antigen receptor.At one of the present invention In embodiment, realize that the method for transformation of the T lymphocytes of Chimeric antigen receptor genetic modification is to be based on Retroviral Transformation Method.This method has transformation efficiency high, and foreign gene can stablize expression, and can shorten in vitro culture T lymphocytes and arrive Up to clinical number of stages time the advantages that.Pass through transcription, accurate translation in the nucleic acid of transgenosis T lymphocytic cell surfaces, conversion On it.The retrovirus for the expression CAR that the present invention is obtained prepares CAR-T cells by Retronectin methods, prepares 3 The efficiency of infection of CAR-T cells flow cytometer detection CAR after it, CAR-T cells are swollen with the CD19 positives in vitro after preparing 5 days Oncocyte (NALM6 and Raji) co-cultures the secretion of detection CD107a expression and IFN γ in 5 hours, CAR-T cells after preparing 5 days 16 hours methods are co-cultured with the tumour cell of the CD19 positives (NALM6 and Raji) in vitro and detect CAR-T cells against tumor cells Specific killing action (cytotoxicity).Therefore CD19-mbIL15 CAR-T of the present invention can be acute in B cell/chronic It is applied in lymphocytic leukemia and lymphoma treating.

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restrictive, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including since introduction provided herein will become apparent from any and whole variation. Method used in embodiment and reagent, unless otherwise stated, for the method and reagent of this field routine.

NT cells used in embodiment are the T cell of the untransfected in source same as Example 4, are used as control cell. K562 cells and NALM6 and Raji derive from ATCC cell banks, the cell of respectively negative expression CD19 and positive expression CD19.

Embodiment 1：The determination of CD19scFv-CD8-41BB-CD3 ζ-mbIL15 gene orders

1.1 from NCBI site databases search people's CD8 α hinge areas and transmembrane region, people 41BB intracellular regions, people CD3 ζ born of the same parents Inner region, IL15 and IL15R α mature peptide gene sequence informations, anti-CD19 single-chain antibodies clone number is FMC63, these sequences are in net Stand http:Codon optimization is carried out on //sg.idtdna.com/site, is ensured in the case where encoding amino acid sequence is constant It is more suitable for human cell's expression.

Each amino acid and gene sequence information are shown in SEQENCE LISTING (SEQUNCE ID NO.1-2).

Above-mentioned sequence is attached successively, different restriction enzyme sites is introduced in each sequence junction, forms complete CD19- BBz-mbIL15 gene sequence informations.

1.2 recombinant plasmids are sequenced

Recombinant plasmid is served Hai Sheng works Bioisystech Co., Ltd be sequenced, by sequencing result and be fitted to Whether CD19-BBz-mbIL15 sequence alignments are correct to verify sequence.Sequencing primer is：

Sense sequences:AGCATCGTTCTGTGTTGTCTC(SEQUNCE ID NO.3)

Antisense sequences:TGTTTGTCTTGTGGCAATACAC(SEQUNCE ID NO.4)

Embodiment 2：Include the structure of the viral vectors of the nucleic acid sequence of CAR molecules

By the nucleotide sequence of the CAR molecules prepared in embodiment 1 through NotI (NEB) and EcoRI (NEB) double digestion, warp The sites NotI-EcoRI of retrovirus RV (MSCV) carrier are inserted into T4 ligases (NEB) connection, are transformed into competence E.coli (DH5 α) uses the plasmid purification kit extraction of Qiagen companies and plasmid purification, purifies matter after being sequenced correctly The plasmid calcium phosphate method transfection 293T cells of grain carry out retrovirus Packaging experimentation.

The plasmid map obtained constructed by the present embodiment is as shown in Figure 1.Fig. 2 shows the portion of the retrovirus expression plasmid Divide sequencing result peak value figure.

Embodiment 3：Retrovirus is packed

1. 293T cells should be less than for 20 generations in the 1st day, do not cover with excessively.With 0.6*10^6cells/ml bed boards, 10cm Ware adds the DMEM culture mediums of 10ml, mixes well cell, 37 degree of overnight incubations；

It is transfected (being typically bed board 14-18h or so) 2. the 2nd day 293T cell fusion degree reaches 90% or so；Prepare Plasmid composite, it is 12.5ug that the amount of various plasmids, which is RV-CD19-BBz-mbIL15, and Gag-pol 10ug, VSVg are 6.25ug CaCl₂250ul, H₂O is that 1ml total volumes are 1.25ml；Addition is with plasmid composite isometric in another pipe HBS, be vortexed concussion 20s when adding plasmid composite.Softly mixture is added to along side in 293T wares, 37 degree of cultures 4h removes culture medium, and PBS is washed one time, rejoins the fresh culture of preheating；

3. the 4th day：Packing is stored in -80 degree after collecting supernatant after transfection 48h and being filtered with 0.45um filters, continues to add The fresh DMEM medium of preheating.

Embodiment 4：The T cell of retroviral infection people

1. purer CD3+T cells are obtained with Ficcol separating liquids (oceans Tianjin Hao) separation, with the X-VIVO of serum containing 5%AB (LONZA) culture medium adjustment cell density is 1 × 10⁶/mL.Cell is inoculated into advance with the holes 1ml/ with anti-human 50ng/ml CD3 antibody (Beijing is with vertical Hai Yuan) and 50ng/ml 41BB antibody (Beijing is with vertical Hai Yuan), add the leucocyte of 100IU/ml Interleukin 2 (the double aigrets in Beijing), restrovirus infection in 48 hours is cultivated in stimulation.

After 2.T cell activation cultures every other day, PBS is diluted to Retronectin (Takara) packets of final concentration of 15 μ g/ml By non-tissue treated culture plates, 24 orifice plates are per 250 μ l of hole.It is protected from light, 4 DEG C spare overnight.

The culture of 3.T cell activations two days later, takes out 2 pieces of 24 orifice plates being coated with, and coating buffer is abandoned in suction, is added containing 2%BSA's HBSS room temperatures close 30min.Confining liquid volume is per 500 μ l of hole, and confining liquid is abandoned in suction, with the HBSS board-washings two containing 2.5%HEPES It is secondary.

4. in virus liquid adding holes, 2ml virus liquids being added per hole, 32 DEG C, 2000g, centrifuge 2h.

5. discarding supernatant liquid, the T cell 1 × 10 after activation is added per hole for 24 orifice plates⁶A, volume 1ml, culture medium is that T is thin IL-2 200IU/ml are added in born of the same parents' culture medium.30 DEG C, 1000g, centrifuge 10min.

6. after centrifugation, culture plate is placed in 37 DEG C, is cultivated in 5%CO2 incubators.

7. after infection for 24 hours, cell suspension is sucked out, 1200rpm, 4 DEG C, 7min is centrifuged.

8. after cell infection, the density of cell is observed daily, adds the T cell culture solution of the 100IU/ml containing IL-2 in due course, The density of T cell is set to maintain 5 × 10⁵/ ml or so, makes cell expand.

Thus to obtain the CAR-T cells of retrovirus shown in embodiment 3 have been infected respectively, it is respectively designated as CD19- TEGFR CAR-T cells and CD19-mbIL15 CAR-T cells.

Embodiment 5：The expression of T lymphocytic cell surface CAR albumen after flow cytomery infection

72 hours after infecting CD19-tEGFR and CD19-mbIL15 CAR-T cells, PBS washings 1 are collected by centrifugation respectively Supernatant is abandoned after secondary, and PBS after corresponding antibody is protected from light 30min is added and washs, is resuspended, last flow cytomery.CAR+ by Anti-mouse IgG F (ab') antibody (Jackson Immunoresearch) and APC-anti EGFR or PE- Anti IL15 antibody tests.

Fig. 3 shows, the retroviral infection T cell being prepared using embodiment 3 is after 72 hours, CD19-mbIL15 The expression efficiency of CAR+ is 33.6%.

Embodiment 6：CD107a detection of expression after CAR-T cells are co-cultured with target cell

1. taking one piece of 96 orifice plate of the bottoms V, add CAR-T/NT cells 2*10 per hole⁵A and target cell (NALM6, Raji)/control Cell (K562) 2*10⁵It is a, the X-VIVO complete mediums for being free of IL-2 for 200ul are resuspended, BD GolgiStop are added and (contain Often 1 μ l BD GolgiStop are added in 1ml culture mediums in monesin), 2ul CD107a antibody (1 is added per hole:50), 37 DEG C It is incubated 4 hours, collects cell.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C centrifuge 5 minutes.Supernatant is abandoned, often pipe adds Enter appropriate specific surfaces antibody CAR, CD3, CD4, CD8, resuspension volume 100ul is protected from light incubation 30 minutes on ice.

3. the PBS cleanings cell per effective 3mL 1 time, 400g is centrifuged 5 minutes.Carefully suck supernatant.Appropriate PBS is resuspended, stream Formula cell instrument detects CAR, CD3, CD4, CD8, CD107a

The present embodiment result is shown in Fig. 4.Fig. 4 shows, CD19-tEGFR and CD19-mbIL15 CAR-T cells and two Kind target cell (NALM6 and Raji) CD107a expression both greater than 60%.

Embodiment 7：IFN γ secretion detects after CAR-T cells are co-cultured with target cell

1. taking the CAR-T cells prepared, it is resuspended with Lonza culture mediums, adjustment cell concentration is 1 × 10⁶/mL。

2. experimental group contains target cell (NALM6, Raji) or negative control cell (K562) 2 × 10 per hole⁵It is a, CAR-T/NT Cell 2 × 10⁵A, 200 μ l are free of the Lonza culture mediums of IL-2.It is added after mixing well in 96 orifice plates.BD is added GolgiStop (contains monesin, 1 μ l BD GolgiStop are added in every 1ml culture mediums), and after mixing well, 37 DEG C of incubations 5 are small When.Cell is collected, as experimental group.

3. the PBS cleanings cell per effective 1mL 1 time, 300g is centrifuged 5 minutes.Supernatant is abandoned, often appropriate specific table is added in pipe Face antibody CAR, CD3, CD4, CD8, resuspension volume 100ul are protected from light incubation 30 minutes on ice.

After 4.PBS washes cell, 250 μ l/EP pipe Fixation/Permeabilization solution are added, 4 DEG C incubate 20 minutes are educated to fix cell and rupture of membranes.With 1 × BD Perm/Wash^TMBuffer cleans cell 2 times, 1mL/ times.

5. carrying out intracellular factor dyeing, appropriate IFN-γ cell factor fluorescence antibody or negative control are taken, with BD Perm/ Wash^TMBuffer is diluted to 50 μ l.The cell for having fixed rupture of membranes is fully resuspended with this antibody diluent, 4 DEG C are protected from light incubation 30min, 1 × BD Perm/Wash^TMThe cleaning cells 2 times of buffer 1mL/ times, are then resuspended with PBS.

6. flow cytomery.

The present embodiment result is shown in Figure 5.Fig. 5 shows, CD19-tEGFR CAR-T and two kinds of target cells (NALM6 and Raji) intracellular INF- γ are both greater than 50%, and CD19-mbIL15 CAR-T intracellular INF- γ are both greater than 10%.

Embodiment 9：CAR-T cells detect tumor specific cell lethal effect after being co-cultured with target cell

1.K562 cells (being free of CD19 target proteins, be the negative control cell of target cell) are resuspended in serum free medium (1640) in, adjustment cell concentration is 1 × 10⁶Fluorescent dye BMQC (2,3,6,7-tetrahydro-9- is added in/ml Bromomethyl-1H, 5Hquinolizino (9,1-gh) coumarin) to final concentration of 5 μM.

2. mixing, 37 DEG C of incubation 30min.

3. room temperature, 1500rpm centrifuges 5min, abandons supernatant, and cell is resuspended in cytotoxicity culture medium (without phenol red 1640+ 5%AB serum) in, 37 DEG C of incubation 60min.

4. fresh cells toxicity culture medium cleans cell twice, and is resuspended in fresh cells toxicity culture medium, and density 1 × 10⁶/ml。

5.NALM6, Raji cell (target protein containing CD19 is target cell) are suspended in the PBS containing 0.1%BSA, are adjusted A concentration of 1 × 10⁶/ml。

6. fluorescein based dye CFSE (carboxyfluoresceindiacetatesuccinimidyl ester) is added to end A concentration of 1 μM.

7. mixing, 37 DEG C of incubation 10min.

8. after being incubated, being added and being reacted with end mark with the isometric FBS of cell suspension, incubation at room temperature 2min.

9. cleaning cell is simultaneously resuspended in fresh cells toxicity culture medium, density 1 × 10⁶/ml。

10. cleaning effector T cell is simultaneously suspended in cytotoxicity culture medium, adjustment a concentration of 5 × 10⁶/ml。

11. in all experiments, the effector T cell (CAR-T cell) of CD19-BBz-mbIL15 CAR has been infected Cytotoxicity and the cytotoxicity for the negative control effector T cell (NT cell) being uninfected by compare, and these effects T is thin Born of the same parents come from the same patient.

12.CD19-BBz-mbIL15 CAR-T and negative control effector T cell, according to T cell：Target cell=2.5:1, 1:2, ratio, cultivated in 5ml sterility tests pipe (BD Biosciences).In each co-cultivation group, target cell is Raji cells 100,000 (50 μ l), 100,000 K562 cell (50 μ l) of negative control cell.One group of setting simultaneously is only Including Raji target cells and K562 negative control cells.

13. co-cultured cell is placed in 37 DEG C of incubation 5h.

14. after the completion of being incubated, PBS cleans cell, the concentration recommended to specifications immediately after rapidly joins 7-AAD (7-aminoactinomycin D), is incubated 30min on ice.

15. being not required to clean, machine testing in streaming is directly carried out, data are analyzed with Flow Jo.

16. analysis using the living cells gating of 7AAD feminine gender, measure target cell living after T cell and target cell co-culture with The ratio of negative control cell living.

A) for the T cell of each group of co-cultivation and target cell,

Target cell survival %=Target cell viable count/Negative control viable count。

B) the target cell survival % of cytotoxic killer cell %=100- calibrations, i.e., (when no effector cellTarget cellIt is living Cell number-the target cell of when containing effector cell viable count)/negative control viable count ratio.

The present embodiment result is shown in figure 6.The results show that being 2.5 in effect target ratio:In the case of 1, CD19-tEGFR and CD19-mbIL15 CAR-T are more than 70% to target cell NALM6 killing rates, are more than 40% to target cell Raji killing rates.

Sequence table

<110>The Shanghai bio tech ltd Heng Run Da Sheng

<120>Target CD19 Chimeric antigen receptors and the method and purposes of Combined expression IL15

<170> PatentIn version 3.3

<210> 1

<211> 2736

<212> DNA

<213>Artificial sequence

<400> 1

atggctctgc ctgtgaccgc cctgctgctg cctctggctc tgctgctgca cgccgctcgg 60

cctgacattc agatgactca gaccacaagc agcctcagtg cgagcctggg ggacagggtg 120

actatcagct gccgggccag ccaggacatt tccaagtacc tgaattggta ccagcagaag 180

cccgatggta ctgtgaaact cctgatatat catacttcta ggctccattc cggggttcca 240

agccgattca gtggctccgg ttccggtaca gattattccc tgaccattag caacttggaa 300

caggaggaca ttgcaacgta tttctgtcag caaggcaaca cattgcccta cacattcggg 360

ggcgggacta aactcgaaat aactggcggc gggggttctg gtggcggcgg cagcggcggt 420

ggaggatcag aagtgaagct gcaggaaagt ggccccgggc tggtagcccc aagtcagtcc 480

ctgagtgtaa cctgtacagt gagtggagtg tctcttcctg actacggggt aagttggatt 540

cggcaacctc cacgcaaggg cctggagtgg ctcggcgtga tttggggatc tgagacaact 600

tactacaatt ccgccctgaa gagcaggctg accatcatta aggacaatag caagtcacag 660

gtgtttctga agatgaactc actgcagacc gacgacaccg ccatctatta ctgcgccaaa 720

cattattatt atggcgggag ttatgctatg gactactggg gccagggcac tagcgtcacc 780

gtcagcagta ctacaactcc agcacccaga ccccctacac ctgctccaac tatcgcaagt 840

cagcccctgt cactgcgccc tgaagcctgt cgccctgctg ccgggggagc tgtgcatact 900

cggggactgg actttgcctg tgatatctac atctgggcgc ccttggccgg gacttgtggg 960

gtccttctcc tgtcactggt tatcaccctt tactgcaggt tcagtgtcgt gaagagaggc 1020

cggaagaagc tgctgtacat cttcaagcag cctttcatga ggcccgtgca gactacccag 1080

gaggaagatg gatgcagctg tagattccct gaagaggagg aaggaggctg tgagctgaga 1140

gtgaagttct cccgaagcgc agatgcccca gcctatcagc agggacagaa tcagctgtac 1200

aacgagctga acctgggaag acgggaggaa tacgatgtgc tggacaaaag gcggggcaga 1260

gatcctgaga tgggcggcaa accaagacgg aagaaccccc aggaaggtct gtataatgag 1320

ctgcagaaag acaagatggc tgaggcctac tcagaaatcg ggatgaaggg cgaaagaagg 1380

agaggaaaag gccacgacgg actgtaccag gggctgagta cagcaacaaa agacacctat 1440

gacgctctgc acatgcaggc tctgccacca agacgagcta aacgaggctc aggcgcgacg 1500

aactttagtt tgctgaagca agctggggat gtagaggaaa atccgggtcc catggattgg 1560

acttggattt tgttcctcgt tgccgcagcg actcgcgtcc atagtaattg ggtgaacgta 1620

attagtgact tgaaaaaaat tgaggacctt atacaaagta tgcatatcga tgcaacactg 1680

tacacggagt ccgacgtgca cccaagctgc aaggtcaccg caatgaaatg ctttttgctc 1740

gaattgcaag ttatctcact tgagtcaggg gacgcttcaa tccatgatac tgtggagaat 1800

ttgataatcc tggcgaacaa tagccttagt tcaaatggca acgtcactga gtcaggctgc 1860

aaggaatgtg aggaattgga agaaaaaaat atcaaggaat ttttgcaatc ttttgttcac 1920

atagttcaga tgttcattaa cactagttcc gggggcggca gtggaggtgg cggtagcggc 1980

gggggtggct ctggtggagg cggctctggg ggcggaagtc tgcagataac atgcccccca 2040

cctatgagtg ttgaacatgc tgatatctgg gttaaatctt actcccttta cagtcgagaa 2100

aggtacattt gcaactccgg ctttaaacgc aaagccggga ctagttcact gactgaatgt 2160

gtattgaata aagcgacaaa tgtcgcacac tggactaccc cttccctcaa atgcattcgc 2220

gatcctgcct tggtgcatca gcgaccagca ccgccgtcca cggtaactac cgcaggagta 2280

acaccgcagc ccgagagcct ttccccctca ggcaaagagc cggccgcatc ctccccatct 2340

tccaataata ccgcagctac caccgcagca atcgtacccg ggtcccagct gatgcccagc 2400

aaaagtccga gtactggaac gactgaaatc tccagtcacg agtcttctca tggaactccg 2460

agtcaaacta cagcaaagaa ttgggagctg actgcttccg cttcacacca gccgccaggc 2520

gtttatcctc agggacactc agataccacg gtggcgatta gcacaagcac cgtcctcctg 2580

tgtgggctga gtgcagtgtc acttctcgcc tgctacctta agtccagaca gacaccccct 2640

ttggcaagcg ttgaaatgga agccatggaa gccttgcctg tcacatgggg gacttcatcc 2700

cgcgatgaag acttggagaa ctgctcacac catctt 2736

<210> 2

<211> 912

<212> PRT

<213>Artificial sequence

<400> 2

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu

20 25 30

Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln

35 40 45

Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr

50 55 60

Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val Pro

65 70 75 80

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile

85 90 95

Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly

100 105 110

Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu

130 135 140

Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser

145 150 155 160

Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly

165 170 175

Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly

180 185 190

Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser

195 200 205

Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys

210 215 220

Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys

225 230 235 240

His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly

245 250 255

Thr Ser Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro

260 265 270

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

275 280 285

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

290 295 300

Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly

305 310 315 320

Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Arg Phe Ser Val

325 330 335

Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe

340 345 350

Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg

355 360 365

Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser

370 375 380

Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr

385 390 395 400

Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys

405 410 415

Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn

420 425 430

Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu

435 440 445

Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly

450 455 460

His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr

465 470 475 480

Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg Arg Ala Lys Arg Gly

485 490 495

Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu

500 505 510

Glu Asn Pro Gly Pro Met Asp Trp Thr Trp Ile Leu Phe Leu Val Ala

515 520 525

Ala Ala Thr Arg Val His Ser Asn Trp Val Asn Val Ile Ser Asp Leu

530 535 540

Lys Lys Ile Glu Asp Leu Ile Gln Ser Met His Ile Asp Ala Thr Leu

545 550 555 560

Tyr Thr Glu Ser Asp Val His Pro Ser Cys Lys Val Thr Ala Met Lys

565 570 575

Cys Phe Leu Leu Glu Leu Gln Val Ile Ser Leu Glu Ser Gly Asp Ala

580 585 590

Ser Ile His Asp Thr Val Glu Asn Leu Ile Ile Leu Ala Asn Asn Ser

595 600 605

Leu Ser Ser Asn Gly Asn Val Thr Glu Ser Gly Cys Lys Glu Cys Glu

610 615 620

Glu Leu Glu Glu Lys Asn Ile Lys Glu Phe Leu Gln Ser Phe Val His

625 630 635 640

Ile Val Gln Met Phe Ile Asn Thr Ser Ser Gly Gly Gly Ser Gly Gly

645 650 655

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

660 665 670

Ser Leu Gln Ile Thr Cys Pro Pro Pro Met Ser Val Glu His Ala Asp

675 680 685

Ile Trp Val Lys Ser Tyr Ser Leu Tyr Ser Arg Glu Arg Tyr Ile Cys

690 695 700

Asn Ser Gly Phe Lys Arg Lys Ala Gly Thr Ser Ser Leu Thr Glu Cys

705 710 715 720

Val Leu Asn Lys Ala Thr Asn Val Ala His Trp Thr Thr Pro Ser Leu

725 730 735

Lys Cys Ile Arg Asp Pro Ala Leu Val His Gln Arg Pro Ala Pro Pro

740 745 750

Ser Thr Val Thr Thr Ala Gly Val Thr Pro Gln Pro Glu Ser Leu Ser

755 760 765

Pro Ser Gly Lys Glu Pro Ala Ala Ser Ser Pro Ser Ser Asn Asn Thr

770 775 780

Ala Ala Thr Thr Ala Ala Ile Val Pro Gly Ser Gln Leu Met Pro Ser

785 790 795 800

Lys Ser Pro Ser Thr Gly Thr Thr Glu Ile Ser Ser His Glu Ser Ser

805 810 815

His Gly Thr Pro Ser Gln Thr Thr Ala Lys Asn Trp Glu Leu Thr Ala

820 825 830

Ser Ala Ser His Gln Pro Pro Gly Val Tyr Pro Gln Gly His Ser Asp

835 840 845

Thr Thr Val Ala Ile Ser Thr Ser Thr Val Leu Leu Cys Gly Leu Ser

850 855 860

Ala Val Ser Leu Leu Ala Cys Tyr Leu Lys Ser Arg Gln Thr Pro Pro

865 870 875 880

Leu Ala Ser Val Glu Met Glu Ala Met Glu Ala Leu Pro Val Thr Trp

885 890 895

Gly Thr Ser Ser Arg Asp Glu Asp Leu Glu Asn Cys Ser His His Leu

900 905 910

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence

<223>Primer

<400> 3

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213>Artificial sequence

<223>Primer

<400> 4

tgtttgtctt gtggcaatac ac 22

Claims

1. a kind of polynucleotide sequence, the polynucleotide sequence is selected from：

(1) contain the coded sequence of sequentially connected anti-CD19 single-chain antibodies, the coded sequence of people's CD8 α hinge areas, people CD8 across The coded sequence in film area, the coded sequence of people's 41BB intracellular regions, the coded sequence of people's CD3 ζ intracellular regions and IL15+IL15R α knots The polynucleotide sequence of structure coded sequence；With

(2) complementary series of (1) described polynucleotide sequence.

2. polynucleotide sequence as described in claim 1, which is characterized in that

The polynucleotide sequence also coded sequence containing signal peptide before the coded sequence of the CD19 single-chain antibodies, preferably Ground, the polynucleotide sequence such as SEQ ID NO of the signal peptide:Shown in 1-63 the polynucleotides；And/or

The polynucleotide sequence of the light chain variable region of the CD19 single-chain antibodies such as SEQ ID NO:1 64-321 polynucleotides It is shown；And/or

The polynucleotide sequence of the heavy chain variable region of the CD19 single-chain antibodies such as SEQ ID NO:1 430-789 multinuclear glycosides Shown in acid；And/or

The polynucleotide sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 1 790-930 polynucleotides；And/or

The polynucleotide sequence of the people CD8 transmembrane regions such as SEQ ID NO:Shown in 1 931-996 polynucleotides；And/or

The polynucleotide sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 1 997-1140 polynucleotides；And/or

The polynucleotide sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 1 1141-1473 polynucleotides；With/ Or

The polynucleotide sequence such as SEQ ID NO of the human IL-15 and IL15R α:Shown in 1 1606-2736 polynucleotides.

3. amino acid sequence as claimed in claim 2, which is characterized in that

The coded sequence such as SEQ ID NO of the signal peptide before the coded sequence of the anti-CD19 single-chain antibodies:2 1-21 Shown in amino acids sequence；And/or

The coded sequence such as SEQ ID NO of the light chain variable region of the anti-CD19 single-chain antibodies:2 22-128 amino acids sequences It is shown；And/or

The coded sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD19 single-chain antibodies:2 144-263 amino acids sequences Shown in row；And/or

The coded sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 2 264-310 amino acids sequences；And/or

The coded sequence of the people CD8 transmembrane regions such as SEQ ID NO:Shown in 2 311-332 amino acids sequences；And/or

The coded sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 2 333-380 amino acids sequences；And/or

The coded sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 2 381-491 amino acids sequences；And/or

The coded sequence such as SEQ ID NO of the human IL-15 and the segment of IL15R α:2 650-912 amino acids sequence institutes Show.

4. a kind of fusion protein, the fusion protein is selected from：

(1) contain sequentially connected anti-CD19 single-chain antibodies, people CD8 α hinge areas, people CD8 transmembrane regions, people 41BB intracellular regions and people The fusion protein and IL15+IL15R α coded sequences of CD3 ζ intracellular regions；With

(2) by replacing, missing or adding one or several amino acid and retaining activation T in the amino acid sequence that (1) limits The fusion protein derived from (1) of cell activity；

Preferably, the anti-CD19 single-chain antibodies are monoclonal antibody FMC63.

5. fusion protein as claimed in claim 4, which is characterized in that the fusion protein has following one or more special Sign：

The fusion protein also contains signal peptide in the N-terminal of the anti-CD19 single-chain antibodies, it is preferable that the amino of the signal peptide Acid sequence such as SEQ ID NO:Shown in 2 1-21 amino acids；

The amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-CD19 single-chain antibodies:2 22-128 amino acids institutes Show；

The amino acid sequence of the heavy chain variable region of the anti-CD19 single-chain antibodies can be such as SEQ ID NO:2 144-263 bit aminos Shown in acid；

The amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 2 264-310 amino acids；

The amino acid sequence of the people CD8 transmembrane regions such as SEQ ID NO:Shown in 2 311-332 amino acids；

The amino acid sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 2 333-380 amino acids；

The amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 2 31-491 amino acids；With

Described and IL15+IL15R α intracellular regions amino acid sequence such as SEQ ID NO:Shown in 2 650-912 amino acids.

6. a kind of nucleic acid constructs, the nucleic acid constructs contains the polynucleotide sequence described in any one of claim 1-3；

Preferably, the nucleic acid constructs is carrier；

It is highly preferred that the nucleic acid constructs is retroviral vector, contain replication origin, 3 ' LTR, 5 ' LTR, pis Packaging signal, restriction enzyme site, described in any one of groundhog hepatitis virus posttranscriptional regulatory element and claim 1-3 Polynucleotide sequence.

7. a kind of retrovirus, the retrovirus contains the nucleic acid constructs described in claim 6, preferably comprises described Carrier, the further preferably described retroviral vector.

8. the pharmaceutical composition of a kind of T cell of genetic modification or the T cell containing the genetic modification, which is characterized in that described thin Born of the same parents contain the polynucleotide sequence described in any one of claim 1-2, or containing the nucleic acid constructs described in claim 6, Or the fusion protein described in any one of having infected retrovirus described in claim 7, or stablized expression claim 4-5 With optional IL-15 segment portions.

9. the fusion egg described in any one of polynucleotide sequence, claim 4-5 described in any one of claim 1-2 In vain, the nucleic acid constructs described in claim 6 or the retrovirus described in claim 7 are in the T cell for preparing activation Using.

10. the fusion egg described in any one of polynucleotide sequence, claim 4-5 described in any one of claim 1-2 In vain, the nucleic acid constructs described in claim 6, the retrovirus described in claim 7 or gene according to any one of claims 8 The purposes of the T cell of modification or its pharmaceutical composition in the drug for preparing the disease that treatment CD19 is mediated；

Preferably, the disease that the CD19 is mediated is leukaemia, lymthoma.

It is highly preferred that the disease that the CD19 is mediated includes B cell lymphoma, lymphoma mantle cell, the white blood of acute lymphoblastic Disease, chronic lymphocytic leukemia, hairy cell leukemia and acute myeloid leukaemia.