CN105949324B

CN105949324B - Target the Chimeric antigen receptor and application thereof of GPC3

Info

Publication number: CN105949324B
Application number: CN201610504698.XA
Authority: CN
Inventors: 黄飞; 王海鹰; 金涛; 何凤; 史子啸
Original assignee: Shanghai Hrain Biotechnology Co Ltd
Current assignee: Shanghai Hengrun Dasheng Biotechnology Co.,Ltd.
Priority date: 2016-06-30
Filing date: 2016-06-30
Publication date: 2019-08-27
Anticipated expiration: 2036-06-30
Also published as: CN105949324A

Abstract

The present invention relates to the Chimeric antigen receptors and application thereof of targeting GPC3.Specifically, the present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from: (1) polynucleotide sequence of the coded sequence of the segment of the III containing extracellular domain and extracellular domain IV of the coded sequence of leader peptide containing sequentially connected CD8 antigen, the coded sequence of resisting GPC 3 single-chain antibody, the coded sequence of people's CD8 α hinge area, the coded sequence of people's CD8 transmembrane region, the coded sequence of people's 41BB intracellular region, the coded sequence of people's CD3 ζ intracellular region and optional EGFR sequence；(2) complementary series of (1) described polynucleotide sequence.The present invention provides the CAR of the polynucleotide sequence coding and expresses the T cell of the CAR.CAR-T cell prepared by the present invention has strong killing ability to specific tumor cell, and in the case that effect target ratio is 20 to 1, killing-efficiency is more than 90%.

Description

Target the Chimeric antigen receptor and application thereof of GPC3

Technical field

The invention belongs to Chimeric antigen receptor fields, and in particular to target Chimeric antigen receptor of GPC3 and application thereof.

Background technique

Liver cancer occupies the 5th and the position in the most common reason of cancer related mortality in most popular tumour in the world Occupy third (Bosch etc., Gastroenterologyl 27:S5-Sl6,2004；El-Serag etc., Gastroenterologyl 32:2557 76,2007).According to American Cancer Society, hepatocellular carcinoma (HCC) accounts for about the 75% of liver cancer case, often until evening Phase liver cancer just has symptom.Surgical operation is the standard care of liver cancer, because such cancer is to most of chemotherapeutic Object reaction is bad.Therefore, there is an urgent need to develop the novel drugs with different role mechanism.

Phosphatidylinositols proteoglycan 3 (Glypican 3, GPC3) is a kind of cell surface protein, belongs to acetyl sulfate liver Fibroin polysaccharide family.GPC3 gene coding generates the precursor core protein of 70kDa or so, which can be by not woods egg Soluble aminoterminal (N-terminal) peptide for being able to enter blood and 30kDa that white enzyme (furin) shearing generates 40kDa or so is left What film of the right side containing 2 Heparan sulfate (HS) sugar chains combined complete cardinal extremity (C-terminal) peptide (Capurro etc., Dev Ce 1114: 700 711,2008；Capurro etc., Cancer Res 65:6245-6254,2005).

GPC3 height is expressed in fetus liver, the hepatic tissue without being expressed in normal adult, but in hepatocellular carcinoma Restoring expression, the occurrence and development with liver cancer have very close relationship, and it is not only higher in the early detective rate of liver cancer generation, but also With the development of liver cancer, recall rate also increases therewith.And the expression of GPC3 is in liver gland cancer, cholangiocellular carcinoma, metastatic liver cancer and It is not detected in 12 kinds of common solid tumors and 21 kinds of non-liver cancer cell lines.In addition, GPC3 is also in such as melanoma, ovary is saturating It is expressed in the tumours such as clear cell carcinoma, yolk sac tumor, neuroblastoma.In view of GPC3 is in hepatocellular carcinoma, melanoma etc. Specific high expression, is considered as a candidate targets of immunotherapy of tumors in tumour.

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cell refers to repairs through gene After decorations, specific purpose antigen, and the T cell of continuous activation amplification can be identified with MHC non-limiting way.It is 2012 international thin Born of the same parents, which treat association's annual meeting middle finger and go out biological immune cell therapy, has become operation, radiotherapy, the 4th kind for the treatment of tumour outside chemotherapy Means, and future tumors will be become and treat essential means.CAR-T cell adoptive therapy is that most clearly have in current cancer therapies The immunotherapeutic form of effect.A large number of studies show that CAR-T cell can effectively identify tumour antigen, cause the anti-of specificity Tumor immune response significantly improves the survival state of patient.

Chimeric antigen receptor (CAR) is the core component of CAR-T, assigns the non-dependent mode of T cell HLA and identifies that tumour is anti- Former ability, this, which enables, identifies wider mesh compared to nave T cell surface receptor TCR by the T cell of CAR transformation Mark.It include that tumor associated antigen (tumor-associated antigen, a TAA) combined area is (logical in the basic engineering of CAR Often derive from the scFV section of monoclonal antibody antigen bond area), an extracellular hinge area, a transmembrane region and a letter intracellular Number area.The selection of target antigen for the safety of the specificity of CAR, validity and genetic modification T cell itself all It is crucial determinant.

As technology is or not Chimeric antigen receptor T cell (Chimeric Antigen Receptor-T cell, CAR-T) Disconnected development, CAR-T can mainly be divided into for four generations at present.

First generation CAR-T cell by extracellular combined area-single-chain antibody (single chain fragment variable, ScFV), transmembrane region (transmembrane region, TM) and intracellular signal area-immunoreceptor tyrosine activating motif (immunoreceptor tyrosine based activation motif, ITAM) composition, wherein Chimeric antigen receptor is each Part is connected by following form: scFv-TM-CD3 ζ.Although first generation CAR it can be seen that some specificity cytotoxicity, Have been found that curative effect is barely satisfactory when carrying out clinical test summary to it within 2006.Trace it to its cause is because of first generation CAR-T Cell will soon exhaust that persistence is very poor in patient body, so that CAR-T cell has enough time touching largely not yet Tumour cell when just this kind of CAR-T cell of apoptosis can excite antitumoral cytotoxic effect, but cell because Son secretion it is fewer, but its survival period in vivo it is shorter cannot excite lasting anti-tumor effect (Zhang T etc., Chimeric NKG2D-modified T cells inhibit systemic T-cell lymphoma growth in a Manner involving multiple cytokines and cytotoxic pathways, Cancer Res 2007,67 (22): 11029-11036).

T cell activation signaling zone is still the hot spot of research in the optimization CAR design of second generation CAR-T cell.T cell it is complete Full activation depends on the effect of dual signal and cell factor.Wherein the first signal is specific signals, identifies antigen submission by TCR Antigenic Peptide-MHC the compound of cell surface is started；Second signal is costimulatory signal.Early in 1998, there have been Two generation CAR (Finney HM etc., J Immunol.1998；161 (6): 2791-7).2nd generation CAR is added in intracellular signal peptide area One costimulatory molecules is assembled into costimulatory signal inside CAR, can preferably provide work for CAR-T cell Change signal, costimulatory molecules and intracellular signal can be activated simultaneously after such CAR tumor cell, realize dual activation, T cell proliferation secretion capacity and anti-tumor effect can be significantly improved.First T cell costimulatory signal receptor studied in detail It is CD28, it can be in conjunction with the B7 family member of target cell surface.The costimulation of CD28 can promote the proliferation of T cell, IL- 2 synthesis and expression and enhancing T cell resist the ability of apoptosis.Then occur CD134 (OX40) and 41BB (4-1BB) again Equal costimulatory molecules maintain t cell response to improve cytotoxicity, the proliferation activity of T cell, extend the T cell time-to-live Deng.Such second generation CAR produces unexpected effect in subsequent clinical test, based on the second generation from 2010 The clinical report of CAR repeatedly causes vibration, and especially for recurrent, intractable patient ALL, complete remission rate is up to 90% or more.

Third generation CAR signal peptide area integrates 2 or more costimulatory molecules, T cell continuous activation can be made to be proliferated, cell The ability of factor continuous release, T cell killing tumor cell is more significant, i.e., CAR of new generation can get stronger antitumor Response (Pule MA etc., Mol Ther., 2005,12 (5): 933-941).Most typical is exactly that U Pen Carl June exists The stimulating factor of a 41BB is added under the action of CD28 stimulating factor again.

The CAR-T cell of forth generation then joined cell factor or costimulation ligand, such as four generation CAR can produce IL- 12, the activation of immune microenvironment-increase T cell can be adjusted, while activating inherent immunity cell that it is made to play a role and coming clearly Except the cancer cell of target antigen feminine gender, to have the function that bidirectional modulation (Chmielewski M, Abken H.TRUCKs:the Fourth generation of CARs, Expert Opin Biol Ther., 2015；15 (8): 1145-54).

It is active medicine that the big advantage of the one of CAR-T cell, which is them, once input, physiological mechanism meeting modulating T cell is put down Weighing apparatus, memory are formed and the amplification of antigen driving.However, this treatment is not perfect enough, T cell can miss the target and attack other groups It knits or amplification amount is excessively high, beyond needed for treatment.It has been included into standard care range in view of CAR-T cell, has designed patient or drug Controllable starting or shutdown mechanism is highly useful come the presence for regulating and controlling CAR-T cell.Due to technical reason, shutdown mechanism is more It is easily applied to T cell.As one of them, iCas9 system is just in clinical research.For cell when expressing iCas9, use is small Molecular compound can induce iCas9 precursor molecule and form dimer, apoptosis pathway be activated, to realize the purpose of scavenger-cell. In graft versus host disease(GVH disease), small molecule AP1903 has been used for inducing iCas9 dimer and removes T cell, shows this Feasibility (the Making Better Chimeric Antigen Receptors for Adoptive T-cell of method Therapy, Clin Cancer Res；22 (8), on April 15th, 2016).

In addition, also make CAR-T cell using the scavenging antibody clinically used while expressing these antibody needles Pair albumen, such as tEGFR, treatment-related toxic reaction generate or treat after the completion of, by giving antibody drug Remove corresponding CAR-T cell (Rational development and characterization of humanized Anti-EGFR variant III chimeric antigen receptor T cells for glioblastoma, Sci Transl Med 2015；7:275ra22).

The monoclonal antibody of the C-terminal epitope of specific recognition people GPC3 oneself be disclosed in such as Chinese patent literature CN101186650A.Furthermore according to document Advances in Liver Cancer Antibody Therapies:A Focus on 3 and of Glypican on October 1st, Mesothelin, BioDrugs, 2011,25 (5): 275-284), oneself knows specifically for other Property identification C-terminal epitope monoclonal antibody include GC33, be located at 524-563 ammonia of C-terminal for the antigenic determinant of GPC3 Base acid residue.The GPC3-GC33 antibody of 15 patients observes apparent therapeutic effect in the Phase I clinical trial for the treatment of HCC, Speculate that naked antibody cannot play good curative effect to anti-human liver cancer.One I phase about the derivative peptide vaccine of GPC3 is clinical Test obtained the results show that the frequency of the middle position Overall survival and GPC3 specific CTL of liver cancer patient is positively correlated, this Research shows that targetedly T cell may be the potential target of liver cancer treatment to GPC3.

The application is while tEGFR to have also been introduced using the heavy chain of the scFV of GPC3-GC33 and light chain as the structure of CAR Structure (truncated EGFR).TEGFR lacks extracellular N-terminal ligand binding domains and intracellular receptor tyrosine-kinase enzyme activity Property, but natural acid sequence is remained, belong to the positioning of I type transmembrane cell surface, space conformation can be anti-with pharmaceutically grade EGFR monoclonal antibody Cetuximab is combined closely (A transgene-encoded cell surface polypeptide For selection, in vivo tracking, and ablation of engineered cells, BLOOD, 2011 years 8 The moon 4,118:1255-1263).The major function of tEGFR: can be used as the label of cell surface, while also be suitble to T cell Tracking in vivo can be detected by streaming and immunohistochemistry；(cetuximab) can also be resisted to remove by appropriate Xidan in vivo.The present invention Introducing this tEGFR structure both can make to carry out well in CAR-T cell body by tracer, it is often more important that this structure can be made For the safety switch of CAR-T cell: appropriate Xidan can be added by being not desired to when it plays a role resists, and safely and effectively controls the needle of infusion It plays a role in vivo to the CAR-T cell of GPC3 target spot.It lays a good foundation for clinical trial and clinical treatment.

Summary of the invention

First aspect present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from:

(1) coded sequence of leader peptide containing sequentially connected CD8 antigen, resisting GPC 3 single-chain antibody coded sequence, The coded sequence of people's CD8 α hinge area, the coded sequence of people's CD8 transmembrane region, the coded sequence of people's 41BB intracellular region, people CD3 ζ born of the same parents The coded sequence of the segment of the III containing extracellular domain and extracellular domain IV of the coded sequence of inner region and optional EGFR it is more Nucleotide sequence；With

(2) complementary series of (1) described polynucleotide sequence.

In one or more embodiments, the amino acid sequence of the CD8 antigen leader peptide such as SEQ ID NO:2 1- Shown in 21 amino acids.

In one or more embodiments, the amino acid sequence of the light chain variable region of the resisting GPC 3 single-chain antibody is such as Shown in SEQ ID NO:2 22-134 amino acids.

In one or more embodiments, the amino acid sequence of the heavy chain variable region of the resisting GPC 3 single-chain antibody can be such as Shown in SEQ ID NO:2 150-264 amino acids.

In one or more embodiments, the amino acid sequence such as SEQ ID NO:2 of the people CD8 α hinge area Shown in 265-311 amino acids.

In one or more embodiments, the amino acid sequence of the people CD8 transmembrane region such as SEQ ID NO:2 312- Shown in 333 amino acids.

In one or more embodiments, the amino acid sequence of the people 41BB intracellular region such as SEQ ID NO:2 Shown in 334-381 amino acids.

In one or more embodiments, the amino acid sequence such as SEQ ID NO:2 of the people CD3 ζ intracellular region Shown in 382-492 amino acids.

In one or more embodiments, the segment of the EGFR contains the extracellular domain III of EGFR, extracellular structure Domain IV and transmembrane region.

In one or more embodiments, by the extracellular domain III, extracellular domain IV and cross-film district's groups of EGFR At.

In one or more embodiments, the segment of the EGFR contains the 310-646 amino acids sequence of Human epidermal growth factor receptor Column.

In one or more embodiments, the segment of the EGFR by Human epidermal growth factor receptor 310-646 amino acids sequence Composition.

In one or more embodiments, the amino acid sequence of the EGFR segment such as SEQ ID NO:2 541-875 Shown in amino acids.

In one or more embodiments, the polynucleotide sequence coding is as described in SEQ ID NO:2 1-492 Amino acid sequence, or coding the amino acid sequence as shown in SEQ ID NO:2.

In one or more embodiments, the polynucleotide sequence contains SEQ ID NO:1 or its 1-1476 Shown in nucleotide sequence, or the nucleotide sequence shown in SEQ ID NO:1 or its 1-1476 forms.

Second aspect of the present invention provides a kind of fusion protein, and the fusion protein is selected from:

(1) containing the leader peptide of sequentially connected CD8 antigen, resisting GPC 3 single-chain antibody, people CD8 α hinge area, people CD8 across Film area, people 41BB intracellular region and people's CD3 ζ intracellular region fusion protein；With

(2) it lives in the amino acid sequence that (1) limits by replacing, missing or adding one or several amino acid and retaining Change the active fusion protein as derived from (1) of T cell.

In one or more embodiments, the resisting GPC 3 single-chain antibody is resisting GPC 3 monoclonal antibody GC33.

In one or more embodiments, the amino acid sequence of the fusion protein such as SEQ ID NO:2 1-492 Shown in amino acid.

Third aspect present invention provides a kind of nucleic acid constructs, and the nucleic acid constructs contains polynucleotides as described herein Sequence.

In one or more embodiments, the nucleic acid constructs is carrier.

In one or more embodiments, the nucleic acid constructs is retroviral vector, contains replication initiation position Point, 3 ' LTR, 5 ' LTR and polynucleotide sequence as described herein.

Fourth aspect present invention provides a kind of retrovirus, and the retrovirus contains nucleic acid construct as described herein Object preferably comprises the carrier, the further preferably described retroviral vector.

Fifth aspect present invention provides a kind of T cell of gene modification, and the cell contains polynucleotides as described herein Sequence or nucleic acid constructs, or infected retrovirus as described herein, or stablize express fusion protein as described herein and The segment of the III containing extracellular domain of optional EGFR, extracellular domain IV and optional transmembrane region.

Sixth aspect present invention provides a kind of pharmaceutical composition, and described pharmaceutical composition contains gene modification as described herein T cell and pharmacy or physiologically acceptable carriers, diluent or excipient.

Seventh aspect present invention provides polynucleotide sequence, fusion protein, nucleic acid constructs or reverse transcription as described herein Application of the virus in the T cell of preparation activation.

Eighth aspect present invention offer polynucleotide sequence as described herein, fusion protein, nucleic acid constructs, reverse transcription disease Purposes of the T cell or its pharmaceutical composition of poison or gene modification in the drug of the preparation treatment GPC3 disease mediated.

In one or more embodiments, the disease that the GPC3 is mediated is liver cancer.

Detailed description of the invention

Fig. 1 is the structural schematic diagram of retrovirus expression vector GPC3-41BBz prepared by embodiment 1.Wherein, V_LFor Light chain variable region；Lk is connector (G₄S)₃；V_HFor heavy chain variable region；H indicates CD8 α hinge area；TM is CD8 α transmembrane region；41BB table Show 41BB intracellular region；CD3z indicates CD3 ζ intracellular region；SP indicates leader sequence.

Fig. 2 is the part sequencing result peak value figure of retrovirus expression vector GPC3-41BBz prepared by embodiment 1.

Fig. 3 is the structural schematic diagram of retrovirus expression vector GPC3-tEGFR prepared by embodiment 2.Wherein, V_LFor Light chain variable region；Lk is connector (G₄S)₃；V_HFor heavy chain variable region；H indicates CD8 α hinge area；TM is CD8 α transmembrane region；41BB table Show 41BB intracellular region；CD3z indicates CD3 ζ intracellular region；2A is T2A polypeptide；SP indicates leader sequence.

Fig. 4 is the part sequencing result peak value figure of retrovirus expression vector GPC3-tEGFR prepared by embodiment 2.

Fig. 5 is 72 hours GPC3-GC33-CAR+ expression efficiencies of FCM results show retroviral infection T cell.

Fig. 6 is 72 hours GPC3-GC33-tEGFR-CAR+ tables of FCM results show retroviral infection T cell Up to efficiency.

Fig. 7 is the secretion of 5 hours INF- γ of GPC3-GC33-CART cell and target cell co-cultivation of preparation 3 days.

Fig. 8 is point of 5 hours INF- γ of GPC3-GC33-tEGFR-CART cell and target cell co-cultivation of preparation 3 days It secretes.

Fig. 9 is the GPC3-GC33-CART cell for preparing 3 days and the killing after target cell co-cultivation 5 hours to tumour cell Effect.

Figure 10 is thin to tumour after the GPC3-GC33-tEGFR-CART cell of preparation 3 days co-cultures 5 hours with target cell The lethal effect of born of the same parents.

Specific embodiment

The present invention provides a kind of Chimeric antigen receptor (CAR) for targeting GPC3.The CAR contains sequentially connected resisting GPC 3 list Chain antibody, people CD8 α hinge area, people CD8 transmembrane region, people 41BB intracellular region, people's CD3 ζ intracellular region.

Being suitable for the invention resisting GPC 3 single-chain antibody may be from the monoclonal of C-terminal epitope of specific recognition people GPC3 Antibody.This kind of monoclonal antibody includes but is not limited to CN101186650A and document (Advances in Liver Cancer Mesothelin, BioDrugs, 2011 years October 1 of Antibody Therapies:A Focus on Glypican-3 and Day；25 (5): 275-284) disclosed in antibody, such as the antigenic determinant of GPC3, to be located at C-terminal 524-563 amino acids residual GC33 and hGC33 monoclonal antibody and GPC3-C02 and 1G12 monoclonal antibody of base etc..The C-terminal of other identification GPC3 The monoclonal antibody of epitope can also apply to the present invention in an appropriate manner.These monoclonal antibodies being disclosed can be used for making Single chain antibody portion in standby CAR of the present invention.

In certain embodiments, it is suitable for the invention the C that resisting GPC 3 single-chain antibody contains specific recognition people GPC3 The light chain variable region and heavy chain variable region of the monoclonal antibody of terminal epitopes.Optionally, the light chain variable region and weight chain variable Area can be linked together by joint sequence.In certain embodiments, the monoclonal antibody is GC33.In certain embodiment party In case, the 22-134 bit amino of the amino acid sequence of the light chain variable region of the resisting GPC 3 single-chain antibody such as SEQ ID NO:2 Shown in sour residue.In other embodiments, the amino acid sequence such as SEQ of the heavy chain variable region of the resisting GPC 3 single-chain antibody Shown in the 150-264 amino acids residue of ID NO:2.

The amino acid sequence for being suitable for the invention people's CD8 α hinge area can be such as SEQ ID NO:2 265-311 bit amino Shown in acid.

Being suitable for the invention people's CD8 transmembrane region can be the transmembrane domain various people CD8 commonly used in the art in CAR. In certain embodiments, the amino acid sequence of the people CD8 transmembrane region such as SEQ ID NO:2 312-333 amino acids institute Show.

Being suitable for the invention 41BB can be the various 41BB for CAR known in the art.As illustrative example, The present invention uses 41BB shown in SEQ ID NO:2 334-381 amino acids sequence.

It is suitable for the invention the various people CD3 ζ intracellular regions that people's CD3 ζ intracellular region can be this field conventionally used for CAR. In certain embodiments, the amino acid sequence of the people CD3 ζ intracellular region such as SEQ ID NO:2 382-492 amino acids institute Show.

CAR of the invention also contains the leader sequence from CD8 at 5 ' ends.It is suitable for the invention CD8 leader sequence The amino acid sequence of an example can be as shown in SEQ ID NO:2 1-21 amino acids.

The each part mentioned above for forming fusion protein of the invention, as the leader peptide of CD8 antigen, resisting GPC 3 single-chain antibody it is light Chain variable region and heavy chain variable region, people CD8 α hinge area, people CD8 transmembrane region, 41BB and people's CD3 ζ intracellular region etc., between each other may be used It is directly connected to, or can be connected by joint sequence.Joint sequence can be the connector sequence suitable for antibody well known in the art Column, such as the joint sequence containing G and S.In general, connector contains duplicate motif before and after one or more.For example, the motif can be with It is GGGS, GGGGS, SSSSG, GSGSA and GGSGG.Preferably, which is adjacent in joint sequence, between repetition It is not inserted into amino acid residue.Joint sequence may include 1,2,3,4 or 5 repetition motif composition.The length of connector can be 3 ~25 amino acid residues, such as 3~15,5~15,10~20 amino acid residues.In certain embodiments, joint sequence It is more glycine linlcers sequences.The quantity of glycine is not particularly limited in joint sequence, and usually 2~20, such as 2~15,2 ~10,2~8.Except glycine and serine come, other known amino acid residue, such as alanine are also contained in connector (A), leucine (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q) etc..As example Son, connector can be made of following amino acid sequence: G (SGGGG)₂SGGGLGSTEF(SEQ ID NO:7)、RSTSGLGGGS (GGGGS)₂G(SEQ ID NO:8)、QLTSGLGGGS(GGGGS)₂G(SEQ ID NO:9)、GGGS(SEQ ID NO:10)、 GGGGS(SEQ ID NO:11)、SSSSG(SEQ ID NO:12)、GSGSA(SEQ ID NO:13)、GGSGG(SEQ ID NO: 14)、GGGGSGGGGSGGGGS(SEQ ID NO:15)、SSSSGSSSSGSSSSG(SEQ ID NO:16)、 GSGSAGSGSAGSGSA (SEQ ID NO:17) and GGSGGGGSGGGGSGG (SEQ ID NO:18) etc..

In certain embodiments, between the light chain variable region and heavy chain variable region of resisting GPC 3 single-chain antibody of the present invention by (GGGS)_nConnection, the integer that wherein n is 1~5.

In certain embodiments, the amino acid sequence of CAR of the present invention such as SEQ ID NO:2 1-492 amino acids institute Show.

It should be understood that in gene cloning operation, it is often necessary to design suitable restriction enzyme site, this certainly will be in expressed ammonia Base acid sequence end introduces one or more incoherent residues, and this has no effect on the activity of aim sequence.In order to construct Fusion protein, the expression for promoting recombinant protein obtain the recombinant protein being secreted into outside host cell automatically or are conducive to recombinant protein Purifying, it is often necessary to it is other suitable in the end N-, the end C- or the albumen of recombinant protein to be added to some amino acid In region, it may for example comprise but be not limited to, suitable joint peptide, signal peptide, leader peptide, end extend etc..Therefore, of the invention The aminoterminal or c-terminus of fusion protein (the i.e. described CAR) can also be containing one or more polypeptide fragments, as protein tag.Appoint What suitable label may be used to herein.For example, the label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out albumen pure Change.

The present invention also includes the mutant of CAR shown in SEQ ID NO:2 1-492 amino acids sequence.These mutation Body includes: with the CAR at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity and retain the CAR biological activity (such as activating T cell) amino acid sequence.It can be used for example The BLASTp of NCBI calculates the sequence identity between the sequence of two comparisons.

Mutant further include: there is one or number in the sequence shown in SEQ ID NO:2 1-492 amino acids sequence The amino acid sequence of a mutation (insertion, deletion or substitution) while the biological activity for still retaining the CAR.Several mutation It is often referred within 1-10, such as 1-8,1-5 or 1-3.Replace and is preferably conservative replaces.For example, in ability In domain, when carrying out conservative replaces with amino acid similar in performance, the function of protein or polypeptide is not usually changed. " amino acid similar in performance " includes the family for example, the amino acid residue with similar side chain, these families include Amino acid (such as lysine, arginine, histidine) with basic side chain, (such as the asparagus fern of the amino acid with acid side-chain Propylhomoserin, glutamic acid), amino acid with uncharged polar side chain (such as glycine, asparagine, glutamine, silk ammonia Acid, threonine, tyrosine, cysteine), amino acid with non-polar sidechain it is (such as alanine, valine, leucine, different Leucine proline, phenylalanine, methionine, tryptophan), with β-branched building block amino acid (such as threonine, figured silk fabrics ammonia Acid, isoleucine) and amino acid (such as tyrosine, phenylalanine, tryptophan, histidine) with aromatic side chain.Therefore, exist One or several sites are replaced with another amino acid residue from the same side chain class in polypeptide of the present invention, will not be in substantially Influence its activity.

The present invention includes the polynucleotide sequence for encoding fusion protein of the present invention.Polynucleotide sequence of the invention can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be it is single-stranded or Double-strand.DNA can be coding strand or noncoding strand.The present invention also includes the degeneracy of the polynucleotide sequence of encoding fusion protein Variant encodes identical amino acid sequence but the different nucleotide sequence of nucleotide sequence.

Polynucleotide sequence as described herein can usually be obtained with PCR amplification method.Specifically, can be public according to institute herein The nucleotide sequence opened, especially open reading frame sequence carry out design primer, and with the commercially available library cDNA or press art technology The library cDNA prepared by conventional method known to personnel expands as template and obtains related sequence.When sequence is longer, usually need Twice or repeatedly PCR amplification is carried out, then the segment that each time amplifies is stitched together by proper order again.For example, In certain embodiments, the polynucleotide sequence of fusion protein described herein is encoded as such as 1-1476 cores of SEQ ID NO:1 Shown in thuja acid.

In certain embodiments, polynucleotide sequence of the invention also includes the nucleotides sequence for encoding the segment of EGFR Column.

Being suitable for the invention EGFR can be EGFR well known in the art, such as the EGFR from people.EGFR contains the end N Hold extracellular domain I and II, extracellular domain III, extracellular domain IV, transmembrane region, membrane-proximal region structural domain and tyrosine-kinase Enzyme domains.Present invention preferably uses truncated EGFR (" tEGFR ", i.e., the segments of EGFR as described herein), do not wrap especially Include the truncated EGFR of its intracellular region (membrane-proximal region structural domain and tyrosine kinase domain).In certain embodiments, also It can further will not include that be further truncated to not include extracellular domain I and II by the EGFR of intracellular region.Therefore, certain In embodiment, the tEGFR that the present invention uses contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or It is made of the extracellular domain III, extracellular domain IV and transmembrane region of EGFR.In certain embodiments, the tEGFR contains There is the 310-646 amino acids sequence of Human epidermal growth factor receptor, or is made of the 310-646 amino acids sequence of Human epidermal growth factor receptor, wherein the 310-480 amino acids sequence is that the extracellular domain III, 481-620 of Human epidermal growth factor receptor are the extracellular domain IV of Human epidermal growth factor receptor, the 621-646 amino acids are the transmembrane region of Human epidermal growth factor receptor.In certain embodiments, the extracellular knot of the amino acid sequence of the tEGFR Structure domain III and IV amino acid sequence as shown in SEQ ID NO:2 541-852 amino acids.In certain embodiments, institute The transmembrane domain of tEGFR is stated as shown in SEQ ID NO:2 853-875 amino acids.

For the expression for promoting tEGFR, also leader sequence can be set in its N-terminal.In certain embodiments, the present invention uses Signal peptide from GM-CSF receptor (" GMCSFR ") α chain.In certain embodiments, the amino acid sequence of the signal peptide is such as Shown in SEQ ID NO:2 519-540 amino acids.

It in addition to this, can be by the coded sequence of T2A polypeptide by the coded sequence of the signal peptide and tEGFR and the present invention The coded sequence of people CD3 ζ intracellular region is connected in CAR.In one or more embodiments, the amino acid sequence of the T2A peptide As shown in SEQ ID NO:2 493-518 amino acids.

Therefore, in certain embodiments, polynucleotide sequence of the invention contains the coded sequence of CAR of the present invention, T2A The coded sequence of the coded sequence of polypeptide, the coded sequence of signal peptide from GM-CSF receptor alpha chain and tEGFR.Certain In embodiment, the sequence of polynucleotides of the present invention is as shown in SEQ ID NO:1.

The present invention also relates to nucleic acid constructs, which contains polynucleotide sequence as described herein, Yi Jiyu One or more regulating and controlling sequences of these series of operations connection.Polynucleotide sequence of the present invention can in many ways by Operate the expression to guarantee the fusion protein (CAR and/or tEGFR).It can basis before nucleic acid constructs is inserted into carrier Difference or the requirement of expression vector and nucleic acid constructs is operated.Change polynucleotide sequence using recombinant DNA method Technology be known in the art.

Regulating and controlling sequence can be suitable promoter sequence.Promoter sequence is usually grasped with the coded sequence of albumen to be expressed The property made connection.Promoter can be any nucleotide sequence that transcriptional activity is shown in selected host cell, including prominent Become, truncated and hybrid promoter, and can be from coding and the homologous or heterologous extracellular or intracellular polypeptide of the host cell Gene obtain.

Regulating and controlling sequence is also possible to suitable transcription terminator sequences, is identified by host cell to terminate the sequence of transcription. Terminator sequence is connect with 3 ' end effectors of the nucleotide sequence for encoding the polypeptide.It is functional in the host cell of selection Any terminator can be used in the present invention.

Regulating and controlling sequence is also possible to suitable leader sequence, the non-translational region of the mRNA important to host cell translation.Before It leads sequence and 5 ' ends of the nucleotide sequence for encoding the polypeptide is operatively connected.Functional in the host cell of selection What terminator can be used in the present invention.

In certain embodiments, the nucleic acid constructs is carrier.It is usually of the invention more by being operably connected Nucleotide sequence is incorporated to expression vector to promoter, and by construct, realizes the expression of polynucleotide sequence of the present invention.The carrier It can be suitable for replicating and integrating eukaryocyte.Typical cloning vector includes that can be used for adjusting desired nucleic acid sequence expression Transcription and translation terminator, homing sequence and promoter.

Polynucleotide sequence of the invention can be cloned into the carrier of many types.For example, plasmid, phagocytosis can be cloned into Grain, phage-derived object, animal virus and clay.Further, carrier is expression vector.Expression vector can be with viral vectors Form is supplied to cell.Viral vector technology be well known in the present art and such as Sambrook etc. (2001, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, New York) It is described in other virology and molecular biology manual.The virus that can be used as carrier includes but is not limited to reverse transcription disease Poison, adenovirus, adeno-associated virus, herpesviral and slow virus.

In general, suitable carrier includes the replication orgin to work at least one organism, promoter sequence, conveniently Restriction enzyme sites and one or more selectable label (for example, WO 01/96584；WO01/29058；And U.S. Patent number 6,326,193)。

For example, in certain embodiments, the present invention uses retroviral vector, which contains multiple Initiation site processed, 3 ' LTR, 5 ' LTR, polynucleotide sequence as described herein, and optional selectable label.

One example of suitable promoter is instant early stage cytomegalovirus (CMV) promoter sequence.The promoter sequence Column are can to drive the strong constitutive promoter sequence for being operably coupled to any polynucleotide sequence high level expression thereon Column.Another example of suitable promoter is -1 α of the elongation growth factor (EF-1 α).It is also possible, however, to use other composing types open Promoter sequences, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer viral (MMTV), people are immune scarce It is instant to fall into long end repetition (LTR) promoter of virus (HIV), MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus Early promoter, Rous sarcoma virus promoter and people's gene promoter, such as, but not limited to actin promoter, Myosin promoter, ferroheme promoter and creatine kinase promoter.Further, also it is contemplated that being started using induction type Son.The use of inducible promoter provides molecular switch, and the induction type that is operably connected can be opened when expressing in the time limit The expression of the polynucleotide sequence of promoter, and expression is being closed when expression is undesirable.The example of inducible promoter Including but not limited to metallothionein promoter, Glucocorticoid promoter, progesterone promoter and tetracycline promoter.

In order to assess the expression of CAR polypeptide or part thereof, the expression vector for being introduced into cell also may include selectable mark Any of gene or reporter or both are remembered, in order to from the cell mass for seeking to be transfected or infect by viral vectors Middle identification and selection expression cell.In other respects, selectable label can be carried on independent section of DNA and for corotation Contaminate program.The flank of selectable label and both reporters can all have adjusting sequence appropriate, so as in host It is expressed in cell.Useful selectable marker includes such as antibiotics resistance gene, such as neo etc..

Reporter is used to identify the cell of potential transfection and for evaluating the functionality for adjusting sequence.DNA by After introducing recipient cell, the expression of reporter is measured under the suitable time.Suitable reporter may include coding Luciferase, beta galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase or Green Fluorescent Protein gene base Cause.Suitable expression system is well known and prepares using known technology or commercially obtain.

Gene is introduced into cell and is well known in the art the method that gene expression enters cell.Carrier can by Any method in this field is easily introduced into host cell, for example, mammal, bacterium, yeast or insect cell.For example, Expression vector can be transferred to host cell by physics, chemistry or biological means.

It include calcium phosphate precipitation by the physical method that polynucleotides introduce host cell, lipofection, particle bombardment, micro- Injection, electroporation etc..It include being carried using DNA and RNA by the biological method that interested polynucleotides introduce host cell Body.It include dispersion system of colloid by the chemical means that polynucleotides introduce host cell, such as macromolecular complex, nanometre glue Capsule, microballoon, pearl；With the system based on lipid, including oil in water emulsion, micella, mixed micelle and liposome.

It include using viral vectors, especially retrovirus vector by the biological method that polynucleotides introduce host cell Body, this has become the most widely used method by gene insertion mammal such as people's cell.Other viral vectors can source From slow virus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus etc..Many has been developed based on virus System, for gene transfer to be entered mammalian cell.For example, retrovirus provides the convenience for gene delivery system Platform.By the gene insertion vector of selection and retroviral particle is packaged into using technology as known in the art.It should Recombinant virus then can be separated and be transferred to internal or external subject cell.Many retroviral systems are in the art It is known.In some embodiments, using adenovirus vector.Many adenovirus vectors are well known in the art.? In one embodiment, slow virus carrier is used.

Therefore, in certain embodiments, the present invention also provides the retrovirus for activating T cell, which contains There are retroviral vector as described herein and corresponding packaging gene, such as gag, pol and vsvg.

Being suitable for the invention T cell can be various types of T cells in various sources.For example, T cell can derive from The PBMC of B cell malignant tumor patient.

It in certain embodiments, can be first with suitable (such as 30~80ng/ml, such as 50ng/ml) after obtaining T cell CD3 antibody stimulate activation, then containing suitable (such as 30~80IU/ml, such as 50IU/ml) IL2 culture medium carry out It cultivates spare.

Therefore, in certain embodiments, the present invention provides a kind of T cell of gene modification, the T cell of the gene modification Containing polynucleotide sequence as described herein, or contain retroviral vector as described herein, or infected as described herein Retrovirus, or be prepared using method described herein, or stablize and express fusion protein as described herein and optional tEGFR。

CAR-T cell of the invention can undergo firm internal T cell to extend and be held in blood and marrow with high level Continue extended time quantum, and forms specific memory T cell.Be not intended to be fettered by any specific theory, encounter and with Afterwards eliminate expression Surrogate antigen target cell after, CAR-T cell of the invention can differentiation in vivo at center remember sample state.

The invention also includes a kind of cell therapy, wherein T cell is expressed CAR as described herein and optionally by gene modification TEGFR and CAR-T cell needed in its recipient by injection.The cell of injection can kill the tumour cell of recipient. Unlike antibody therapy, CAR-T cell can replicate in vivo, generate the long-term persistence that can lead to continued tumor control.

The anti-tumor immune response as caused by CAR-T cell can be active or passive immunity response.In addition, what CAR was mediated Immune response can be a part of adoptive immunotherapy step, and wherein the induction of CAR-T cell is to the antigen-binding portion dtex in CAR Anisotropic immune response.

Therefore, it is thin that CAR of the invention, its coded sequence, nucleic acid constructs, expression vector, virus and CAR-T can be used The disease of born of the same parents' treatment is preferably the disease that GPC3 is mediated.

Specifically, herein, " disease that GPC3 is mediated " especially includes various types of liver cancer.

The T cell of CAR- modification of the invention can be administered alone or as pharmaceutical composition and diluent and/or and its Such as relevant cell factor of his component or cell mass combine application.Briefly, pharmaceutical composition of the invention may include as CAR-T cell as described herein, in conjunction with one or more pharmacy or physiologically acceptable carriers, diluent or excipient. Such composition may include buffer such as neutral buffered saline, sulfate buffered saline etc.；Carbohydrate such as Portugal Grape sugar, mannose, sucrose or glucan, mannitol；Protein；Polypeptide or amino acid such as glycine；Antioxidant；Chelating agent Such as EDTA or glutathione；Adjuvant (for example, aluminium hydroxide)；And preservative.

The mode that pharmaceutical composition of the invention can be suitable for the disease of (or prevention) to be treated is applied.The quantity of application It will be determined by such factor with frequency, such as the illness of patient and the type of patient disease and severity.

When pointing out " effective quantity in immunology ", " antitumor effective quantity ", " tumour-inhibition effective quantity " or " therapeutic dose ", The precise volume of the present composition to be administered can be determined that the age of consideration patient (object), weight, tumour are big by doctor The individual difference of small, infection or metastasis degree and illness.It can usually point out: the pharmaceutical composition including T cell described herein It can be with 10⁴To 10⁹A cell/kg weight dosage, preferably 10⁵To 10⁶A cell/kg weight dosage.T cell composition It can also be with these dosage multiple applications.Cell can be by using injection technique well known in immunotherapy (see for example Rosenberg etc., New Eng.J.of Med.319:1676,1988) application.Optimal dose and treatment for specific patient Scheme can be by monitoring the disease indication of patient and therefore adjustment for the treatment of is readily determined by medical domain technical staff.

The application of object composition object can carry out in any convenient manner, including pass through spray-on process, inject, swallow, is defeated Liquid, implantation or transplanting.Compositions described herein can by subcutaneous, intradermal, tumor, in knot, in spinal cord, intramuscular, pass through vein Patient is administered in interior injection or peritonaeum.In one embodiment, T cell composition of the invention passes through intradermal or subcutaneous note It penetrates and is administered to patient.In another embodiment, T cell composition of the invention preferably passes through intravenous injection application.T is thin The composition of born of the same parents can be injected directly into tumour, lymph node or infection position.

In some embodiments of the present invention, CAR-T cell of the invention or combinations thereof object can with it is known in the art Other therapies combine.The therapy includes but is not limited to chemotherapy, radiotherapy and immunosuppressor.For example, in combination with well known in the art Treatment GPC3 mediate disease radiotherapy or chemotheraping preparation treated.

Herein, " anti-tumor effect " refers to a kind of biological effect, can be by the reduction of gross tumor volume, tumor cell number Reduction, the increase of life expectancy or the improvement expression of various physiological signs relevant to cancer for reducing, shifting number.

" patient ", " object ", " individual " etc. are used interchangeably herein, and referring to can cause the work of immune response organic Body, such as mammal.Example includes but is not limited to people, dog, cat, mouse, rat and its genetically modified organism.

The present invention using the resisting GPC 3 antibody scFV of GC33 (specifically be derived from) gene order, and from NCBI The CD8 α hinge area of people, the CD8 transmembrane region of people, the 41BB intracellular region of people and the CD3 ζ born of the same parents of people are searched in GenBank database Inner region gene sequence information, full genome synthesize Chimeric antigen receptor GC33scFv-CD8 hinge area-CD8TM-41BB-CD3 ζ with The genetic fragment of GC33scFv-CD8 hinge area-CD8TM-41BB-CD3 ζ-tEGFR, is inserted into retroviral vector.Weight Group plasmid packaging virus in 293T cell, infects T cell, T cell is made to express the Chimeric antigen receptor.The present invention realizes chimeric The method for transformation of the T lymphocyte of antigen receptor gene modification is based on Retroviral Transformation method.This method has conversion High-efficient, foreign gene can stablize expression, and can shorten the time etc. that in vitro culture T lymphocyte reaches clinical number of stages Advantage.On the transgenosis T lymphocyte surface, the nucleic acid of conversion passes through transcription, accurate translation on it.It is prepared by the present invention GPC3-GC33 CAR-T cell has strong killing ability to specific tumor cell and kills in the case that effect target ratio is 20 to 1 Hurting efficiency is more than 90%.Further, by carrying tEGFR component, CAR of the invention also has tracing in vivo and safety open The effect of pass.

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restrictive, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including since introduction provided herein will become apparent from any and whole variation.

The determination of embodiment 1:mGPC3scFv-CD8 α -41BB-CD3 ζ gene order

From NCBI site databases search the CD8 α hinge area of people, the CD8 α transmembrane region of people, people 41BB intracellular region and The CD3 ζ intracellular region gene sequence information of people, resisting GPC 3 single-chain antibody clone number is GC33, these sequences are in website http: // Codon optimization is carried out on sg.idtdna.com/site, guarantees to be more suitable for the mankind in the case where encoding amino acid sequence is constant Cell expression.

Above-mentioned sequence is successively pressed by resisting GPC 3 scFv, people's CD8 α hinge area gene, people's CD8 α transmembrane region base using over-lap PCR Cause, people's 41BB intracellular region gene, people's CD3 ζ intracellular region gene order are attached, and introduce different digestion positions in each sequence junction Point forms complete mGPC3-CAR gene sequence information, obtains CAR molecule (hereinafter referred to as " mGPC3CAR "), gene order As shown in SEQ ID NO:1 1-1476, the amino acid sequence such as SEQ ID NO:2 1-492 amino acids institute of coding Show.

With the nucleotide sequence of NotI (NEB) and EcoRI (NEB) double digestion the CAR molecule, connect through T4 ligase (NEB) The site NotI-EcoRI into retrovirus MSCV (Addgene) is patched, competent E.coli (DH5 α) is transformed into.

Recombinant plasmid obtained is served Hai Shenggong Bioisystech Co., Ltd to be sequenced, by sequencing result and fitting At mGPC3-CAR sequence alignment it is whether correct to verify sequence.Sequencing primer are as follows:

Ariyoshi: AGCATCGTTCTGTGTTGTCTC (SEQ ID NO:3)；

Antisense: TGTTTGTCTTGTGGCAATACAC (SEQ ID NO:4).

After being sequenced correctly, simultaneously plasmid purification is extracted using the plasmid purification kit of Qiagen company, plasmid purification Plasmid calcium phosphate method transfects 293T cell and carries out retrovirus Packaging experimentation.

The plasmid map obtained constructed by the present embodiment is as shown in Figure 1.Fig. 2 shows the MSCV-CAR retrovirus expression The part sequencing result peak value figure of plasmid.

The determination of embodiment 2:mGPC3CAR-tEGFR gene order

The EGFR Extracellular domain sequence information of people is searched from NCBI site databases, sequence is in website http: // Codon optimization is carried out on sg.idtdna.com/site, guarantees to be more suitable for the mankind in the case where encoding amino acid sequence is constant Cell expression.

Above-mentioned sequence is successively pressed by GPC3CAR, GMCSFR leader sequence of embodiment 1 using over-lap PCR, tEGFR is carried out Connection introduces different restriction enzyme sites in each sequence junction, forms complete mGPC3CAR-tEGFR gene sequence information, obtain CAR molecule, sequence is as shown in SEQ ID NO:1, and the amino acid sequence of coding is as shown in SEQ ID NO:2.

Recombinant plasmid is served Hai Shenggong Bioisystech Co., Ltd be sequenced, by sequencing result be fitted to Whether mGPC3CAR-tEGFR sequence alignment is correct to verify sequence.Sequencing primer are as follows:

Ariyoshi: AGCATCGTTCTGTGTTGTCTC (SEQ ID NO:5)；

Antisense: TGTTTGTCTTGTGGCAATACAC (SEQ ID NO:6).

The plasmid map obtained constructed by the present embodiment is as shown in Figure 3.Fig. 4 shows the MSCV-CAR retrovirus expression The part sequencing result peak value figure of plasmid.

Embodiment 3: retrovirus packaging

1. the 1st day: 293T cell should be less than for 20 generations, not cover with excessively.With 0.6*10^6 cell/ml bed board, 10cm Ware adds the DMEM culture medium of 10ml, mixes well cell, 37 degree of overnight incubations.

2. the 2nd day: 293T cell fusion degree reaches 90% or so and is transfected (usually bed board 14-18h or so)；Prepare Plasmid composite, the amount of various plasmids are MSCV skeleton carrier 12.5ug, the Gag-pol 10ug, VSVg of embodiment 1 or 2 6.25ug CaCl₂250ul, H₂O 1ml, total volume 1.25ml；It is added in another pipe isometric with plasmid composite HBS, be vortexed concussion 20s when adding plasmid composite.Softly mixture is added in 293T ware along side, 37 DEG C of cultures 4h removes culture medium, and PBS is washed one time, rejoins the fresh culture of preheating.

3. the 4th day: collecting supernatant after transfection 48h and be stored in -80 DEG C with packing after the filtering of 0.45um filter, continue to add The fresh DMEM medium of preheating.

Embodiment 4: the T cell of retroviral infection people

1. purer CD3+T cell is obtained with Ficcol separating liquid (ocean Tianjin Hao) separation, with the X-VIVO of serum containing 5%AB (LONZA) culture medium adjustment cell density is 1 × 10⁶/mL.Cell is inoculated into advance with the hole 1ml/ with anti-human 50ng/ml CD3 antibody (Beijing is with vertical Hai Yuan) and 50ng/ml CD28 antibody (Beijing is with vertical Hai Yuan), add the leucocyte of 100IU/ml Interleukin 2 (the double aigrets in Beijing), the virus infection that stimulation culture is prepared after 48 hours with embodiment 3；

After 2.T cell activation culture every other day, PBS is diluted to Retronectin (Takara) packet of final concentration of 15 μ g/ml By non-tissue treatment culture plate, the every 250 μ l of hole of 24 orifice plates.It is protected from light, 4 DEG C spare overnight.

The culture of 3.T cell activation two days later, takes out 2 pieces of 24 orifice plates being coated with, and inhales and abandons coating buffer, is added containing 2%BSA's HBSS room temperature closes 30min.Confining liquid volume is every 500 μ l of hole, inhales and abandons confining liquid, with the HBSS board-washing two containing 2.5%HEPES It is secondary.

4. in the virus liquid adding hole that embodiment 3 is prepared, every hole adds 2ml virus liquid, 32 DEG C, 2000g, it is centrifuged 2h。

5. discarding supernatant liquid, the T cell 1 × 10 after activation is added in the every hole of 24 orifice plates⁶A, volume 1ml, culture medium is that T is thin IL-2 200IU/ml is added in born of the same parents' culture medium.30 DEG C, 1000g, it is centrifuged 10min.

6. culture plate is placed in 37 DEG C, 5%CO after centrifugation₂It is cultivated in incubator.

7. after infection for 24 hours, cell suspension is sucked out, 1200rpm, 4 DEG C, it is centrifuged 7min.

8. after cell infection, the density of cell is observed daily, adds the T cell culture solution of the 100IU/ml containing IL-2 in due course, The density of T cell is set to maintain 5 × 10⁵/ ml or so, expands cell.

Thus to obtain the CART cell for having infected retrovirus shown in embodiment 3 respectively, it is respectively designated as GPC3- GC33-CART cell (GPC3CAR of expression embodiment 1) and GPC3-GC33-tEGFR-CART cell (express embodiment 2 MGPC3CAR and tEGFR).

Embodiment 5: the ratio of T lymphocyte and the expression of surface C AR albumen after flow cytomery infection

72 hours after infecting CAR-T cells and NT cell (control group) are collected by centrifugation respectively, PBS is abandoned after washing 1 time Clearly, PBS after corresponding antibody is protected from light 30min is added to wash, is resuspended, last flow cytomery.CAR+ is by anti-mouse IgG F (ab') antibody (Jackson Immunoresearch) detects.

As a result as illustrated in Figures 5 and 6.Wherein, Fig. 5 is shown, the retroviral infection T being prepared using embodiment 3 is thin After born of the same parents 72 hours, the expression efficiency of GPC3-GC33-CAR+ is up to 36%；Fig. 6 shows, the reverse transcription being prepared using embodiment 3 After virus infection T cell 72 hours, the expression efficiency of GPC3-GC33-tEGFR-CAR+ is up to 23%.

INF- γ secretion detects after embodiment 6:CAR-T cell and target cell co-culture

1. the CAR-T cell that Example 4 prepares, be resuspended in Lonza culture medium, adjustment cell concentration is 1 × 10⁶/mL。

2. the culture plate of positive controls uses CD3 monoclonal antibody 500ng/mL that CD28 monoclonal antibody 500ng/ml is added to be coated in advance, training It supports in base and does not add IL-2.It is added after mixing well in 24 orifice plates, every hole 1mL cell suspension.BD GolgiPlug is added simultaneously (containing BFA, 1 μ l BD GolgiPlug is added in every 1ml cell culture medium), after mixing well, 37 DEG C incubation 5-6 hours.It collects Cell is compareed as CAR-T cell positive.

3. the every hole of experimental group contains target cell (HepG2 and Huh-7) or negative control cell (SK-HEP-1) 2 × 10⁵It is a, it is real Apply the CAR-T cell 2 × 10 of example 4⁵A, 200 μ l are free of the Lonza culture medium of IL-2.It is added after mixing well in 96 orifice plates.Together When BD GolgiPlug (containing BFA, 1 μ l BD GolgiPlug is added in every 1ml cell culture medium), after mixing well, 37 is added DEG C be incubated for 5-6 hours.Cell is collected, as experimental group.

4. the PBS per effective 1mL is cleaned cell 1 time, 300g is centrifuged 5 minutes.Carefully suck or outwell supernatant.

After 5.PBS washes cell, 250 μ l/EP pipes are added and fix/penetrating fluid, 4 DEG C are incubated for 20 minutes to fix cell and break Film.With 1 × BD Perm/Wash^TMBuffer solution for cleaning cell 2 times, 1mL/ times.

6. carrying out factor dyeing intracellular, appropriate IFN-γ, IL-2 cell factor fluorescence antibody or negative control are taken, BD is used Perm/Wash^TMBuffer is diluted to 50 μ l.The cell for having fixed rupture of membranes is sufficiently resuspended with this antibody diluent, 4 DEG C are protected from light incubation 30min, 1 × BD Perm/Wash^TMThe cleaning cell 2 times of buffer 1mL/ times, is then resuspended with PBS.

7. flow cytomery.

As a result as shown in FIG. 7 and 8.Wherein, Fig. 7 display prepares 3 days GPC3-GC33-CART cells and target cell (SK- HEP-1, HepG2, Huh-7) co-culture 5 hours INF- γ secretion situation.Fig. 8 display prepares 3 days GPC3-GC33- TEGFR-CART cell and target cell (SK-HEP-1, HepG2) co-culture the secretion situation of 5 hours INF- γ.

Embodiment 7:CAR-T cell and target cell detect tumor specific cell lethal effect after co-culturing

The tumour cell (HepG2 and Huh-7) (target protein containing GPC3, be target cell) of the 1.GPC3 positive be suspended in containing In the PBS of 0.1%BSA, adjustment concentration is 1 × 10⁶/ml。

2. fluorescein based dye CFSE (carbox fluorescenceindiacetate succinimidyl ester) is added to final concentration of 1 μM.

3. mixing, 37 DEG C of incubation 10min.

4. after being incubated for, being added and being reacted with the isometric FBS of cell suspension, incubation at room temperature 2min with end mark.

5. cleaning cell is simultaneously resuspended in fresh cells toxicity culture medium, density 1 × 10⁶/ml。

6. cleaning the effector T cell of embodiment 4 and being suspended in cytotoxicity culture medium, adjustment concentration is 5 × 10⁶/ml。

7. in all experiments, compare the cytotoxicity for having infected the effector T cell (CART) of embodiment 4 and/or not The cytotoxicity of the negative control effector T cell (NT cell) of infection, and these effector T cells come from the same patient.

8. for effector T cell and negative control effector T cell that infection embodiment 4 obtains, according to T cell: target cell The ratio of=20:1 or 4:1 (Fig. 9) or 2:1 or 1:2 (Figure 10) are trained in 5ml sterility test pipe (BD Biosciences) It supports, every group of two multiple holes of setting.In each co-cultivation group, target cell 50,000 (50 μ l), negative control cell 50, 000 (50 μ l).

9. co-cultured cell is placed in 37 DEG C of incubation 4h.

10. after the completion of being incubated for, PBS cleans cell, the concentration recommended to specifications immediately after rapidly joins 7-AAD (7-aminoactinomycin D), is incubated for 30min on ice.

It is not required to clean, directly machine testing in progress streaming, data are analyzed with Flow Jo.

As the result is shown in figures 9 and 10.Fig. 9 display prepares 3 days GPC3-GC33-CART cells (" CART ") and feminine genders Compare the lethal effect after effector T cell (" NT ") and target cell (HepG2 or Huh-7) is co-cultured 5 hours to tumour cell.Figure 10 displays prepare 3 days GPC3-GC33-tEGFR-CART cells (" GPC3-tEGFR CART "), GPC3-GC33-CART cells (" GPC3 CART ") and negative control effector T cell (" NT ") and target cell (HepG2) co-culture 5 hours after to tumour cell Lethal effect.

Claims

1. a kind of polynucleotide sequence, the polynucleotide sequence is selected from:

(1) amino acid sequence or coding such as SEQ ID NO:2 shown in ammonia of the coding as described in SEQ ID NO:2 1-492 The polynucleotide sequence of base acid sequence；With

(2) complementary series of (1) described polynucleotide sequence.

2. polynucleotide sequence as described in claim 1, which is characterized in that the polynucleotide sequence is by SEQ ID NO:1 Or the composition of nucleotide sequence shown in its 1-1476.

3. a kind of fusion protein, which is characterized in that the amino acid sequence of the fusion protein such as SEQ ID NO:2 1-492 Shown in amino acid.

4. a kind of nucleic acid constructs, the nucleic acid constructs contains polynucleotide sequence of any of claims 1-2.

5. nucleic acid constructs as claimed in claim 4, which is characterized in that the nucleic acid constructs is carrier.

6. nucleic acid constructs as claimed in claim 5, which is characterized in that the nucleic acid constructs is retroviral vector, Contain replication origin, 3 ' LTR, 5 ' LTR and polynucleotide sequence of any of claims 1-2.

7. a kind of retrovirus, the retrovirus contains nucleic acid constructs described in any one of claim 4-6.

8. the pharmaceutical composition of a kind of T cell of gene modification or the T cell containing the gene modification, which is characterized in that described thin Born of the same parents contain polynucleotide sequence of any of claims 1-2, or contain core described in any one of claim 4-6 Acid construct object, or retrovirus as claimed in claim 7 has been infected, or stablize and express fusion protein as claimed in claim 3 With EGFR segment shown in optional SEQ ID NO:2 541-875 amino acids sequence.

9. polynucleotide sequence of any of claims 1-2, fusion protein as claimed in claim 3, claim Nucleic acid constructs described in any one of 4-6 or retrovirus as claimed in claim 7 answering in the T cell of preparation activation With.

10. polynucleotide sequence of any of claims 1-2, fusion protein as claimed in claim 3, claim Nucleic acid constructs described in any one of 4-6, retrovirus as claimed in claim 7 or gene according to any one of claims 8 are repaired The purposes of the T cell of decorations or its pharmaceutical composition in the drug of preparation treatment liver cancer.