CN108864286A

CN108864286A - Target CD19 Chimeric antigen receptor and the anti-antibody variable region PD1 of Combined expression method and and application thereof

Info

Publication number: CN108864286A
Application number: CN201710341236.5A
Authority: CN
Inventors: 黄飞; 金涛; 王海鹰; 何凤; 史子啸
Original assignee: Shanghai Hrain Biotechnology Co Ltd
Current assignee: Shanghai Hrain Biotechnology Co Ltd
Priority date: 2017-05-16
Filing date: 2017-05-16
Publication date: 2018-11-23
Anticipated expiration: 2037-05-16
Also published as: CN108864286B

Abstract

The invention discloses a kind of Chimeric antigen receptor CD19 scFV-CD8hinge-CD28TM-CD28-CD3 ζ joint aPD1 scFV CAR-T cells and application thereof.Specifically, the present invention provides a kind of polynucleotide sequence, it is selected from：(1) contain the coded sequence and P2A polypeptid coding sequence, people IL2 signal coding sequence, anti-human PD1 monoclonal antibody coded sequence of the coded sequence of sequentially connected anti-CD19 single-chain antibody, the coded sequence of people's CD8 α hinge area, the coded sequence of people's CD28 transmembrane region, the coded sequence of people's CD28 intracellular region, people's CD3 ζ intracellular region；(2) complementary series of (1) described polynucleotide sequence.The present invention also provides the purposes of relevant fusion protein, the carrier containing the coded sequence and the fusion protein, coded sequence, carrier.CD19-28z-aPD1 CAR-T cell prepared by the present invention all has strong killing ability to specific tumor cell.CD19-28z-aPD1 CAR-T cell prepared by the present invention can close the site PD1-PDL1, make CAR-T cell from the inhibiting effect of PD1 with secretion PD1 antibody function.

Description

Target the Chimeric antigen receptor of CD19 and the side of the anti-antibody variable region PD1 of Combined expression Method and and application thereof

Technical field

The invention belongs to Chimeric antigen receptor fields, and in particular to the targeting anti-antibody variable region PD1 of CD19CAR Combined expression Cell and application thereof.

Background technique

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cell refers to repairs through gene After decorations, specific purpose antigen, and the T cell of continuous activation amplification can be identified with MHC non-limiting way.It is 2012 international thin Born of the same parents, which treat association's annual meeting middle finger and go out biological immune cell therapy, has become operation, radiotherapy, the 4th kind for the treatment of tumour outside chemotherapy Means, and future tumors will be become and treat essential means.CAR-T cell adoptive therapy is that most clearly have in current cancer therapies The immunotherapeutic form of effect.A large number of studies show that CAR-T cell can effectively identify tumour antigen, cause the anti-of specificity Tumor immune response significantly improves the survival state of patient.

Chimeric antigen receptor (CAR) is the core component of CAR-T, assigns the non-dependent mode of T cell HLA and identifies that tumour is anti- Former ability, this, which enables, identifies wider mesh compared to nave T cell surface receptor TCR by the T cell of CAR transformation Mark.It include that tumor associated antigen (tumor-associated antigen, a TAA) combined area is (logical in the basic engineering of CAR Often derive from the scFV section of monoclonal antibody antigen bond area), an extracellular hinge area, a transmembrane region and a letter intracellular Number area.The selection of target antigen for the safety of the specificity of CAR, validity and genetic modification T cell itself all It is crucial determinant (Science.1986.233 (4770):p.1318-21.).

CD19 is the glycoprotein of the 95kDa on B cell surface a kind of, is expressed since the early stage that B cell is developed is, until its It is divided into thick liquid cell.CD19 is one of the member of immunoglobulin (Ig) superfamily, as B cell surface signal transduction compound One of component, participated in the signal transduction process of B-cell receptor.In the mouse model of CD19 defect, periphery The quantity of B cell will appear apparent reduction in lymphoid tissue, can also decline to the response of vaccine and mitogen, while with blood The attenuating of clear Ig level.Generally, it is considered that the expression of CD19 is only limited to B cell system (B-cell lineage), it is more without being expressed in It can hemopoietic stem cell surface.It is thin that CD19 is also expressed in most of B cell lymphomas, lymphoma mantle cell, ALLs, CLLs, crinosity The surface of born of the same parents' leukaemia and a part of acute myeloid leukemia cells in children.Therefore, in the treatment of leukaemia/lymthoma, CD19 It is a kind of very valuable immunotherapeutic targets.Importantly, CD19 will not be expressed in it is most of normal thin in addition to B cell Cellular surface, including pluripotential hemopoietic stem cell, this feature make CD19 can be used as a kind of safe therapy target, can send out patient Raw autoimmune disease or the risk of irreversibility bone marrow toxicity damage minimize.Currently, anti-CD19 is had been developed that Antibody or scFv segment, and demonstrate in mouse model and the mankind/primate the prospect of its application.

PD1 (programmed death 1) is initially obtained in the T cell hybridoma of apoptosis, due to itself and cell Apoptosis is related and is named as 1 receptor of programmed death.PD1 expression of receptor is in T cell surface and Primary B cells surface, at this It plays a role in the differentiation of a little cells and apoptosis.PD1 is PD-L1 (B7-H1) and PD-L2 (B7-DC) respectively there are two ligand, Belong to B7 family protein (Blood.2009.114 (8):p.1537-44.).PD-L1 albumen wide expression and antigen presenting cell, Activate T, B cell, macrophage, placental trophoblast, myocardium endothelium and thymic cortical epithelial cells.In PD-L1 and T cell by Body PD1 interaction, plays an important role in terms of the negativity regulation of immune response.Under normal circumstances, body encounters external When pathogen or antigen are invaded, antigen presenting cell captures antigen, carries out processing to antigen and makes what T cell can identify Epitope in conjunction with MHC molecule and is presented with cell outside for T cell identification.T cell passes through TCR and antigen presenting cell MHC molecule combine, in addition the B7-1 (CD80) or B7-2 (CD86) on costimulatory signal CD28 receptor and T cells surface are tied It closes, T cell is connected to positive regulation signal, and T cells activation is effector T cell, starts immune response.When there is lasting antigen to pierce When swashing, to avoid response excessive, activating T cell surface expression PD1 is thin to T in conjunction with the PD-L1 on antigen presenting cell surface Born of the same parents transmit negative regulation signal, and T cell proliferation reduces or apoptosis.The study found that detectable in many mankind tumor tissues To the expression of PD-L1 albumen, the microenvironment of tumor locus can induce the expression of PD-L1 on tumour cell, the PD-L1 and T of expression The PD1 of cell surface, which is combined, inhibits T cell anti-tumor activity, so that tumour cell be made to escape the monitoring of body immune system and clear It removes, is conducive to the generation and growth of tumour.

PD1/PD-L1 pathway inhibitor can block the combination of PD1 and PD-L1, block negative regulation signal, make T cell Activity recovery, to enhance immune response.PD1/PDL1 pathway inhibitor mainly includes anti-PD1 or anti-PD-L1 monoclonal antibody. In July, 2014, the Opdivo of Shi Guibao take the lead in granted for treating advanced melanoma in Japan, become in the first approval in the whole world The PD1 inhibitor in city.This is that PD1 inhibitor shows life cycle curative effect, and chemotherapeutic Dacca in III phase clinical trial for the first time Bar piperazine is compared to 1 year survival rate 73% to 42%, and response rate 40% is to 14%, and adverse reaction decreases.And Merck Keytruda (pembrolizumab) in September, 2014 is with a unconventional large-scale I phase clinical trial for having 1000 patients to participate in As a result with first PD-1 inhibitor identity successful log American market, being approved for treatment can not perform the operation excision or to have gone out It now shifts and to the unresponsive advanced melanoma patient of other drugs (N Engl J Med.2013 Jul 11；369(2): 134-44.)。

Although compound combine foreground is wide, current antineoplastic treatment window is generally relatively narrow, the effect of drug combination Still it is difficult to predict seriously constrain the performance of PD1 effect.The fast development of CAR-T cell then provides new opportunity thus. CAR-T it is cell targeted it is strong, specificity is high, after being stimulated by tumour antigen can rapid, high volume proliferation, thus may be pressed down The limitation of property signal processed, so that its anti-tumor capacity be made to have a greatly reduced quality.If energy blocking t cell surface Inhibitory receptor PD1, can So that CAR-T cell is freed one's minds, gives full play to Tumor cytotoxicity.Based on this, by CAR-T cell and PD1/PD-L1 letter is blocked The strategy of number use in conjunction has obtained rapidly the concern (Oncoimmunology.2014Dec 21 of researchers；3(11): e970027.)。

University of Pennsylvania Edmund Moon professor and the team that he is led carry out for this use in conjunction strategy A series of researchs.In the TCR-T cell killing tumour cell experiment that NY-ESO-1 is Antigenic Target, anti-PD1 antibody is added, The phenomenon that T cell hypofunction can be significantly improved；Correspondingly, in mouse subcutaneous transplanting tumor model, the tumour of TCR-T cell is clear Removing solid capacity is limited, and after giving the processing of PD1 antibody at the same time, then it can achieve the purpose that completely eliminate tumour (Clin Cancer Res.2016.22(2):p.436-47.).Meanwhile the team devises CAR-T cell of new generation using technique for gene engineering, i.e., Be inserted into a transgene receptor PD1CD28 in CAR-T cell by viral vectors, this structure by PD1 extracellular fragment and total thorn The cross-film section and intracellular section of composition for swashing molecule CD28, can be after PD1 and tumor cell surface ligand PD-L1 be combined, by PD1/PD- L1 inhibits signal to be changed into activation signals, so that the function for CAR-T cell increases power.This effect is in preclinical animal model Also good authentication has been obtained in research, is loaded into the CAR-T cell of PD1CD28 compared to the T cell for being not inserted into PD1CD28, energy Stronger immune response is generated to mouse tumor model, increases the survival rate of mouse.

The above Preliminary Study shows CAR-T cell and blocks PD1/PD-L1 combined signal application strategy in oncotherapy In feasibility, it would be desirable to herein on basis, make full use of the genetic modification technology of mature now, realize the two Between best combination.And we design at present 1 single-chain antibody of CD19CAR combined PD this strategy makes CAR-T cell and blocking PD1 signal has obtained good application, inhibits microenvironment to obtain good improvement tumour immunity, while being also facing from now on Bed experiment is laid a good foundation.

Summary of the invention

First aspect present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from：

(1) contain leading peptide-coding sequence, the anti-CD19 single-chain antibody coded sequence, people CD8 of sequentially connected CD8 antigen α hinge area coded sequence, people's CD28 transmembrane region coded sequence, people's CD28 intracellular region coded sequence, people's CD3 ζ intracellular region code sequence Column and P2A polypeptid coding sequence, people IL2 signal coding sequence, anti-human PD1 monoclonal antibody heavy chain and light chain variable The coded sequence in area and

(2) complementary series of (1) described polynucleotide sequence.

In one or more embodiments, coded sequence of the polynucleotide sequence in the anti-CD19 single-chain antibody It is preceding also containing the coded sequence of signal peptide.In one or more embodiments, the amino acid sequence of the signal peptide such as SEQ ID NO:Shown in 2 1-21 amino acids.In one or more embodiments, the light chain variable of the anti-CD19 single-chain antibody The amino acid sequence in area such as SEQ ID NO:Shown in 2 22-128 amino acids.It is described anti-in one or more embodiments The amino acid sequence of the heavy chain variable region of CD19 single-chain antibody such as SEQ ID NO:Shown in 2 144-263 amino acids.At one Or in multiple embodiments, the amino acid sequence such as SEQ ID NO of the people CD8 α hinge area:2 264-310 amino acids institutes Show.In one or more embodiments, the amino acid sequence of the people CD28 transmembrane region such as SEQ ID NO:2 311-337 Shown in amino acids.In one or more embodiments, the amino acid sequence of the people CD28 intracellular region such as SEQ ID NO:2 Shown in 338-378 amino acids.In one or more embodiments, the amino acid sequence of the people CD3 ζ intracellular region is such as SEQ ID NO:Shown in 2 379-489 amino acids.In one or more embodiments, the amino acid sequence of the people P2A Such as SEQ ID NO:Shown in 2 490-515 amino acids.In one or more embodiments, the ammonia of the people IL2 signal peptide Base acid sequence such as SEQ ID NO:Shown in 2 516-535 amino acids.In one or more embodiments, the anti-PD1 is mono- The amino acid sequence of the heavy chain variable region of chain antibody such as SEQ ID NO:Shown in 2 536-648 amino acids.In one or more In embodiment, the amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-PD1 single-chain antibody:2 664-770 Shown in amino acid.

In one or more embodiments, the signal peptide before the coded sequence of the anti-CD19 single-chain antibody Coded sequence such as SEQ ID NO:Shown in 1 1-63 nucleotide sequences.In one or more embodiments, the anti-CD19 The coded sequence of the light chain variable region of single-chain antibody such as SEQ ID NO:Shown in 1 64-384 nucleotide sequences.At one or In multiple embodiments, the coded sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD19 single-chain antibody:1 430-789 Shown in the nucleotide sequence of position.In one or more embodiments, the coded sequence such as SEQ ID of the people CD8 α hinge area NO:Shown in 1 790-930 nucleotide sequences.In one or more embodiments, the code sequence of the people CD28 transmembrane region Column such as SEQ ID NO:Shown in 1 931-1010 nucleotide sequences.In one or more embodiments, the people CD28 born of the same parents The coded sequence of inner region such as SEQ ID NO:Shown in 1 1011-1134 nucleotide sequences.In one or more embodiments In, the coded sequence such as SEQ ID NO of the people CD3 ζ intracellular region:Shown in 1 1135-1467 nucleotide sequences.At one Or in multiple embodiments, the coded sequence of the people P2A such as SEQ ID NO:Shown in 1 1368-1545 nucleotide sequences. In one or more embodiments, the coded sequence of human IL-2's signal peptide such as SEQ ID NO:1 1546-1605 cores Shown in nucleotide sequence.In one or more embodiments, the coded sequence of the heavy chain variable region of the anti-PD1 single-chain antibody is such as SEQ ID NO:Shown in 1 1606-1944 nucleotide sequences.In one or more embodiments, the anti-PD1 is single-stranded anti- The coded sequence of the light chain variable region of body such as SEQ ID NO:Shown in 1 1990-2310 nucleotide sequences.

Second aspect of the present invention provides a kind of fusion protein, and the fusion protein is selected from：

(1) containing the leader peptide of sequentially connected CD8 antigen, anti-CD19 single-chain antibody, people CD8 α hinge area, people CD28 across Film area, people CD28 intracellular region and people's CD3 ζ intracellular region and P2A polypeptide, people IL2 signal peptide, anti-human PD1 monoclonal antibody weight The fusion protein of chain and light chain variable region；With

(2) it lives in the amino acid sequence that (1) limits by replacing, missing or adding one or several amino acid and retaining Change the fusion protein as derived from (1) of CAR-T cell activity；

Preferably, the anti-CD19 single-chain antibody is anti-CD19 monoclonal antibody FMC63.

In one or more embodiments, the amino acid sequence of the signal peptide such as SEQ ID NO:2 1-21 ammonia Shown in base acid.In one or more embodiments, the amino acid sequence of the light chain variable region of the anti-CD19 single-chain antibody is such as SEQ ID NO:Shown in 2 22-128 amino acids.In one or more embodiments, the weight of the anti-CD19 single-chain antibody The amino acid sequence of chain variable region such as SEQ ID NO:Shown in 2 144-263 amino acids.In one or more embodiments In, the amino acid sequence such as SEQ ID NO of the people CD8 α hinge area:Shown in 2 264-310 amino acids.At one or more In a embodiment, the amino acid sequence of the people CD28 transmembrane region such as SEQ ID NO:Shown in 2 311-337 amino acids. In one or more embodiments, the amino acid sequence of the people CD28 intracellular region such as SEQ ID NO:2 338-378 ammonia Shown in base acid.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular region:2 Shown in 379-489 amino acids.In one or more embodiments, the amino acid sequence of the people P2A such as SEQ ID NO:2 Shown in 490-515 amino acids.In one or more embodiments, the amino acid sequence such as SEQ of the people IL2 signal peptide ID NO:Shown in 2 516-535 amino acids.In one or more embodiments, the heavy chain of the anti-PD1 single-chain antibody can Become the amino acid sequence such as SEQ ID NO in area:Shown in 2 536-648 amino acids.In one or more embodiments, institute State the amino acid sequence such as SEQ ID NO of the light chain variable region of anti-PD1 single-chain antibody:Shown in 2 664-770 amino acids.

Third aspect present invention provides a kind of nucleic acid constructs, and the nucleic acid constructs contains polynucleotides as described herein Sequence.

In one or more embodiments, the nucleic acid constructs is carrier.In one or more embodiments, institute Stating nucleic acid constructs is retroviral vector, contains replication origin, 3 ' LTR, 5 ' LTR, polynucleotides as described herein Sequence, and optional selectable label.

Fourth aspect present invention provides a kind of retrovirus, and the retrovirus contains nucleic acid construct as described herein Object preferably comprises the carrier, the further preferably described retroviral vector.

Fifth aspect present invention provides a kind of CAR-T cell of gene modification, and the cell contains multicore as described herein Nucleotide sequence, or contain nucleic acid constructs as described herein, or infected retrovirus as described herein.

Sixth aspect present invention provides a kind of pharmaceutical composition of CAR-T cell containing gene modification as described herein.

Seventh aspect present invention provides polynucleotide sequence, fusion protein, nucleic acid constructs or reverse transcription as described herein Application of the virus in the CAR-T cell of preparation activation.

The eighth aspect of the invention is gene modification CAR-T cell activation method and training method and its application

The 9th aspect offer of present invention polynucleotide sequence as described herein, fusion protein, nucleic acid constructs, reverse transcription Use of the CAR-T cell or its pharmaceutical composition of virus or gene modification in the drug of the preparation treatment CD19 disease mediated On the way.

In one or more embodiments, the disease that the CD19 is mediated is leukaemia, lymthoma.

Detailed description of the invention

Fig. 1 is RV-CD19-28z-aPD1-CAR retrovirus expression vector (CD19-28z-aPD1) schematic diagram.SP： Signal peptide；VL：Light chain variable region；Lk：Connector (G₄S)₃；VH：Heavy chain variable region；H：CD8 α hinge area；TM：CD8 transmembrane region.

Fig. 2 is that the part of RV-CD19-28z-aPD1-CAR retrovirus expression vector (CD19-28z-aPD1) is sequenced As a result peak value figure.

Fig. 3 is FCM results show retroviral infection T cell 72 hours CD19-28z-tEGFR and CD19- 28z-aPD1 CAR-T expression efficiency.

Fig. 4 is that CD19-28z-tEGFR the and CD19-28z-aPD1 CAR-T cell for preparing 5 days and target cell co-culture 4 Hour CD107a degranulation detection.

Fig. 5 is that CD19-28z-tEGFR the and CD19-28z-aPD1 CAR-T cell for preparing 5 days and target cell co-culture 4 The secretion detection of hour IFN γ.

Fig. 6 is that CD19-28z-tEGFR the and CD19-28z-aPD1 CAR-T cell for preparing 5 days and target cell co-culture 16 The lethal effect of tumour cell is detected after hour.

Fig. 7 is that CD19-28z-tEGFR the and CD19-28z-aPD1 CAR-T cell for preparing 5 days and target cell co-culture 24 The surface CAR-T PD1 detection of expression after hour.

Specific embodiment

The present invention provides a kind of Chimeric antigen receptor (CAR) its table for having combined the anti-antibody variable region PD1 for targeting CD19 It reaches.The CAR contains the leader peptide, anti-CD19 single-chain antibody, people CD8 α hinge area, people's CD28 cross-film of sequentially connected CD8 antigen Area, people CD28 intracellular region and people's CD3 ζ intracellular region and P2A polypeptide, people IL2 signal peptide, anti-human PD1 single-chain antibody variable region Fusion protein.

Various anti-CD19 monoclonal antibodies well known in the art can be derived from by being suitable for the invention anti-CD19 single-chain antibody.

Optionally, the light chain variable region and heavy chain variable region can be linked together by joint sequence.Can illustrate this Class single-chain antibody includes but is not limited to FMC63, SJ25C1.In certain embodiments, the monoclonal antibody is that clone number is The monoclonal antibody of FMC63.In certain embodiments, the amino acid sequence of the light chain variable region of the anti-CD19 single-chain antibody Such as SEQ ID NO:Shown in 2 22-128 amino acids residue.In other embodiments, the anti-CD19 single-chain antibody The amino acid sequence of heavy chain variable region such as SEQ ID NO:Shown in 2 144-263 amino acids residue.

The amino acid sequence for being suitable for the invention people's CD8 α hinge area can be such as SEQ ID NO:2 264-310 bit aminos Shown in acid.

Being suitable for the invention people's CD28 transmembrane region can be the various people CD28 transmembrane region sequences commonly used in the art in CAR Column.In certain embodiments, the amino acid sequence of the people CD28 transmembrane region such as SEQ ID NO:2 311-337 bit aminos Shown in acid.

Being suitable for the invention CD28 can be the various CD28 for CAR known in the art.As illustrative example, The present invention uses SEQ ID NO:CD28 shown in 2 338-378 amino acids sequences.

It is suitable for the invention the various people CD3 ζ intracellular regions that people's CD3 ζ intracellular region can be this field conventionally used for CAR. In certain embodiments, the amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular region:2 379-489 amino acids institutes Show.

The amino acid sequence for being suitable for the invention people P2A can be such as SEQ ID NO:Shown in 2 490-515 amino acids.

The amino acid sequence for being suitable for the invention human IL-2's signal peptide can be such as SEQ ID NO:2 516-535 bit aminos Shown in acid.

The heavy chain variable amino acid sequence for being suitable for the invention the anti-PD1 single-chain antibody of people can be such as SEQ ID NO:2 Shown in 536-648 amino acids.

The chain variable region amino acid sequence for being suitable for the invention the anti-PD1 single-chain antibody of people can be such as SEQ ID NO:2 Shown in 664-770 amino acids.

Form each part mentioned above of fusion protein of the invention, the i.e. leader peptide of CD8 antigen, anti-CD19 single-chain antibody, people It is CD8 α hinge area, people CD28 transmembrane region, people CD28 intracellular region people CD3 ζ intracellular region, people P2A polypeptide, people IL2 signal peptide, anti-human PD1 single-chain antibody can be directly connected between each other, or can be connected by joint sequence.Joint sequence can be well known in the art The joint sequence suitable for antibody, such as the joint sequence containing G and S.In general, connector contain it is duplicate before and after one or more Motif.For example, the motif can be GGGS, GGGGS, SSSSG, GSGSA and GGSGG.Preferably, the motif is in joint sequence Be it is adjacent, amino acid residue is not inserted between repetition.Joint sequence may include 1,2,3,4 or 5 repetition motif group At.The length of connector can be 3~25 amino acid residues, such as 3~15,5~15,10~20 amino acid residues.At certain In a little embodiments, joint sequence is more glycine linlcers sequences.The quantity of glycine is not particularly limited in joint sequence, usually It is 2~20, such as 2~15,2~10,2~8.Except glycine and serine come, also containing other known in connector Amino acid residue, for example, alanine (A), leucine (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), Glutamine (Q) etc..As an example, connector can be made of following amino acid sequence：G(SGGGG)₂SGGGLGSTEF(SEQ ID NO:7)、RSTSGLGGGS(GGGGS)₂G(SEQ ID NO:8)、QLTSGLGGGS(GGGGS)₂G(SEQ ID NO:9)、GGGS (SEQ ID NO:10)、GGGGS(SEQ ID NO:11)、SSSSG(SEQ ID NO:12)、GSGSA(SEQ ID NO:13)、 GGSGG(SEQ ID NO:14)、GGGGSGGGGSGGGGS(SEQ ID NO:15)、SSSSGSSSSGSSSSG(SEQ ID NO: 16),GSGSAGSGSAGSGSA(SEQ ID NO:And GGSGGGGSGGGGSGG (SEQ ID NO 17):18) etc..

In certain embodiments, the light chain variable region and heavy chain variable region of the anti-CD19 and PD1 single-chain antibody of the present invention it Between by (GGGS)_nConnection, the integer that wherein n is 1~5.

It should be understood that in gene cloning operation, it is often necessary to design suitable restriction enzyme site, this certainly will be in expressed ammonia Base acid sequence end introduces one or more incoherent residues, and this has no effect on the activity of aim sequence.In order to construct Fusion protein, the expression for promoting recombinant protein obtain the recombinant protein being secreted into outside host cell automatically or are conducive to recombinant protein Purifying, it is often necessary to it is other suitable in the end N-, the end C- or the albumen of recombinant protein to be added to some amino acid In region, it may for example comprise but be not limited to, suitable joint peptide, signal peptide, leader peptide, end extend etc..Therefore, of the invention The aminoterminal or c-terminus of fusion protein (the i.e. described CAR) can also be containing one or more polypeptide fragments, as protein tag.Appoint What suitable label may be used to herein.For example, the label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out albumen pure Change.

The present invention also includes by SEQ ID NO:1 and SEQ ID NO:2 are sequentially connected in series the mutant for the CAR to be formed.These Mutant includes：With the CAR at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably extremely Lack 97% sequence identity and retains the amino acid sequence of the biological activity (such as activating T cell) of the CAR.It can be used for example The BLASTp of NCBI calculates the sequence identity between the sequence of two comparisons.

Mutant further includes：In SEQ ID NO:There is one or several mutation (insertion, missing in sequence shown in 1 and 2 Or replace), simultaneously still retain the CAR biological activity amino acid sequence.Several mutation be often referred to 1-10 with It is interior, such as 1-8,1-5 or 1-3.Replace and is preferably conservative replaces.For example, in the art, using similar performance Or similar amino acid does not usually change the function of protein or polypeptide when carrying out conservative replaces." similar performance is similar Amino acid " include for example, with similar side chain amino acid residue family, these families include the ammonia with basic side chain Base acid (such as lysine, arginine, histidine), has the amino acid (such as aspartic acid, glutamic acid) with acid side-chain Uncharged polar side chain amino acid (such as glycine, asparagine, glutamine, serine, threonine, tyrosine, Cysteine), amino acid with non-polar sidechain (such as alanine, valine, leucine, isoleucine proline, phenylpropyl alcohol Propylhomoserin, methionine, tryptophan), with β-branched building block amino acid (such as threonine, valine, isoleucine) and tool There is the amino acid (such as tyrosine, phenylalanine, tryptophan, histidine) of aromatic side chain.Therefore, it is used in polypeptide of the present invention One or several sites are replaced from another amino acid residue of same side chain class, will not be in substantially influences its activity.

The present invention includes the polynucleotide sequence for encoding fusion protein of the present invention.Polynucleotide sequence of the invention can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be it is single-stranded or Double-strand.DNA can be coding strand or noncoding strand.The present invention also includes the degeneracy of the polynucleotide sequence of encoding fusion protein Variant encodes identical amino acid sequence but the different nucleotide sequence of nucleotide sequence.

Polynucleotide sequence as described herein can usually be obtained with PCR amplification method.Specifically, can be public according to institute herein The nucleotide sequence opened, especially open reading frame sequence carry out design primer, and with the commercially available library cDNA or press art technology The library cDNA prepared by conventional method known to personnel expands as template and obtains related sequence.When sequence is longer, usually need Twice or repeatedly PCR amplification is carried out, then the segment that each time amplifies is stitched together by proper order again.For example, In certain embodiments, the polynucleotide sequence such as SEQ ID NO of fusion protein described herein is encoded:Shown in 1.

The present invention also relates to nucleic acid constructs, which contains the coded sequence of fusion protein as described herein, And the one or more regulating and controlling sequences being connect with these series of operations.The coded sequence of fusion protein of the present invention can It is operable to guarantee the expression of the albumen in many ways.It can be according to expression vector before nucleic acid constructs is inserted into carrier Difference or requirement and nucleic acid constructs is operated.The technology for changing polynucleotide sequence using recombinant DNA method is It is known in the art.

Regulating and controlling sequence can be suitable promoter sequence.Promoter sequence is usually grasped with the coded sequence of albumen to be expressed The property made connection.Promoter can be any nucleotide sequence that transcriptional activity is shown in selected host cell, including prominent Become, truncated and hybrid promoter, and can be from coding and the homologous or heterologous extracellular or intracellular polypeptide of the host cell Gene obtain.

Regulating and controlling sequence is also possible to suitable transcription terminator sequences, is identified by host cell to terminate the sequence of transcription. Terminator sequence is connect with 3 ' end effectors of the nucleotide sequence for encoding the polypeptide.It is functional in the host cell of selection Any terminator can be used in the present invention.

Regulating and controlling sequence is also possible to suitable leader sequence, the non-translational region of the mRNA important to host cell translation.Before It leads sequence and 5 ' ends of the nucleotide sequence for encoding the polypeptide is operatively connected.Functional in the host cell of selection What terminator can be used in the present invention.

In certain embodiments, the nucleic acid constructs is carrier.Usually the more of CAR are encoded by being operably connected Nucleotide sequence is incorporated to expression vector to promoter, and by construct, realizes the expression of the polynucleotide sequence of coding CAR.It should Carrier can be suitable for replicating and integrating eukaryocyte.Typical cloning vector includes that can be used for adjusting desired nucleic acid sequence Transcription and translation terminator, homing sequence and the promoter of expression.

The polynucleotide sequence for encoding CAR of the present invention can be cloned into the carrier of many types.For example, matter can be cloned into Grain, phasmid, phage-derived object, animal virus and clay.Further, carrier is expression vector.Expression vector can be with Viral vectors form is supplied to cell.Viral vector technology be well known in the present art and such as Sambrook etc. (2001, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, New York) It is described in other virology and molecular biology manual.The virus that can be used as carrier includes but is not limited to reverse transcription disease Poison, adenovirus, adeno-associated virus, herpesviral and slow virus.

In general, suitable carrier includes the replication orgin to work at least one organism, promoter sequence, conveniently Restriction enzyme sites and one or more selectable label (for example, WO 01/96584；WO01/29058；And U.S. Patent number 6,326,193)。

For example, in certain embodiments, the present invention uses retroviral vector, which contains multiple Initiation site processed, 3 ' LTR, 5 ' LTR, polynucleotide sequence as described herein, and optional selectable label.

One example of suitable promoter is instant early stage cytomegalovirus (CMV) promoter sequence.The promoter sequence Column are can to drive the strong constitutive promoter sequence for being operably coupled to any polynucleotide sequence high level expression thereon Column.Another example of suitable promoter is -1 α of the elongation growth factor (EF-1 α).It is also possible, however, to use other composing types open Promoter sequences, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer viral (MMTV), people are immune scarce It is instant to fall into long end repetition (LTR) promoter of virus (HIV), MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus Early promoter, Rous sarcoma virus promoter and people's gene promoter, such as, but not limited to actin promoter, Myosin promoter, ferroheme promoter and creatine kinase promoter.Further, also it is contemplated that being started using induction type Son.The use of inducible promoter provides molecular switch, and the induction type that is operably connected can be opened when expressing in the time limit The expression of the polynucleotide sequence of promoter, and expression is being closed when expression is undesirable.The example of inducible promoter Including but not limited to metallothionein promoter, Glucocorticoid promoter, progesterone promoter and tetracycline promoter.

In order to assess the expression of CAR polypeptide or part thereof, the expression vector for being introduced into cell also may include selectable mark Any of gene or reporter or both are remembered, in order to from the cell mass for seeking to be transfected or infect by viral vectors Middle identification and selection expression cell.In other respects, selectable label can be carried on independent section of DNA and for corotation Contaminate program.The flank of selectable label and both reporters can all have adjusting sequence appropriate, so as in host It is expressed in cell.Useful selectable marker includes such as antibiotics resistance gene, such as neo etc..

Reporter is used to identify the cell of potential transfection and for evaluating the functionality for adjusting sequence.DNA by After introducing recipient cell, the expression of reporter is measured under the suitable time.Suitable reporter may include coding Luciferase, beta galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase or Green Fluorescent Protein gene base Cause.Suitable expression system is well known and prepares using known technology or commercially obtain.

Gene is introduced into cell and is well known in the art the method that gene expression enters cell.Carrier can by Any method in this field is easily introduced into host cell, for example, mammal, bacterium, yeast or insect cell.For example, Expression vector can be transferred to host cell by physics, chemistry or biological means.

It include calcium phosphate precipitation by the physical method that polynucleotides introduce host cell, lipofection, particle bombardment, micro- Injection, electroporation etc..It include being carried using DNA and RNA by the biological method that interested polynucleotides introduce host cell Body.It include dispersion system of colloid by the chemical means that polynucleotides introduce host cell, such as macromolecular complex, nanometre glue Capsule, microballoon, pearl；With the system based on lipid, including oil in water emulsion, micella, mixed micelle and liposome.

It include using viral vectors, especially retrovirus vector by the biological method that polynucleotides introduce host cell Body, this has become the most widely used method by gene insertion mammal such as people's cell.Other viral vectors can source From slow virus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus etc..Many has been developed based on virus System, for gene transfer to be entered mammalian cell.For example, retrovirus provides the convenience for gene delivery system Platform.By the gene insertion vector of selection and retroviral particle is packaged into using technology as known in the art.It should Recombinant virus then can be separated and be transferred to internal or external subject cell.Many retroviral systems are in the art It is known.In some embodiments, using adenovirus vector.Many adenovirus vectors are well known in the art.? In one embodiment, slow virus carrier is used.

Therefore, in certain embodiments, the present invention also provides the retrovirus for activating T cell, which contains There are retroviral vector as described herein and corresponding packaging gene, such as gag, pol and vsvg.

Being suitable for the invention T cell can be various types of T cells in various sources.For example, T cell can derive from The PBMC of B cell malignant tumor patient.

It in certain embodiments, can be first with suitable (such as 30~80ng/ml, such as 50ng/ml) after obtaining T cell CD3 antibody stimulate activation, then containing suitable (such as 30~80IU/ml, such as 50IU/ml) IL2 culture medium carry out It cultivates spare.

CAR-T cell of the invention can undergo firm internal T cell to extend and be held in blood and marrow with high level Continue extended time quantum, and forms specific memory T cell.Be not intended to be fettered by any specific theory, encounter and with Afterwards eliminate expression Surrogate antigen target cell after, CAR-T cell of the invention can differentiation in vivo at center remember sample state.

The invention also includes a kind of cell therapies, and wherein T cell is expressed CAR as described herein by gene modification, and CAR-T cell is needed by injection in its recipient.The cell of injection can kill the tumour cell of recipient.Unlike antibody is treated Method, CAR-T cell can replicate in vivo, generate the long-term persistence that can lead to continued tumor control.

The anti-tumor immune response as caused by CAR-T cell can be active or passive immunity response.In addition, what CAR was mediated Immune response can be a part of adoptive immunotherapy step, and wherein the induction of CAR-T cell is to the antigen-binding portion dtex in CAR Anisotropic immune response.

Medicable cancer can be non-physical knurl, such as neoplastic hematologic disorder, such as leukaemia and lymthoma.Especially, it can adopt Disease with CAR of the invention, its coded sequence, nucleic acid constructs, expression vector, virus and CAR-T cell therapy is preferred The neoplastic hematologic disorder mediated for the disease that CD19 is mediated, especially CD19.

Specifically, herein, " disease that CD19 is mediated " includes but is not limited to leukaemia and lymthoma, such as B cell Lymthoma, lymphoma mantle cell, acute lymphoblastic leukemia, chronic lymphocytic leukemia, hairy cell leukemia and urgency Property myelogenous leukemia.

The T cell of CAR- modification of the invention can be administered alone or as pharmaceutical composition and diluent and/or and its Such as relevant cell factor of his component or cell mass combine application.Briefly, pharmaceutical composition of the invention may include as CAR-T cell as described herein, in conjunction with one or more pharmacy or physiologically acceptable carriers, diluent or excipient. Such composition may include buffer such as neutral buffered saline, sulfate buffered saline etc.；Carbohydrate such as Portugal Grape sugar, mannose, sucrose or glucan, mannitol；Protein；Polypeptide or amino acid such as glycine；Antioxidant；Chelating agent Such as EDTA or glutathione；Adjuvant (for example, aluminium hydroxide)；And preservative.

The mode that pharmaceutical composition of the invention can be suitable for the disease of (or prevention) to be treated is applied.The quantity of application It will be determined by such factor with frequency, such as the illness of patient and the type of patient disease and severity.

When pointing out " effective quantity in immunology ", " antitumor effective quantity ", " tumour-inhibition effective quantity " or " therapeutic dose ", The precise volume of the present composition to be administered can be determined that the age of consideration patient (object), weight, tumour are big by doctor The individual difference of small, infection or metastasis degree and illness.It can usually point out：Pharmaceutical composition including T cell described herein It can be with 10⁴To 10⁹A cell/kg weight dosage, preferably 10⁵To 10⁶A cell/kg weight dosage.T cell composition It can also be with these dosage multiple applications.Cell can be by using injection technique well known in immunotherapy (see for example Rosenberg etc., New Eng.J.of Med.319:1676,1988) it applies.Optimal dose and treatment for specific patient Scheme can be by monitoring the disease indication of patient and therefore adjustment for the treatment of is readily determined by medical domain technical staff.

The application of object composition object can carry out in any convenient manner, including pass through spray-on process, inject, swallow, is defeated Liquid, implantation or transplanting.Compositions described herein can by subcutaneous, intradermal, tumor, in knot, in spinal cord, intramuscular, pass through vein Patient is administered in interior injection or peritonaeum.In one embodiment, T cell composition of the invention passes through intradermal or subcutaneous note It penetrates and is administered to patient.In another embodiment, T cell composition of the invention preferably passes through intravenous injection application.T is thin The composition of born of the same parents can be injected directly into tumour, lymph node or infection position.

In some embodiments of the present invention, CAR-T cell of the invention or combinations thereof object can with it is known in the art Other therapies combine.The therapy includes but is not limited to chemotherapy, radiotherapy and immunosuppressor.For example, in combination with various radiotherapy systems Agent is treated, these radiotherapy agents include：Cyclosporin, imuran, methopterin, mycophenolate, FK506, fluorine, which reach, to be drawn Shore, rapamycin and Mycophenolic Acid etc..In a further embodiment, cell composition of the invention and bone-marrow transplantation, benefit With the T of chemotherapeutics such as fludarabine, external beam radiation therapy (XRT), cyclophosphamide or antibody such as OKT3 or CAMPATH Cell burning-eroding therapy is administered to patient in conjunction with (prior to, concurrently with, or after for example).

Herein, " anti-tumor effect " refers to a kind of biological effect, can be by the reduction of gross tumor volume, tumor cell number Reduction, the increase of life expectancy or the improvement expression of various physiological signs relevant to cancer for reducing, shifting number.

" patient ", " object ", " individual " etc. are used interchangeably herein, and referring to can cause the work of immune response organic Body, such as mammal.Example includes but is not limited to people, dog, cat, mouse, rat and its genetically modified organism.

Embodiment

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restrictive, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including since introduction provided herein will become apparent from any and whole variation.

Embodiment 1：The determination of CD19scFv-CD8 α-CD28-CD3 ζ-P2A-aPD1scFV gene order

Anti-CD 19 antibodies light chain and heavy chain variable region, the CD8 α hinge area of people, people are searched from NCBI site databases CD28 transmembrane region and intracellular region, the CD3 ζ intracellular region of people, anti-human PD1 heavy chain of antibody and light-chain variable region gene sequence information, this A little sequences are in website http:Codon optimization is carried out on //sg.idtdna.com/CodonOpt, is guaranteed in coding amino acid sequence Arrange it is constant in the case where be more suitable for human cell expression.

Above-mentioned sequence is successively pressed by anti-CD19scFv, people's CD8 α hinge area gene, people's CD28 transmembrane region base using over-lap PCR Cause, people's CD28 intracellular region gene, people's CD3 ζ intracellular region gene, anti-PD1 heavy chain of antibody and light-chain variable region gene sequence connect It connects, introduces different restriction enzyme sites in each sequence junction, form complete CD19-CD28-aPD1 CAR gene order.

With the nucleotide sequence of NotI (NEB) and EcoRI (NEB) double digestion the CAR molecule, connect through T4 ligase (NEB) The site NotI-EcoRI into retroviral vector MSCV (Addgene) is patched, competent E.coli (DH5 α) is transformed into.

Recombinant plasmid is served Hai Sheng work Bioisystech Co., Ltd be sequenced, by sequencing result be fitted to Whether mCD19-CAR sequence alignment is correct to verify sequence.Sequencing primer is：

Sense sequences:AGCATCGTTCTGTGTTGTCTC

Antisense sequences:TGTTTGTCTTGTGGCAATACAC

After being sequenced correctly, simultaneously plasmid purification is extracted using the plasmid purification kit of Qiagen company, plasmid purification Plasmid calcium phosphate method transfects 293T cell and carries out retrovirus Packaging experimentation.

The plasmid map obtained constructed by the present embodiment is as shown in Figure 1.Fig. 2 shows the portion of the retrovirus expression plasmid Divide sequencing result peak value figure.

Embodiment 2：Retrovirus packaging

1. 293T cell should be less than for 20 generations in the 1st day, do not cover with excessively.With 0.6*10^6cells/ml bed board, 10cm Ware adds the DMEM culture medium of 10ml, mixes well cell, 37 degree of overnight incubations.

2. the 2nd day 293T cell fusion degree, which reaches 90% or so, is transfected (usually bed board 14-18h or so)；Prepare Plasmid composite, it is 12.5ug, Gag-pol 10ug, VSVg 6.25ug that the amount of various plasmids, which is Retro backbone, CaCl₂250ul, H₂O is that 1ml total volume is 1.25ml；The HBS isometric with plasmid composite, side are added in another pipe Add plasmid composite side to be vortexed and shakes 20s.Softly mixture is added in 293T ware, 37 degree of culture 4h along side, is removed Culture medium, PBS are washed one time, rejoin the fresh culture of preheating.

3. the 4th day：Supernatant is collected after transfection 48h and is stored in -80 degree with packing after the filtering of 0.45um filter, continues to add The fresh DMEM medium of preheating.

Embodiment 3：The T cell of retroviral infection people

1. purer CD3+T cell is obtained with Ficcol separating liquid (ocean Tianjin Hao) separation, with serum containing 5%AB (GEMINI) X-VIVO (LONZA) culture medium adjustment cell density is 1 × 10⁶/mL.Cell is inoculated into preparatory use with the hole 1ml/ Anti-human 50ng/ml CD3 antibody (Beijing is with vertical Hai Yuan) and 50ng/ml CD28 antibody (Beijing is with vertical Hai Yuan), add The interleukin 2 (the double aigrets in Beijing) of 100IU/ml, restrovirus infection in 48 hours is cultivated in stimulation.

After 2.T cell activation culture every other day, PBS is diluted to Retronectin (Takara) packet of final concentration of 15 μ g/ml By Non-ti ssue treated culture plate, the every 250 μ l of hole of 24 orifice plates.It is protected from light, 4 DEG C spare overnight.

The culture of 3.T cell activation two days later, takes out 2 pieces of 24 orifice plates being coated with, and inhales and abandons coating buffer, is added containing 2%BSA's HBSS room temperature closes 30min.Confining liquid volume is every 500 μ l of hole, inhales and abandons confining liquid, with the HBSS board-washing two containing 2.5%HEPES It is secondary.

4. in virus liquid adding hole, every hole adds 2ml virus liquid, 32 DEG C, 2000g, it is centrifuged 2h.

5. discarding supernatant liquid, the T cell 1 × 10 after activation is added in the every hole of 24 orifice plates⁶A, volume 1ml, culture medium is that T is thin IL-2 200IU/ml is added in born of the same parents' culture medium.30 DEG C, 1000g, it is centrifuged 10min.

6. culture plate is placed in 37 DEG C, is cultivated in 5%CO2 incubator after centrifugation.

7. after infection for 24 hours, cell suspension is sucked out, 1200rpm, 4 DEG C, it is centrifuged 7min.

8. after cell infection, the density of cell is observed daily, adds the T cell culture solution of the 100IU/ml containing IL-2 in due course, The density of T cell is set to maintain 5 × 10⁵/ ml or so, expands cell.

Thus to obtain the CAR-T cell for having infected retrovirus shown in embodiment 3 respectively, it is respectively designated as CD19-28- APD1 CAR-T cell (the CD19-28-aPD1 CAR of expression embodiment 1).

Embodiment 4：The expression of T lymphocyte surface C AR albumen after flow cytomery infection

72 hours after infecting CAR-T cells and NT cell (control group) are collected by centrifugation respectively, PBS is abandoned after washing 1 time Clearly, PBS after corresponding antibody is protected from light 30min is added to wash, is resuspended, last flow cytomery CAR (anti-mouse IgG F(ab')antibody(Jackson Immunoresearch))。

The present embodiment result shows by Fig. 3, the retroviral infection T cell being prepared using embodiment 3 72 hours Afterwards, the expression efficiency of the expression efficiency of CD19-28-aPD1 CAR+ up to 42.278%, CD19-28-tEGFR CAR+ reach 46.69%.Two groups of CAR-T cells have similar expression efficiency.

Embodiment 5：CD107a degranulation detects after CAR-T cell and target cell co-culture

1. taking one piece of 96 orifice plate of the bottom V, every hole adds CAR-T/NT cell 2*10⁵A and target cell (Raji or NALM6)/control Cell (K562) 2*10⁵It is a, the X-VIVO complete medium for being free of IL-2 for 100ul is resuspended, BD GolgiStop is added and (contains 1 μ l BD GolgiStop is added in every 1ml culture medium in monesin), 2ul CD107a antibody (Biolegend) is added in every hole (1:50) it, is incubated for 4 hours for 37 DEG C, collects cell.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C are centrifuged 5 minutes.Supernatant is abandoned, every pipe adds Enter appropriate specific surfaces antibody CD3 (Biolegend), CD4 (Biolegend), CD8 (Biolegend), resuspension volume 100ul is protected from light incubation 30 minutes on ice.

3. the PBS per effective 3mL is cleaned cell 1 time, 400g is centrifuged 5 minutes.Carefully suck supernatant.

4. appropriate PBS is resuspended, flow cytomery CD3, CD4, CD8, CD107a.

The present embodiment is as the result is shown in Fig. 4.CD19-28z-aPD1 CAR-T cell and CD19-28z-tEGFR CAR-T Cell after being co-cultured with Raji cell in CD8 positive cell the percentage of CD107a degranulation be respectively 40.1% and 55.5%；After CD19-28z-aPD1 CAR-T cell and CD19-28z-tEGFR CAR-T cell and NALM6 cell co-culture The percentage of CD107a degranulation is respectively 30.4% and 60.3% in CD8 positive cell；CD19-28z-aPD1 CAR-T cell With the percentage of CD19-28z-tEGFR CAR-T cell CD107a degranulation in CD4 positive cell after being co-cultured with Raji cell Rate is respectively 40.9% and 56.9%；CD19-28z-aPD1 CAR-T cell and CD19-28z-tEGFR CAR-T cell with The percentage of CD107a degranulation is respectively 38.5% and 45.5% in CD4 positive cell after NALM6 cell co-cultures.

Embodiment 6：IFN γ secretion detects after CAR-T cell and target cell co-culture

1. taking the CAR-T cell prepared, it is resuspended in Lonza culture medium, adjustment cell concentration is 1 × 10⁶/mL。

2. the every hole of experimental group contains target cell (Raji or NALM6) or negative control cell (K562) 2 × 10⁵It is a, CAR-T/ NT cell 2 × 10⁵A, 100 μ l are free of the Lonza culture medium of IL-2.It is added after mixing well in 96 orifice plates.BD is added GolgiStop (contains monesin, 1 μ l BD GolgiStop is added in every 1ml culture medium), and after mixing well, 37 DEG C of incubations 4 are small When.Cell is collected, as experimental group.

3. the PBS per effective 1mL is cleaned cell 1 time, 300g is centrifuged 5 minutes.Carefully suck or outwell supernatant.

After 4.PBS washes cell, 250 μ l/EP pipe Fixation/Permeabilization solution are added, 4 DEG C incubate 20 minutes are educated to fix cell and rupture of membranes.With 1 × BD Perm/Wash^TMBuffer is cleaned cell 2 times, 1mL/ times.

5. carrying out factor dyeing intracellular, appropriate IFN-γ cell factor fluorescence antibody or negative control are taken, with BD Perm/ Wash^TMBuffer is diluted to 50 μ l.The cell for having fixed rupture of membranes is sufficiently resuspended with this antibody diluent, 4 DEG C are protected from light incubation 30min, 1 × BD Perm/Wash^TMThe cleaning cell 2 times of buffer 1mL/ times, is then resuspended with PBS.

6. flow cytomery.

The present embodiment is as the result is shown in Fig. 5, CD19-28z-aPD1 CAR-T cell and CD19-28z-tEGFR CAR-T The percentage of IFN γ expression is respectively 28.2% and 57.4% to cell in CD8 positive cell after co-culturing with Raji cell； CD8 is positive thin after CD19-28z-aPD1 CAR-T cell and CD19-28z-tEGFR CAR-T cell and NALM6 cell co-culture The percentage that IFN γ is expressed in born of the same parents is respectively 29.4% and 58.9%；CD19-28z-aPD1 CAR-T cell and CD19-28z- The percentage of IFN γ expression is respectively 29.7% to tEGFR CAR-T cell in CD4 positive cell after co-culturing with Raji cell With 44.1%；After CD19-28z-aPD1 CAR-T cell and CD19-28z-tEGFR CAR-T cell and NALM6 cell co-culture The percentage that IFN γ is expressed in CD4 positive cell is respectively 24.8% and 38.9%.

Embodiment 7：CAR-T cell and target cell detect tumor specific cell lethal effect after co-culturing

1.K562 cell (being free of CD19 target protein, be the negative control cell of target cell) is resuspended in serum free medium (1640) in, adjustment cell concentration is 1 × 10⁶Fluorescent dye BMQC (2,3,6,7-tetrahydro-9- is added in/ml Bromomethyl-1H, 5Hquinolizino (9,1-gh) coumarin) to final concentration of 5 μM.

2. mixing, 37 DEG C of incubation 30min.

3. room temperature, 1500rpm is centrifuged 5min, abandons supernatant, and cell is resuspended in cytotoxicity culture medium (without phenol red 1640+ 5%AB serum) in, 37 DEG C of incubation 60min.

4. fresh cells toxicity culture medium cleans twice of cell, and is resuspended in fresh cells toxicity culture medium, and density 1 × 10⁶/ml。

5.Raji or NALM6 cell (target protein containing CD19 is target cell) is suspended in the PBS containing 0.1%BSA, is adjusted Whole concentration is 1 × 10⁶/ml。

6. fluorescein based dye CFSE (carboxyfluoresceindiacetatesuccinimidyl ester) is added to end Concentration is 1 μM.

7. mixing, 37 DEG C of incubation 10min.

8. after being incubated for, being added and being reacted with the isometric FBS of cell suspension, incubation at room temperature 2min with end mark.

9. cleaning cell is simultaneously resuspended in fresh cells toxicity culture medium, density 1 × 10⁶/ml。

10. cleaning effector T cell is simultaneously suspended in cytotoxicity culture medium, adjustment concentration is 5 × 10⁶/ml。

11. having infected the thin of the effector T cell (CAR-T cell) of CD19-28z-aPD1 CAR in all experiments The cytotoxicity of cellular toxicity and the negative control effector T cell being uninfected by (NT cell) compare, and these effector T cells From the same patient.

12.CD19-28z-aPD1 CAR-T and negative control effector T cell, according to T cell：Target cell=5:1,1:1, Ratio, cultivated in 5ml sterility test pipe (BD Biosciences).In each co-cultivation group, target cell Raji 100,000, cell (50 μ l), 100,000 K562 cell (50 μ l) of negative control cell.Being arranged one group simultaneously only includes Raji or NALM6 target cell and K562 negative control cell.

13. co-cultured cell is placed in 37 DEG C of incubation 16h.

14. after the completion of being incubated for, PBS cleans cell, the concentration recommended to specifications immediately after rapidly joins 7-AAD (7-aminoactinomycin D), is incubated for 30min on ice.

15. being not required to clean, directly machine testing in progress streaming, data are analyzed with Flow Jo.

16. analysis uses the living cells gating of 7AAD feminine gender, measure the Raji to live after T cell and target cell co-culture or The ratio of NALM6 target cell and K562 negative control cell living.

A) for the T cell of each group of co-cultivation and target cell,

Target cell survival %=Raji or NALM6 viable count/K562 viable count。

B) cytotoxic killer cell %=100- calibration target cell survive %, i.e., (when no effector cell Raji or NALM6 viable count-when containing effector cell Raji or NALM6 viable count)/K562 viable count ratio.

The present embodiment is as the result is shown in Fig. 6.Fig. 6 is shown, is 5 in effect target ratio:In the case of 1, CD19-28z-aPD1CAR- T cell and CD19-28z-tEGFR CAR-T cell are respectively 96% and 95% to the killing-efficiency of target cell NALM6.

Embodiment 8：CAR-T cell and target cell co-culture rear surface PD1 detection of expression

1. taking one piece of 96 orifice plate of the bottom V, every hole adds CAR-T/NT cell 2*10⁵A and target cell (Raji or NALM6), setting It is negative control that target cell group, which is not added, and the X-VIVO complete medium for 100ul containing IL-2 is resuspended, and 37 DEG C are incubated for 24 hours, is received Collect cell.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C are centrifuged 5 minutes.Supernatant is abandoned, every pipe adds Enter appropriate specific surfaces antibody CD3, CAR, PD1 (Biolegend), resuspension volume 100ul is protected from light incubation 30 minutes on ice.

4. appropriate PBS is resuspended, flow cytomery CD3, CAR, PD1, analyzes PD1 in CD3+CAR+ cell mass and express feelings Condition.

The present embodiment is as the result is shown in Fig. 7, the CD19-28z- after being incubated for jointly with target cell (Raji or NALM6) PD1 expression in the surface aPD1CAR-T is below CD19-28z-tEGFR CAR-T.

Sequence table

<110>Shanghai Heng Run Da Sheng Biotechnology Co., Ltd

<120>Target CD19 Chimeric antigen receptor and the anti-antibody variable region PD1 of Combined expression method and and application thereof

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 2310

<212> DNA

<213>Artificial sequence

<400> 1

atggctctgc ctgtgaccgc cctgctgctg cctctggctc tgctgctgca cgccgctcgg 60

cctgacattc agatgactca gaccacaagc agcctcagtg cgagcctggg ggacagggtg 120

actatcagct gccgggccag ccaggacatt tccaagtacc tgaattggta ccagcagaag 180

cccgatggta ctgtgaaact cctgatatat catacttcta ggctccattc cggggttcca 240

agccgattca gtggctccgg ttccggtaca gattattccc tgaccattag caacttggaa 300

caggaggaca ttgcaacgta tttctgtcag caaggcaaca cattgcccta cacattcggg 360

ggcgggacta aactcgaaat aactggcggc gggggttctg gtggcggcgg cagcggcggt 420

ggaggatcag aagtgaagct gcaggaaagt ggccccgggc tggtagcccc aagtcagtcc 480

ctgagtgtaa cctgtacagt gagtggagtg tctcttcctg actacggggt aagttggatt 540

cggcaacctc cacgcaaggg cctggagtgg ctcggcgtga tttggggatc tgagacaact 600

tactacaatt ccgccctgaa gagcaggctg accatcatta aggacaatag caagtcacag 660

gtgtttctga agatgaactc actgcagacc gacgacaccg ccatctatta ctgcgccaaa 720

cattattatt atggcgggag ttatgctatg gactactggg gccagggcac tagcgtcacc 780

gtcagcagta ctacaactcc agcacccaga ccccctacac ctgctccaac tatcgcaagt 840

cagcccctgt cactgcgccc tgaagcctgt cgccctgctg ccgggggagc tgtgcatact 900

cggggactgg actttgcctg tgatatctac ttctgggtgc tggtcgtggt cggaggggtg 960

ctggcctgtt atagcctgct ggtgactgtc gccttcatta tcttctgggt gcggagcaag 1020

aggtctcgcg gtgggcattc cgactacatg aacatgaccc ctagaaggcc tggcccaacc 1080

agaaagcact accagccata cgcccctccc agagatttcg ccgcttatcg aagcgtgaag 1140

ttctcccgaa gcgcagatgc cccagcctat cagcagggac agaatcagct gtacaacgag 1200

ctgaacctgg gaagacggga ggaatacgat gtgctggaca aaaggcgggg cagagatcct 1260

gagatgggcg gcaaaccaag acggaagaac ccccaggaag gtctgtataa tgagctgcag 1320

aaagacaaga tggctgaggc ctactcagaa atcgggatga agggcgaaag aaggagagga 1380

aaaggccacg acggactgta ccaggggctg agtacagcaa caaaagacac ctatgacgct 1440

ctgcacatgc aggctctgcc accaagaaga gctaagcgcg gctcaggcgc gaccaacttt 1500

tctctgctta agcaggcagg cgacgtggaa gagaaccccg ggcccatgta cagaatgcag 1560

ctgttgtctt gtattgccct ttctctcgcc ctcgtaacaa attcacaagt ccaattggtg 1620

gagtctggcg gtggggtagt tcagcccggc cgatccctgc gcctggactg caaagcttct 1680

ggaattacgt tctcaaactc cggaatgcac tgggtgcggc aagcacctgg gaaagggctg 1740

gagtgggttg cggtgatttg gtacgatggc tctaagaggt actacgcaga cagcgttaaa 1800

ggcagattta ctatatcccg agataactct aaaaatacgc tcttcctcca aatgaatagc 1860

ctgagggcag aagacacagc cgtttactat tgtgctacca atgatgatta ctggggacag 1920

ggcaccctgg ttaccgtaag ttccggcggt ggtggaagtg gaggaggggg atccggaggc 1980

gggggttctg agatcgtcct gacccagtct ccagccactc tctccctgtc tccaggcgag 2040

cgcgctacac tgagttgtag agcttcccag tccgtgagca gctatctggc ctggtatcag 2100

cagaagcctg ggcaggctcc acggttgctg atttatgacg cctccaaccg cgcgactggg 2160

ataccagcta ggttttccgg atcaggcagc ggcactgatt ttacactgac catctcatct 2220

ctcgagccgg aagatttcgc cgtttactat tgtcaacaga gttcaaactg gccacggaca 2280

ttcggtcagg ggaccaaggt tgaaattaag 2310

<160> 1

<170> PatentIn version 3.3

<210> 2

<211> 770

<212> PRT

<213>Artificial sequence

<400> 2

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu

20 25 30

Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln

35 40 45

Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr

50 55 60

Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val Pro

65 70 75 80

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile

85 90 95

Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly

100 105 110

Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu

130 135 140

Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser

145 150 155 160

Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly

165 170 175

Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly

180 185 190

Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser

195 200 205

Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys

210 215 220

Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys

225 230 235 240

His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly

245 250 255

Thr Ser Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro

260 265 270

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

275 280 285

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

290 295 300

Phe Ala Cys Asp Ile Tyr Phe Trp Val Leu Val Val Val Gly Gly Val

305 310 315 320

Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp

325 330 335

Val Arg Ser Lys Arg Ser Arg Gly Gly His Ser Asp Tyr Met Asn Met

340 345 350

Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala

355 360 365

Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Val Lys Phe Ser Arg Ser

370 375 380

Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu

385 390 395 400

Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg

405 410 415

Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln

420 425 430

Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr

435 440 445

Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp

450 455 460

Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala

465 470 475 480

Leu His Met Gln Ala Leu Pro Pro Arg Arg Ala Lys Arg Gly Ser Gly

485 490 495

Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn

500 505 510

Pro Gly Pro Met Tyr Arg Met Gln Leu Leu Ser Cys Ile Ala Leu Ser

515 520 525

Leu Ala Leu Val Thr Asn Ser Gln Val Gln Leu Val Glu Ser Gly Gly

530 535 540

Gly Val Val Gln Pro Gly Arg Ser Leu Arg Leu Asp Cys Lys Ala Ser

545 550 555 560

Gly Ile Thr Phe Ser Asn Ser Gly Met His Trp Val Arg Gln Ala Pro

565 570 575

Gly Lys Gly Leu Glu Trp Val Ala Val Ile Trp Tyr Asp Gly Ser Lys

580 585 590

Arg Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp

595 600 605

Asn Ser Lys Asn Thr Leu Phe Leu Gln Met Asn Ser Leu Arg Ala Glu

610 615 620

Asp Thr Ala Val Tyr Tyr Cys Ala Thr Asn Asp Asp Tyr Trp Gly Gln

625 630 635 640

Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly

645 650 655

Gly Ser Gly Gly Gly Gly Ser Glu Ile Val Leu Thr Gln Ser Pro Ala

660 665 670

Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala

675 680 685

Ser Gln Ser Val Ser Ser Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly

690 695 700

Gln Ala Pro Arg Leu Leu Ile Tyr Asp Ala Ser Asn Arg Ala Thr Gly

705 710 715 720

Ile Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu

725 730 735

Thr Ile Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln

740 745 750

Gln Ser Ser Asn Trp Pro Arg Thr Phe Gly Gln Gly Thr Lys Val Glu

755 760 765

Ile Lys

770

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence

<223>Primer

<400> 3

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213>Artificial sequence

<223>Primer

<400> 4

tgtttgtctt gtggcaatac ac 22

<210> 7

<211> 21

<212> PRT

<213>Artificial sequence

<223>Joint sequence

<400> 5

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Leu

1 5 10 15

Gly Ser Thr Glu Phe

20

Claims

1. a kind of fusion protein, the fusion protein is selected from：

(1) contain leader peptide, anti-CD19 single-chain antibody, the people CD8 α hinge area, people's CD28 cross-film of sequentially connected CD8 antigen Area, people CD28 intracellular region and people's CD3 ζ intracellular region and P2A polypeptide, people IL2 signal peptide and anti-human PD1 monoclonal antibody weight The fusion protein of chain and light chain variable region；With

(2) by replacing, missing or adding one or several amino acid and retaining activation T in the amino acid sequence that (1) limits The fusion protein as derived from (1) of cell activity；

2. fusion protein as described in claim 1, which is characterized in that the fusion protein has following one or more special Sign：

The amino acid sequence of the CD8 antigen leader peptide such as SEQ ID NO:Shown in 2 1-21 amino acids；

The amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-CD19 single-chain antibody:2 22-128 amino acids institutes Show；

The amino acid sequence of the heavy chain variable region of the anti-CD19 single-chain antibody can be such as SEQ ID NO:2 144-263 bit aminos Shown in acid；

The amino acid sequence such as SEQ ID NO of the people CD8 α hinge area:Shown in 2 264-310 amino acids；

The amino acid sequence of the people CD28 transmembrane region such as SEQ ID NO:Shown in 2 311-337 amino acids；

The amino acid sequence of the people CD28 intracellular region such as SEQ ID NO:Shown in 2 338-378 amino acids；

The amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular region:Shown in 2 379-489 amino acids；

The amino acid sequence of the people P2A such as SEQ ID NO:Shown in 2 490-515 amino acids；

The amino acid sequence of the people IL2 signal peptide such as SEQ ID NO:Shown in 2 516-535 amino acids；

The amino acid sequence such as SEQ ID NO of the heavy chain variable region of the anti-PD1 single-chain antibody:2 536-648 amino acids institutes Show；

The amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-PD1 single-chain antibody:2 664-770 amino acids institutes Show.

3. polynucleotide sequence as claimed in claim 2, which is characterized in that

The coded sequence such as SEQ ID NO of the signal peptide before the coded sequence of the anti-CD19 single-chain antibody:1 1-63 Shown in the nucleotide sequence of position；And/or

The coded sequence such as SEQ ID NO of the light chain variable region of the anti-CD19 single-chain antibody:1 64-384 nucleotide sequences It is shown；And/or

The coded sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD19 single-chain antibody:1 430-789 nucleotides sequences Shown in column；And/or

The coded sequence such as SEQ ID NO of the people CD8 α hinge area:Shown in 1 790-930 nucleotide sequences；And/or

The coded sequence of the people CD28 transmembrane region such as SEQ ID NO:Shown in 1 931-1010 nucleotide sequences；And/or

The coded sequence of the people CD28 intracellular region such as SEQ ID NO:Shown in 1 1011-1134 nucleotide sequences；And/or

The coded sequence such as SEQ ID NO of the people CD3 ζ intracellular region:Shown in 1 1135-1467 nucleotide sequences；

The coded sequence of the people P2A such as SEQ ID NO:Shown in 1 1368-1545 nucleotide sequences；

The coded sequence of the people IL2 signal peptide such as SEQ ID NO:Shown in 1 1546-1605 nucleotide sequences；

The coded sequence such as SEQ ID NO of the heavy chain chain variable region of the anti-PD1 single-chain antibody:1 1606-1944 nucleotide Shown in sequence；

The coded sequence such as SEQ ID NO of the light chain variable region of the anti-PD1 single-chain antibody:1 1990-2310 nucleotides sequences Shown in column.

4. fusion protein as claimed in claim 4, which is characterized in that the fusion protein has following one or more special Sign：

The fusion protein also contains signal peptide in the N-terminal of the anti-CD19 single-chain antibody, it is preferable that the amino of the signal peptide Acid sequence such as SEQ ID NO:Shown in 2 1-21 amino acids；

5. a kind of nucleic acid constructs, the nucleic acid constructs contains polynucleotide sequence of any of claims 1-3；

Preferably, the nucleic acid constructs is carrier；

It is highly preferred that the nucleic acid constructs is retroviral vector, and containing replication origin, 3 ' LTR, 5 ' LTR, and Polynucleotide sequence of any of claims 1-3.

6. a kind of retrovirus, the retrovirus contains nucleic acid constructs described in claim 5, preferably comprises described Carrier, the further preferably described retroviral vector.

7. a kind of method of ex vivo activation T cell, the method includes using retroviral infection institute as claimed in claim 6 The step of stating T cell.

8. the pharmaceutical composition of a kind of T cell of gene modification or the T cell containing the gene modification, which is characterized in that described thin Born of the same parents contain polynucleotide sequence as claimed in claim 3 herein, or containing the retroviral vector described in claim 5, or Retrovirus as claimed in claim 6 has been infected, or has been prepared using method of claim 7.

9. a kind of cultural method cultivates the T cell of acquisition described in claim 8.It is characterized in that with IL-2 cell factor is contained Culture medium C AR-T cell.

10. according to the method described in claim 9, wherein, the cell culture about 3-5 days.

11. according to the method described in claim 10, wherein, the activation T cell be add anti-cd 3 antibodies to culture medium, and Exogenous IL-2 is optionally added into cell culture.

12. fusion protein of any of claims 1-2, polynucleotide sequence as claimed in claim 3, right are wanted The application of carrier described in asking 5 or retrovirus as claimed in claim 6 in the T cell of preparation activation.

13. fusion protein of any of claims 1-2, polynucleotide sequence as claimed in claim 3, right are wanted The T cell of carrier described in asking 5, retrovirus as claimed in claim 6 or gene modification according to any one of claims 8 is being made Purposes in the drug for the disease that standby treatment CD19 is mediated；

Preferably, the disease that the CD19 is mediated includes leukaemia and lymthoma；

It is highly preferred that the disease that the CD19 is mediated includes B cell lymphoma, lymphoma mantle cell, the white blood of acute lymphoblastic Disease, chronic lymphocytic leukemia, hairy cell leukemia and acute myeloid leukaemia.