WO2026010404A1 - 코리네박테리움 속 균주 유래의 신규 합성 프로모터 - Google Patents

코리네박테리움 속 균주 유래의 신규 합성 프로모터

Info

Publication number
WO2026010404A1
WO2026010404A1 PCT/KR2025/009536 KR2025009536W WO2026010404A1 WO 2026010404 A1 WO2026010404 A1 WO 2026010404A1 KR 2025009536 W KR2025009536 W KR 2025009536W WO 2026010404 A1 WO2026010404 A1 WO 2026010404A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
sequence
strain
target protein
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
PCT/KR2025/009536
Other languages
English (en)
French (fr)
Inventor
조창희
이상엽
조재성
프리실라 수야 프라보우신디
한태희
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Advanced Institute of Science and Technology KAIST
Hanwha Solutions Corp
Original Assignee
Korea Advanced Institute of Science and Technology KAIST
Hanwha Solutions Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea Advanced Institute of Science and Technology KAIST, Hanwha Solutions Corp filed Critical Korea Advanced Institute of Science and Technology KAIST
Publication of WO2026010404A1 publication Critical patent/WO2026010404A1/ko
Pending legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/05—Oxidoreductases acting on the CH-OH group of donors (1.1) with a quinone or similar compound as acceptor (1.1.5)
    • C12Y101/05003—Glycerol-3-phosphate dehydrogenase (1.1.5.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/0103—Glycerol kinase (2.7.1.30)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/01—Hydro-lyases (4.2.1)
    • C12Y402/01028—Propanediol dehydratase (4.2.1.28)

Definitions

  • the present invention relates to a novel synthetic promoter derived from a strain of the genus Corynebacterium, and more specifically, to two novel promoters which are mutant forms of known promoters of a strain of the genus Corynebacterium, a new strain comprising one of the two promoters, a vector comprising one of the two promoters, a host cell, and a method for producing a target protein using the host cell.
  • the inventors of the present invention discovered two novel promoters capable of further overexpressing a target gene in a Corynebacterium glutamicum strain, and confirmed that the expression ability thereof was significantly improved compared to existing promoters, thereby completing the present invention.
  • Patent Document 1 Republic of Korea Publication No. 10-2014-0110134
  • Another object of the present invention is to provide a vector comprising the novel promoter and a host cell transformed with the vector.
  • Another object of the present invention is to provide a new strain of Corynebacterium glutamicum comprising the novel promoter.
  • the present invention provides a vector comprising the promoter.
  • a gene encoding a target protein can be operably linked to the promoter.
  • the expression level of the gene encoding the target protein may be higher than when operably linked to the H36 promoter including the base sequence of SEQ ID NO: 3.
  • the present invention provides a Corynebacterium glutamicum strain 13g (accession number KCTC 15895BP) comprising a promoter comprising a base sequence of SEQ ID NO: 1 and a gene cluster, glpFKD , encoding glycerol facilitator, glycerol kinase, and glycerol-3-phosphate dehydrogenase.
  • the present invention provides a Corynebacterium glutamicum strain comprising a promoter having a base sequence of SEQ ID NO: 2, a gene cluster pduCDEGH encoding propanediol dehydratase large subunit PduC, propanediol dehydratase medium subunit PduD, propanediol dehydratase small subunit PduE, propanediol dehydratase reactivase alpha subunit PduG , and propanediol dehydratase reactivase beta subunit PduH. 13gp2 (Accession No. KCTC 15896BP) is provided.
  • the present invention provides a host cell transformed with the vector.
  • the host cell may be derived from a Gram-positive bacterium.
  • the Gram-positive bacteria may be Corynebacterium , Bifidobacterium , Rhodococcus , Candida , Bacillus , Staphylococcus , Lactococcus , Streptococcus , Lactobacillus , Clostridium , Streptomyces , or Bifidobacterium .
  • the present invention provides a method for producing a target protein, comprising a step of culturing the transformed host cell to produce the target protein.
  • the method for producing the target protein may additionally include a step of recovering the produced target protein.
  • the two novel synthetic promoters according to the present invention are more effective in overexpressing a target gene in a host cell, and thus, a host cell and method capable of mass-producing a useful target protein can be provided using the same.
  • Figure 1 is a schematic diagram showing the process by which the J0 promoter and J1 promoter of the present invention are generated by mutation of the H36 promoter inserted into the Corynebacterium glutamicum genome.
  • Figure 2 is a schematic diagram of the genome of the Corynebacterium WT bioD::sfGFP strain into which the H36, JO, and J1 promoters were each inserted.
  • Figure 3 is a graph comparing the green fluorescence intensities of the H36, JO, and J1 promoters.
  • the first aspect of the present invention relates to a novel synthetic promoter exhibiting strong promoter activity in a microorganism of the genus Corynebacterium, wherein the promoter may comprise or consist of the base sequences of SEQ ID NO: 1 and SEQ ID NO: 2, respectively.
  • the promoter consisting of the base sequence of sequence number 1 is named 'J0'
  • the promoter consisting of the base sequence of sequence number 2 is named 'J1'.
  • promoter refers to a DNA region to which RNA polymerase binds and initiates transcription of a gene operably linked thereto.
  • the promoter sequence can be modified by those skilled in the art to the extent that it has the same or similar activity. Accordingly, a promoter having a sequence identity of, for example, 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more with each base sequence of SEQ ID NOs: 1 and 2, and a fragment (hereinafter "variant") comprising a sequence having promoter activity among each base sequence of SEQ ID NOs: 1 and 2, for example, a sequence of a predicted transcription start point and a -10 region, may be included within the scope of the present invention.
  • homology refers to the percentage of identity between two polynucleotides or polypeptide moieties.
  • sequence homology from one moiety to another can be determined by known techniques. For example, homology can be determined by directly aligning sequence information and parameters such as score, identity, and similarity between two polynucleotide molecules or two polypeptide molecules using readily available computer programs (e.g., BLAST 2.0).
  • homology between polynucleotides can be determined by hybridizing polynucleotides under conditions that form a stable duplex between homologous regions, then digesting them with a single-strand-specific nuclease and determining the sizes of the digested fragments.
  • the two types of promoters are novel synthetic promoters derived from Corynebacterium glutamicum, and the two types of promoter sequences may match a portion of the entire genome of Corynebacterium glutamicum, but the strong promoter activity of the corresponding sequences is confirmed for the first time in the present invention.
  • a second aspect of the present invention relates to two new strains of Corynebacterium glutamicum each comprising the two promoters described above.
  • the two new strains of Corynebacterium glutamicum may be Corynebacterium glutamicum strain 13g (accession number KCTC 15895BP) including a promoter including a base sequence of sequence number 1 and Corynebacterium glutamicum strain 13gp2 (accession number KCTC 15896BP) including a promoter including a base sequence of sequence number 2.
  • Corynebacterium glutamicum strain 13g may include (i) a promoter comprising the base sequence of SEQ ID NO: 1, and (ii) glpFKD , a gene cluster encoding glycerol facilitator, glycerol kinase, and glycerol-3-phosphate dehydrogenase.
  • the gene encoding the above glycerol facilitator ( glpF ), the gene encoding glycerol kinase ( glpK ), and the gene encoding glycerol-3-phosphate dehydrogenase ( glpD ) may be derived from Escherichia coli, particularly from E. coli MG1655.
  • the amino acid sequence of the above glycerol persylate and the base sequence of the gene encoding the above glycerol persylate are disclosed in a known database such as NCBI.
  • the glycerol persylate may include the amino acid sequence of NCBI Reference Sequence: NP_418362.1 or a portion thereof, or may consist of the amino acid sequence or a portion thereof
  • the gene encoding the glycerol persylate may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: NP_418362.1 or a portion thereof, or may consist of the base sequence or a portion thereof.
  • the amino acid sequence of the above glycerol kinase and the base sequence of the gene encoding the above glycerol kinase are disclosed in a known database such as NCBI.
  • the glycerol kinase may include the amino acid sequence of NCBI Reference Sequence: NP_418361.1 or a portion thereof, or may be composed of the amino acid sequence or a portion thereof
  • the gene encoding the glycerol kinase may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: NP_418361.1 or a portion thereof, or may be composed of the base sequence or a portion thereof.
  • the amino acid sequence of the above glycerol-3-phosphate dehydrogenase and the base sequence of the gene encoding the above glycerol-3-phosphate dehydrogenase are disclosed in a known database such as NCBI.
  • the glycerol-3-phosphate dehydrogenase may include the amino acid sequence of NCBI Reference Sequence: NP_417884.1 or a part thereof, or may be made of the amino acid sequence or a part thereof
  • the gene encoding the glycerol-3-phosphate dehydrogenase may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: NP_417884.1 or a part thereof, or may be made of the base sequence or a part thereof.
  • the glpFKD It may comprise or consist of the base sequence of sequence number 4 and the base sequence of sequence number 5.
  • the glpFKD It may sequentially include the base sequence of sequence number 4 and the base sequence of sequence number 5, or may be sequentially composed of these base sequences.
  • Corynebacterium glutamicum strain 13gp2 may include (i) a promoter comprising a base sequence of SEQ ID NO: 2, and (ii) a gene cluster pduCDEGH encoding propanediol dehydratase large subunit PduC, propanediol dehydratase medium subunit PduD, propanediol dehydratase small subunit PduE, propanediol dehydratase reactivase alpha subunit PduG, and propanediol dehydratase reactivase beta subunit PduH .
  • the gene encoding the propanediol dehydratase large subunit PduC, propanediol dehydratase medium subunit PduD, propanediol dehydratase small subunit PduE, propanediol dehydratase reactivase alpha subunit PduG, and propanediol dehydratase reactivase beta subunit PduH may be derived from Klebsiella pneumoniae, particularly Klebsiella pneumoniae KCTC 2952.
  • the amino acid sequence of the propanediol dehydratase large subunit PduC and the base sequence of the gene encoding the propanediol dehydratase large subunit PduC are disclosed in known databases such as NCBI.
  • the propanediol dehydratase large subunit PduC may include the amino acid sequence of NCBI Reference Sequence: WP_002915744.1 or a part thereof, or may consist of the amino acid sequence or a part thereof
  • the gene encoding the propanediol dehydratase large subunit PduC may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: WP_002915744.1 or a part thereof, or may consist of the base sequence or a part thereof.
  • the amino acid sequence of the propanediol dehydratase medium subunit PduD and the base sequence of the gene encoding the propanediol dehydratase medium subunit PduD are disclosed in known databases such as NCBI.
  • the propanediol dehydratase medium subunit PduD may include the amino acid sequence of NCBI Reference Sequence: WP_016161755.1 or a part thereof, or may consist of the amino acid sequence or a part thereof
  • the gene encoding the propanediol dehydratase medium subunit PduD may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: WP_016161755.1 or a part thereof, or may consist of the base sequence or a part thereof.
  • the amino acid sequence of the propanediol dehydratase small subunit PduE and the base sequence of the gene encoding the propanediol dehydratase small subunit PduE are disclosed in known databases such as NCBI.
  • the propanediol dehydratase small subunit PduE may include the amino acid sequence of NCBI Reference Sequence: WP_004133648.1 or a part thereof, or may consist of the amino acid sequence or a part thereof
  • the gene encoding the propanediol dehydratase small subunit PduE may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: WP_004133648.1 or a part thereof, or may consist of the base sequence or a part thereof.
  • the amino acid sequence of the propanediol dehydratase reactivase alpha subunit PduG and the base sequence of the gene encoding the propanediol dehydratase reactivase alpha subunit PduG are disclosed in known databases such as NCBI.
  • the propanediol dehydratase reactivase alpha subunit PduG may include the amino acid sequence of NCBI Reference Sequence: WP_014226638.1 or a part thereof, or may consist of the amino acid sequence or a part thereof
  • the gene encoding the propanediol dehydratase reactivase alpha subunit PduG may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: WP_014226638.1 or a part thereof, or may consist of the base sequence or a part thereof.
  • the amino acid sequence of the propanediol dehydratase reactivase beta subunit PduH and the base sequence of the gene encoding the propanediol dehydratase reactivase beta subunit PduH are disclosed in known databases such as NCBI.
  • the propanediol dehydratase reactivase beta subunit PduH may include the amino acid sequence of NCBI Reference Sequence: WP_004205479.1 or a part thereof, or may consist of the amino acid sequence or a part thereof
  • the gene encoding the propanediol dehydratase reactivase beta subunit PduH may include the base sequence encoding the amino acid sequence of NCBI Reference Sequence: WP_004205479.1 or a part thereof, or may consist of the base sequence or a part thereof.
  • the pduCDEGH may contain or consist of the base sequence of sequence number 6.
  • the two types of promoters according to the present invention can be each inserted into a vector and used for the purpose of mass producing a target protein or target product in a Gram-positive bacterium, particularly a microorganism of the genus Corynebacterium.
  • the third aspect of the present invention relates to a vector comprising each of the two promoters described above and a host cell transformed with the vector.
  • vector refers to an artificial DNA molecule that carries genetic material capable of expressing a gene of interest in a suitable host, and specifically refers to a DNA construct containing the base sequence of a gene operably linked to suitable regulatory sequences.
  • the regulatory sequences may include, but are not limited to, a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the promoter may be a J0 or J1 promoter.
  • the vector used in the present invention is not particularly limited as long as it is replicable in a host cell, and any vector known in the art can be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state.
  • pWE15, M13, ⁇ MBL3, ⁇ MBL4, ⁇ IXII, ⁇ ASHII, ⁇ APII, ⁇ t10, ⁇ t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors
  • pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors.
  • the vector usable in the present invention is not particularly limited, and a known expression vector can be used.
  • Examples include, but are not limited to, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, and pCES208 vectors.
  • the endogenous promoter within the chromosome can be replaced with a nucleic acid molecule having the promoter activity of the present invention through a vector for chromosomal integration into a host cell.
  • the insertion of the nucleic acid molecule into the chromosome can be achieved by any method known in the art, for example, homologous recombination. Since the vector of the present invention can be inserted into the chromosome by homologous recombination, it may additionally include a selection marker to confirm whether the chromosomal insertion has occurred.
  • a selectable marker is used to select cells transformed with a vector, i.e., to confirm the presence of the target nucleic acid molecule.
  • Markers that confer selectable phenotypes such as drug resistance, nutrient requirements, cytotoxic agent resistance, or expression of surface proteins, can be used. In an environment treated with a selective agent, only cells expressing the selectable marker will survive or exhibit other phenotypic characteristics, allowing the selection of transformed cells.
  • the target gene can be replaced by homologous recombination with an endogenous promoter in a host cell, for example, a microorganism of the genus Corynebacterium.
  • a host cell for example, a microorganism of the genus Corynebacterium.
  • intrinsic activity refers to the activity state of an enzyme that a microorganism originally has in an unmodified state
  • modified to be enhanced compared to intrinsic activity refers to the newly introduced or enhanced activity of the enzyme compared to the activity of the enzyme before modification
  • “enhancement of enzyme activity” includes an increase in activity by increasing endogenous gene activity, amplification of endogenous genes from internal or external factors, deletion of inhibitory regulatory factors of gene expression, increase in gene copy number, introduction of genes from outside, modification of expression regulatory sequences, particularly promoter replacement or modification, and increase in enzyme activity by mutation within a gene.
  • modified to be enhanced compared to the intrinsic activity means that the activity of the microorganism after manipulation is increased compared to the activity of the microorganism before manipulation, such as deletion of a suppression regulator of gene expression or modification of an expression control sequence, or use of an improved promoter.
  • overexpression refers to a higher level of expression than the level at which the corresponding gene is expressed in a cell under normal conditions, and is a concept that includes increasing the amount of expression by replacing the promoter of a gene existing in the genome with a strong promoter or cloning the corresponding gene into an expression vector and transforming the cell.
  • a gene encoding a target protein may be operably linked to the promoter.
  • the target gene may be operably linked downstream of the promoter or a variant thereof.
  • operably linked means that the gene required for expression and its regulatory sequence are functionally linked to each other in a manner that enables gene expression.
  • target protein or target product refers to a protein or product to be overexpressed or mass-produced in a host cell or microorganism. Specifically, any protein or product to be overexpressed or mass-produced in a Gram-positive bacterium, more preferably a microorganism of the genus Corynebacterium, may be included without limitation.
  • the vector of the present invention can be linked downstream of a promoter to express a gene encoding a quantifiable protein (hereinafter referred to as a "reporter gene"), thereby measuring the level of promoter activity.
  • Green fluorescent protein (GFP) is preferably used as the reporter gene, but is not limited thereto.
  • the expression level of a gene encoding a target protein operably linked to the J0 promoter or J1 promoter according to the present invention may be higher than the expression level of the same target gene operably linked to the H36 promoter comprising the base sequence of SEQ ID NO: 3 below.
  • the expression level of a gene encoding a target protein may be about 1.5 times, about 2 times, or about 3 times higher than when operably linked to the H36 promoter.
  • the gene expression ability of the J0 promoter and J1 promoter of the present invention was compared and evaluated using the Corynebacterium WT bioD::sfGFP strain.
  • the WT bioD::sfGFP strain is a strain in which a sequence for expressing the fluorescent protein sfGFP with the synthetic promoter H36 is inserted into the gene bioD position of the wild-type Corynebacterium strain.
  • the host cell according to the present invention is a transformant transformed with the above-described vector.
  • transformation in the present invention refers to introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide includes both an integrated location within the chromosome of the host cell and an extrachromosomal location, as long as it can be expressed in the host cell.
  • the polynucleotide includes DNA and RNA encoding the target protein.
  • the polynucleotide may be introduced in any form as long as it can be introduced into the host cell and expressed.
  • the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for its own expression.
  • the expression cassette typically includes a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, which are operably linked to the polynucleotide.
  • the promoter may comprise a nucleic acid molecule having the activity of a promoter comprising or consisting of the base sequence of SEQ ID NO: 1 or SEQ ID NO: 2 according to the present invention.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell.
  • the method for transforming the vector of the present invention includes any method for introducing nucleic acids into cells, and can be performed by selecting an appropriate standard technique known in the art depending on the host cell. Examples thereof include, but are not limited to, electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.
  • the host cell may be selected from the group consisting of Rhizobium , Bifidobacterium , Rhodococcus , Candida , Erwinia , Enterobacter , Pasteurella, Mannheimia , Actinobacillus , Aggregatibacter , Xanthomonas , Vibrio , Pseudomonas , Azotobacter , Acinetobacter, Ralstonia , Agrobacterium , Rhodobacter , Zymomonas , Bacillus , It may be derived from Staphylococcus , Lactococcus , Streptococcus , Lactobacillus , Clostridium , Corynebacterium , Strept
  • the host cell may be derived from a Gram-positive bacterium.
  • the Gram-positive bacteria may be , but are not limited to, Corynebacterium , Bifidobacterium , Rhodococcus , Candida , Bacillus, Staphylococcus , Lactococcus , Streptococcus , Lactobacillus , Clostridium , Streptomyces , or Bifidobacterium .
  • the host cell may be derived from Corynebacterium glutamicum, more preferably Corynebacterium glutamicum ATCC 13032, but is not limited thereto.
  • a host cell transformed with a vector containing a promoter according to the present invention can overexpress a gene encoding a target protein compared to an existing promoter, and is therefore useful for mass-producing a target protein or target product.
  • the fourth aspect of the present invention relates to a method for producing a target protein, comprising a step of culturing the aforementioned host cell to produce the target protein.
  • the term "cultivation" in the present invention refers to growing host cells under appropriately artificially controlled environmental conditions.
  • the method for producing the desired product using host cells derived from Gram-positive bacteria, such as Corynebacterium genus, in the present invention can be performed using methods widely known in the art. Specifically, the culturing can be performed continuously in a batch process, fed batch, or repeated fed batch process, but is not limited thereto.
  • the culture medium used must suitably meet the requirements of the specific strain.
  • Culture media for the aforementioned Gram-positive bacteria, particularly strains of the genus Corynebacterium, are known (e.g., Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981).
  • Sugar sources that can be used include, but are not limited to, sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as gluconic acid, acetic acid, and pyruvic acid. These substances can be used individually or as a mixture.
  • sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose
  • oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil
  • fatty acids such as palmitic acid, stearic acid, and linoleic acid
  • alcohols such as glycerol and ethanol
  • organic acids such as gluconic acid, acetic acid, and
  • Nitrogen sources that can be used include, but are not limited to, peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources can also be used individually or as a mixture. Phosphorus sources that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts.
  • the culture medium may contain metal salts such as magnesium sulfate or iron sulfate required for growth.
  • essential growth substances such as amino acids and vitamins may be used.
  • Appropriate precursors may also be used in the culture medium.
  • the above-mentioned raw materials may be added to the culture in a batch or continuous manner in an appropriate manner during the culture process.
  • the pH of the culture can be adjusted by appropriately using basic compounds such as sodium hydroxide, potassium hydroxide, or ammonia, or acid compounds such as phosphoric acid or sulfuric acid. Furthermore, foaming can be suppressed by using antifoaming agents such as fatty acid polyglycol esters. Oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture to maintain an aerobic state.
  • the culture temperature can typically be between 20°C and 45°C, preferably between 25°C and 40°C, but can be changed depending on the conditions, but is not limited thereto.
  • the method for producing the target protein may additionally include a step of recovering the produced target protein.
  • Methods for recovering the target protein from host cells or cultures thereof may include, but are not limited to, methods known in the art, such as centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC.
  • the above two types of promoters were discovered when a mutation was found in the inserted promoter H36 during the construction of a mutant Corynebacterium strain that can grow using glycerol as a single carbon.
  • the construction method of the mutant Corynebacterium strain is disclosed in Korean Patent Publication No. 10-2019-0087091, and the construction method is briefly described as follows. After inserting the gene glpFKD into the genome of wild-type Corynebacterium glutamicum ATCC 13032, a mutant strain was selected through adaptive laboratory evolution, and the selected strain was named '13g'.
  • the sequences of the glpFK gene fragment and the glpD gene fragment are as shown in SEQ ID NOs: 4 and 5 of Table 1 below.
  • the selected strain '13g' was deposited in the Korea Center for Bioscience and Biotechnology (KCTC) Gene Bank on April 26, 2024 and was assigned the accession number KCTC 15895BP.
  • these four amplified sequences were performed by overlapping PCR using primers of SEQ ID NO: 11 and SEQ ID NO: 14, and inserted into pK19mob-sacB (Park, SH et al., Nat. Commun 5, 4618, 2014) digested with BamHI and PstI by Gibson assembly method to construct the final vector 'pK19-msb-J1-pduCDEGH'.
  • the J1 promoter and pduCDEGH gene were inserted into the 13g strain using 'pK19-msb-J1-pduCDEGH' using the reported method (Park, SH et al., Nat. Commun 5, 4618, 2014), and the strain was named '13gp2'.
  • Strain '13gp2' was deposited at the Korea Center for Bioscience and Biotechnology (KCTC) Gene Bank on April 26, 2024 and was assigned the accession number KCTC 15896BP.
  • the Corynebacterium WT bioD::sfGFP strain is a strain in which a sequence for expressing the fluorescent protein sfGFP (super-folder green fluorescent protein) with the synthetic promoter H36 is inserted into the bioD gene locus of the wild-type Corynebacterium strain (ATCC 13032).
  • the primers of SEQ ID NO: 15 and SEQ ID NO: 17 were used to amplify the J0 promoter from the genome of the improved Corynebacterium '13g' strain with SEQ ID NO: 16 and SEQ ID NO: 17.
  • the upstream (left arm) that becomes the homologous arm was amplified from the WT bioD::sfGFP genome using primers of SEQ ID NO: 18 and SEQ ID NO: 19, and the downstream (right arm) was amplified from the WT bioD::sfGFP genome using primers of SEQ ID NO: 20 and SEQ ID NO: 21.
  • these three amplified sequences were subjected to overlapping PCR using primers of SEQ ID NO: 18 and SEQ ID NO: 21, and inserted into pK19mob-sacB (Park, S.H. et al., Nat.
  • the J0 and J1 promoters were inserted into the WT bioD::sfGFP strain using the reported method (Park, S.H. et al., Nat. Commun 5, 4618, 2014) to construct strains containing each promoter.
  • Corynebacterium glutamicum into which the above promoter was introduced was inoculated into BHIS (Brain Heart Infusion (BHI), 91 g/L sorbitol) medium and cultured at 30°C and 200 rpm for 24 hours. Then, 1/100 of the volume was transferred to fresh BHI medium and cultured for 24 hours under the same conditions. Each Corynebacterium glutamicum strain culture was centrifuged at 6000 rpm for 5 minutes to obtain bacterial cells, which were suspended in PBS and subjected to fluorescence intensity analysis to confirm the expression level of GFP.
  • BHI Brain Heart Infusion
  • 91 g/L sorbitol 91 g/L sorbitol

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 코리네박테리움 속 균주 유래의 신규 합성 프로모터에 관한 것으로, 보다 상세하게는 코리네박테리움 속 균주의 공지된 프로모터의 변이 형태인 2종의 신규 프로모터, 상기 2종의 프로모터 중 각 1종을 포함하는 신균주, 상기 2종의 프로모터 중 각 1종을 포함하는 벡터, 숙주 세포 및 상기 숙주 세포를 이용한 목적 단백질의 제조방법을 제공한다.

Description

코리네박테리움 속 균주 유래의 신규 합성 프로모터
본 출원은 2024년 7월 3일에 출원된 대한민국 특허출원 제10-2024-0087809호에 기초한 우선권을 주장하며, 해당 출원의 명세서 및 도면에 개시된 모든 내용은 본 출원에 원용된다.
본 발명은 코리네박테리움 속 균주 유래의 신규 합성 프로모터에 관한 것으로, 보다 상세하게는 코리네박테리움 속 균주의 공지된 프로모터의 변이 형태인 2종의 신규 프로모터, 상기 2종의 프로모터 중 각 1종을 포함하는 신균주, 상기 2종의 프로모터 중 각 1종을 포함하는 벡터, 숙주 세포 및 상기 숙주 세포를 이용한 목적 단백질의 제조방법을 제공한다.
코리네박테리움 속 균주, 특히 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)은 그람 양성 균주로서, 글루타메이트, 리신, 트레오닌과 같은 아미노산을 생산하는 용도로 널리 이용되고 있다. 코리네박테리움 글루타미쿰은 생장 조건이 단순하며, 대장균에 비해 고농도 배양이 가능하고, 유전체 구조가 안정적이어서 돌연변이 발생 확률이 낮다. 또한, 비병원성 균주이고 포자를 만들지 않아 환경에 유해한 영향을 미치지 않는 등 산업용 균주로서의 장점을 갖추고 있다.
이러한 코리네박테리움 속 균주를 유전공학적, 대사공학적 기술을 이용하여 목적 물질들을 고역가로 생산할 수 있는 균주로 개발하기 위해서는 원하는 유전자의 발현 세기를 조절하는 것이 필수적이며, 특히 특정 유전자를 과발현하는 것은 대량 생산 및 산업화에 있어서 필수 불가결하다. 이에, 유전자의 발현 세기를 향상시키기 위한 합성 생물학 도구를 발굴하고 발전시키는 연구가 진행되고 있으나, 균주에서 유전자 발현 세기를 향상시키는 새로운 유전자 서열을 발굴한 사례는 드물다.
기존에 보고된 코리네박테리움 속 균주의 프로모터를 살펴보면, 특허문헌 1에 'H30' 및 'H36'으로 명명된 강한 유전자 발현을 유도할 수 있는 신규 프로모터가 개시된 바 있으나, 보다 높은 발현 효율을 나타내는 신규 프로모터의 개발 필요성은 여전히 존재한다.
이러한 배경 하에, 본 발명자들은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 균주에서 목적 유전자를 더욱 과발현할 수 있는 신규 프로모터 2종을 발굴하고, 이의 발현능이 기존 프로모터에 비해 월등히 개선됨을 확인함으로써 본 발명을 완성하였다.
[선행기술문헌]
[특허문헌]
(특허문헌 1) 대한민국 공개특허 제10-2014-0110134호
본 발명의 목적은 코리네박테리움 속(Corynebacterium spp.) 균주에서 강한 활성을 나타내는 신규 프로모터를 제공하는 것이다.
본 발명의 다른 목적은 상기 신규 프로모터를 포함하는 벡터 및 상기 벡터로 형질전환된 숙주 세포를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 신규 프로모터를 포함하는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 신균주를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 숙주 세포를 이용한 목적 단백질의 제조방법을 제공하는 것이다.
상술한 과제를 해결하기 위해, 본 발명은 서열번호 1 또는 서열번호 2의 염기서열을 포함하는 프로모터를 제공한다.
또한, 본 발명은 상기 프로모터를 포함하는 벡터를 제공한다.
본 발명에 있어서, 상기 프로모터에는 목적 단백질을 코딩하는 유전자가 작동 가능하게 연결될 수 있다.
본 발명에 있어서, 상기 목적 단백질을 코딩하는 유전자의 발현량은 서열번호 3의 염기서열을 포함하는 H36 프로모터와 작동 가능하게 연결된 경우보다 높을 수 있다.
또한, 본 발명은 서열번호 1의 염기서열을 포함하는 프로모터, 및 글리세롤 퍼실레이터(glycerol facilitator), 글리세롤 키나제(glycerol kinase) 및 글리세롤-3-인산 디하이드로게나제(glycerol-3-phosphate dehydrogenase)를 코딩하는 유전자 클러스터인 glpFKD를 포함하는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 균주 13g(수탁번호 KCTC 15895BP)을 제공한다.
또한, 본 발명은 서열번호 2의 염기서열을 포함하는 프로모터, 프로판디올 디하이드라타제 라지 서브유닛 PduC(propanediol dehydratase large subunit PduC), 프로판디올 디하이드라타제 미디움 서브유닛 PduD(propanediol dehydratase medium subunit PduD), 프로판디올 디하이드라타제 스몰 서브유닛 PduE(propanediol dehydratase small subunit PduE), 프로판디올 디하이드라타제 리액티바제 알파 서브유닛 PduG(propanediol dehydratase reactivase alpha subunit PduG) 및 프로판디올 디하이드라타제 리액티바제 베타 서브유닛 PduH(propanediol　dehydratase　reactivase beta subunit　PduH)를 코딩하는 유전자 클러스터인 pduCDEGH를 포함하는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 균주 13gp2(수탁번호 KCTC 15896BP)를 제공한다.
추가로, 본 발명은 상기 벡터로 형질전환된 숙주 세포를 제공한다.
본 발명에 있어서, 상기 숙주 세포는 그람 양성균 유래일 수 있다.
본 발명에 있어서, 상기 그람 양성균은 코리네박테리움(Corynebacterium), 비피도박테리움(Bifidobacterium), 로도코커스(Rhodococcus), 칸디다(Candida), 바실러스(Bacillus), 스테필로코커스(Staphylococcus), 락토코커스(Lactococcus), 스트렙토코커스(Streptococcus), 락토바실러스(Lactobacillus), 클로스트리디움(Clostridium), 스트렙토마이세스(Streptomyces) 또는 비피도박테리움(Bifidobacterium)일 수 있다.
나아가, 본 발명은 상기 형질전환된 숙주 세포를 배양하여 목적 단백질을 생산하는 단계를 포함하는, 목적 단백질의 제조방법을 제공한다.
본 발명에 있어서, 상기 목적 단백질의 제조방법은 생산된 목적 단백질을 회수하는 단계를 추가로 포함할 수 있다.
본 발명에 따른 2종의 신규 합성 프로모터는 숙주 세포에서 목적 유전자의 과발현에 보다 효과적인 바, 이를 이용하여 유용한 목적 단백질을 대량 생산할 수 있는 숙주 세포 및 방법을 제공할 수 있다.
도 1은 코리네박테리움 글루타미쿰 게놈에 삽입된 H36 프로모터의 변이에 의해 본 발명의 J0 프로모터 및 J1 프로모터가 발생하는 과정을 나타낸 개략도이다.
도 2는 H36, JO 및 J1 프로모터가 각각 삽입된 코리네박테리움 WT bioD::sfGFP 균주의 게놈 모식도이다.
도 3은 H36, JO 및 J1 프로모터의 녹색 형광 강도를 비교하여 나타낸 그래프이다.
이하, 본 발명을 보다 상세히 설명한다.
본 발명에서 사용되는 모든 기술용어는, 달리 정의되지 않는 이상, 본 발명의 관련 분야에서 통상의 당업자가 일반적으로 이해하는 바와 같은 의미로 사용된다. 또한 본 명세서에는 바람직한 방법이나 시료가 기재되나, 이와 유사하거나 동등한 것들도 본 발명의 범주에 포함된다.
본 명세서 및 특허청구범위에서 사용된 특징부의 크기, 양 및 물리적 특성을 표현하는 모든 수는 모든 경우 용어 "약"에 의해 수식되는 것으로 이해되어야 한다. 따라서, 반대로 나타내지 않는 한, 명세서 및 특허청구범위에 개시된 수치 파라미터는 본 명세서에 개시된 교시 내용을 이용하여 당업자가 얻고자 하는 원하는 특성에 따라 달라질 수 있는 근사치이다.
전술한 바와 같이, 코리네박테리움 속 미생물에서 보다 높은 발현 효율을 나타내는 신규 프로모터의 개발 필요성이 여전히 존재하고 있는 실정이다. 이에, 본 발명자들은 기존에 코리네박테리움 속 미생물에서 작동하는 것으로 공지된 합성 프로모터인 H36의 변이에 의해 생성된 2종의 신규 합성 프로모터가 월등히 개선된 발현능을 가진다는 것을 확인함으로써, 상술한 문제의 해결방안을 모색하였다.
따라서, 본 발명의 제1 측면은 코리네박테리움 속 미생물에서 강한 프로모터 활성을 나타내는 신규 합성 프로모터에 관한 것으로, 상기 프로모터는 각각 다음의 서열번호 1 및 서열번호 2의 염기서열을 포함하거나, 이로 이루어질 수 있다.
acccggtgggtgacctttttaccgtggtcagcgcagcttagttctgcttggaaatacttttgcttacatgtggggttggtgcagcggtagcgaggtagacggataaacagtttggtgggaaacccgacgatgggtaaatcaatgagcatccggtgggtgtgatgacgaaacaccccaggttgggagcattctgggcaggtggaggtgtagtcgagtgcgtctgcttcgatcagggtgtaatcacctgcatcggaagcgccggtgatggtgagtcctagttccgcagtgcggcagatggtgtcagcgatgatgttgccggtagacttcatgggtagagccttttgttggtgtttggttagcttagatacctaaaccttaaccctgacaaaaggctcgtttattttcgggtctacaccgctagcccaggttctgtgatgtaccccaaaaccggaagggcccctaaacgggggaatattaacgggcccagggtggtcgcaccttggttggtaggagtagcatgggatcc (서열번호 1)
ggtacctctatctggtgccctaaacggggggtagagccttttgttggtgtttggttagcttagatacctaaaccttaaccctgacaaaaggctcgtttattttcgggtctacaccgctagcccaggttctgtgatgtaccccaaaaccggaagggcccctaaacgggggaatattaacgggcccagggtggtcgcaccttggttggtaggagtagcatgggatcc (서열번호 2)
본 발명에 있어서, 상기 서열번호 1의 염기서열로 이루어진 프로모터는 'J0'로 명명되며, 상기 서열번호 2의 염기서열로 이루어진 프로모터는 'J1'로 명명된다.
본 명세서에서 용어 "프로모터(promoter)"는 RNA 중합효소가 결합하여 이와 작동 가능하게 연결되어 있는 유전자의 전사를 개시하도록 하는 DNA 영역을 의미한다. 상기 프로모터 서열은 통상의 기술자에 의해 동일 또는 유사한 활성을 갖는 범위에서 변형될 수 있다. 따라서, 상기 서열번호 1 및 2의 각 염기서열과 예를 들면, 70% 이상, 80% 이상, 90% 이상, 95% 이상 또는 99% 이상의 서열 상동성을 갖는 프로모터 및 서열번호 1 및 2의 각 염기서열 중 프로모터 활성을 갖는 서열, 예를 들면, 예측된 전사 개시점 및 -10 영역의 서열을 포함하는 단편(이하 "변이체")이 본 발명의 범위 내에 포함될 수 있다.
본 명세서에서 용어, "상동성"은 두 개의 폴리뉴클레오티드 또는 폴리펩티드 모이어티(moiety) 사이의 동일성의 퍼센트를 말한다. 하나의 모이어티로부터 다른 하나의 모이어티까지의 서열 간 상동성은 알려진 당해 기술에 의해 결정될 수 있다. 예를 들면, 상동성은 서열 정보를 정렬하고 용이하게 입수 가능한 컴퓨터 프로그램을 이용하여 두 개의 폴리뉴클레오티드 분자 또는 두 개의 폴리펩티드 분자 간의 서열 정보, 예로는 점수(score), 동일성(identity) 및 유사도(similarity) 등의 매개 변수(parameter)를 직접 정렬하여 결정될 수 있다(예: BLAST 2.0). 또한, 폴리뉴클레오티드 간 상동성은 상동 영역 간의 안정된 이중가닥을 이루는 조건 하에서 폴리뉴클레오티드를 혼성화한 후, 단일-가닥-특이적 뉴클레아제로 분해시켜 분해된 단편의 크기를 결정함으로써 결정할 수 있다.
본 발명에 있어서, 상기 2종의 프로모터는 코리네박테리움 글루타미쿰에서 유래된 신규 합성 프로모터로, 상기 2종의 프로모터 서열은 코리네박테리움 글루타미쿰 전체 게놈의 일부와 매치될 수 있으나, 해당 서열의 강한 프로모터 활성은 본 발명에서 처음으로 확인된 것이다.
본 발명의 제2 측면은 전술한 2종의 프로모터를 각각 포함하는 코리네박테리움 글루타미쿰 신균주 2종에 관한 것이다.
구체적으로, 상기 코리네박테리움 글루타미쿰 신균주 2종은 서열번호 1의 염기서열을 포함하는 프로모터를 포함하는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 균주 13g(수탁번호 KCTC 15895BP)와 서열번호 2의 염기서열을 포함하는 프로모터를 포함하는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 균주 13gp2(수탁번호 KCTC 15896BP)일 수 있다.
보다 상세하게는, 상기 코리네박테리움 글루타미쿰 균주 13g는 (i) 서열번호 1의 염기서열을 포함하는 프로모터, 및 (ii) 글리세롤 퍼실레이터(glycerol facilitator), 글리세롤 키나제(glycerol kinase) 및 글리세롤-3-인산 디하이드로게나제(glycerol-3-phosphate dehydrogenase)를 코딩하는 유전자 클러스터인 glpFKD를 포함할 수 있다.
상기 글리세롤 퍼실레이터를 코딩하는 유전자(glpF), 글리세롤 키나제(glpK)를 코딩하는 유전자 및 글리세롤-3-인산 디하이드로게나제(glpD)를 코딩하는 유전자는 대장균(Escherichia coli) 유래, 특히 대장균 MG1655 유래일 수 있다.
상기 글리세롤 퍼실레이트의 아미노산 서열 및 상기 글리세롤 퍼실레이트를 코딩하는 유전자의 염기서열은 NCBI와 같은 공지된 데이터베이스에 공개되어 있다. 예를 들어, 글리세롤 퍼실레이트는 NCBI Reference Sequence: NP_418362.1의 아미노산 서열 또는 이의 일부를 포함하거나, 상기 아미노산 서열 또는 이의 일부로 이루어질 수 있고, 글리세롤 퍼실레이트를 코딩하는 유전자는 NCBI Reference Sequence: NP_418362.1의 아미노산 서열을 코딩하는 염기서열 또는 이의 일부를 포함하거나, 상기 염기서열 또는 이의 일부로 이루어질 수 있다.
상기 글리세롤 키나제의 아미노산 서열 및 상기 글리세롤 키나제를 코딩하는 유전자의 염기서열은 NCBI와 같은 공지된 데이터베이스에 공개되어 있다. 예를 들어, 글리세롤 키나제는 NCBI Reference Sequence: NP_418361.1의 아미노산 서열 또는 이의 일부를 포함하거나, 상기 아미노산 서열 또는 이의 일부로 이루어질 수 있고, 글리세롤 키나제를 코딩하는 유전자는 NCBI Reference Sequence: NP_418361.1의 아미노산 서열을 코딩하는 염기서열 또는 이의 일부를 포함하거나, 상기 염기서열 또는 이의 일부로 이루어질 수 있다.
상기 글리세롤-3-인산 디하이드로게나제의 아미노산 서열 및 상기 글리세롤-3-인산 디하이드로게나제를 코딩하는 유전자의 염기서열은 NCBI와 같은 공지된 데이터베이스에 공개되어 있다. 예를 들어, 글리세롤-3-인산 디하이드로게나제는 NCBI Reference Sequence: NP_417884.1의 아미노산 서열 또는 이의 일부를 포함하거나, 상기 아미노산 또는 이의 일부로 이루어질 수 있고, 글리세롤-3-인산 디하이드로게나제를 코딩하는 유전자는 NCBI Reference Sequence: NP_417884.1의 아미노산 서열을 코딩하는 염기서열 또는 이의 일부를 포함하거나, 상기 염기서열 또는 이의 일부로 이루어질 수 있다.
본 발명의 구체적인 일 실시예에 따르면, 상기 glpFKD는 서열번호 4의 염기서열 및 서열번호 5의 염기서열을 포함하거나, 이로 이루어진 것일 수 있다. 바람직하게는 상기 glpFKD는 서열번호 4의 염기서열 및 서열번호 5의 염기서열을 순차적으로 포함하거나, 이들 염기서열로 순차적으로 이루어진 것일 수 있다.
상기 코리네박테리움 글루타미쿰 균주 13gp2는 (i) 서열번호 2의 염기서열을 포함하는 프로모터, 및 (ii) 프로판디올 디하이드라타제 라지 서브유닛 PduC(propanediol dehydratase large subunit PduC), 프로판디올 디하이드라타제 미디움 서브유닛 PduD(propanediol dehydratase medium subunit PduD), 프로판디올 디하이드라타제 스몰 서브유닛 PduE(propanediol dehydratase small subunit PduE), 프로판디올 디하이드라타제 리액티바제 알파 서브유닛 PduG(propanediol dehydratase reactivase alpha subunit PduG) 및 프로판디올 디하이드라타제 리액티바제 베타 서브유닛 PduH(propanediol　dehydratase　reactivase beta subunit　PduH)를 코딩하는 유전자 클러스터인 pduCDEGH를 포함할 수 있다.
상기 프로판디올 디하이드라타제 라지 서브유닛 PduC(propanediol dehydratase large subunit PduC), 프로판디올 디하이드라타제 미디움 서브유닛 PduD(propanediol dehydratase medium subunit PduD), 프로판디올 디하이드라타제 스몰 서브유닛 PduE(propanediol dehydratase small subunit PduE), 프로판디올 디하이드라타제 리액티바제 알파 서브유닛 PduG(propanediol dehydratase reactivase alpha subunit PduG) 및 프로판디올 디하이드라타제 리액티바제 베타 서브유닛 PduH(propanediol　dehydratase　reactivase beta subunit　PduH)를 코딩하는 유전자를 코딩하는 유전자(PduH)는 클렙시엘라 뉴모니에(Klebsiella pneumonia), 특히 클렙시엘라 뉴모니에 KCTC 2952 유래일 수 있다.
상기 프로판디올 디하이드라타제 라지 서브유닛 PduC의 아미노산 서열 및 상기 프로판디올 디하이드라타제 라지 서브유닛 PduC를 코딩하는 유전자의 염기서열은 NCBI와 같은 공지된 데이터베이스에 공개되어 있다. 예를 들어, 프로판디올 디하이드라타제 라지 서브유닛 PduC는 NCBI Reference Sequence: WP_002915744.1의 아미노산 서열 또는 이의 일부를 포함하거나, 상기 아미노산 서열 또는 이의 일부로 이루어질 수 있고, 프로판디올 디하이드라타제 라지 서브유닛 PduC를 코딩하는 유전자는 NCBI Reference Sequence: WP_002915744.1의 아미노산 서열을 코딩하는 염기서열 또는 이의 일부를 포함하거나, 상기 염기서열 또는 이의 일부로 이루어질 수 있다.
상기 프로판디올 디하이드라타제 미디움 서브유닛 PduD의 아미노산 서열 및 상기 프로판디올 디하이드라타제 미디움 서브유닛 PduD를 코딩하는 유전자의 염기서열은 NCBI와 같은 공지된 데이터베이스에 공개되어 있다. 예를 들어, 프로판디올 디하이드라타제 미디움 서브유닛 PduD는 NCBI Reference Sequence: WP_016161755.1의 아미노산 서열 또는 이의 일부를 포함하거나, 상기 아미노산 서열 또는 이의 일부로 이루어질 수 있고, 프로판디올 디하이드라타제 미디움 서브유닛 PduD를 코딩하는 유전자는 NCBI Reference Sequence: WP_016161755.1의 아미노산 서열을 코딩하는 염기서열 또는 이의 일부를 포함하거나, 상기 염기서열 또는 이의 일부로 이루어질 수 있다.
상기 프로판디올 디하이드라타제 스몰 서브유닛 PduE의 아미노산 서열 및 상기 프로판디올 디하이드라타제 스몰 서브유닛 PduE를 코딩하는 유전자의 염기서열은 NCBI와 같은 공지된 데이터베이스에 공개되어 있다. 예를 들어, 프로판디올 디하이드라타제 스몰 서브유닛 PduE는 NCBI Reference Sequence: WP_004133648.1의 아미노산 서열 또는 이의 일부를 포함하거나, 상기 아미노산 서열 또는 이의 일부로 이루어질 수 있고, 프로판디올 디하이드라타제 스몰 서브유닛 PduE를 코딩하는 유전자는 NCBI Reference Sequence: WP_004133648.1의 아미노산 서열을 코딩하는 염기서열 또는 이의 일부를 포함하거나, 상기 염기서열 또는 이의 일부로 이루어질 수 있다.
상기 프로판디올 디하이드라타제 리액티바제 알파 서브유닛 PduG의 아미노산 서열 및 상기 프로판디올 디하이드라타제 리액티바제 알파 서브유닛 PduG를 코딩하는 유전자의 염기서열은 NCBI와 같은 공지된 데이터베이스에 공개되어 있다. 예를 들어, 프로판디올 디하이드라타제 리액티바제 알파 서브유닛 PduG는 NCBI Reference Sequence: WP_014226638.1의 아미노산 서열 또는 이의 일부를 포함하거나, 상기 아미노산 서열 또는 이의 일부로 이루어질 수 있고, 프로판디올 디하이드라타제 리액티바제 알파 서브유닛 PduG를 코딩하는 유전자는 NCBI Reference Sequence: WP_014226638.1의 아미노산 서열을 코딩하는 염기서열 또는 이의 일부를 포함하거나, 상기 염기서열 또는 이의 일부로 이루어질 수 있다.
상기 프로판디올 디하이드라타제 리액티바제 베타 서브유닛 PduH의 아미노산 서열 및 상기 프로판디올 디하이드라타제 리액티바제 베타 서브유닛 PduH를 코딩하는 유전자의 염기서열은 NCBI와 같은 공지된 데이터베이스에 공개되어 있다. 예를 들어, 프로판디올 디하이드라타제 리액티바제 베타 서브유닛 PduH는 NCBI Reference Sequence: WP_004205479.1의 아미노산 서열 또는 이의 일부를 포함하거나, 상기 아미노산 서열 또는 이의 일부로 이루어질 수 있고, 프로판디올 디하이드라타제 리액티바제 베타 서브유닛 PduH를 코딩하는 유전자는 NCBI Reference Sequence: WP_004205479.1의 아미노산 서열을 코딩하는 염기서열 또는 이의 일부를 포함하거나, 상기 염기서열 또는 이의 일부로 이루어질 수 있다.
본 발명의 구체적인 일 실시예에 따르면, 상기 pduCDEGH는 서열번호 6의 염기서열을 포함하거나, 이로 이루어진 것일 수 있다.
본 발명에 따른 2종의 프로모터는 각각 벡터에 삽입되어 그람 양성균, 특히 코리네박테리움 속 미생물에서 목적 단백질 또는 목적 산물을 대량 생산하기 위한 용도로 사용될 수 있다.
따라서, 본 발명의 제3 측면은 전술한 2종의 각 프로모터를 포함하는 벡터 및 상기 벡터로 형질전환된 숙주 세포에 관한 것이다.
본 명세서에서 용어 "벡터"는 적합한 숙주 내에서 목적 유전자를 발현시킬 수 있도록 유전 물질을 보유하는 인위적 DNA 분자로, 구체적으로 적합한 조절 서열에 작동 가능하게 연결된 유전자의 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있으나, 이에 제한되지 않는다. 본 발명의 목적 상 상기 프로모터는 J0 또는 J1 프로모터일 수 있다.
본 발명에서 사용되는 벡터는 숙주 세포 내에서 복제 가능한 것이면 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, λMBL3, λMBL4, λⅨII, λASHII, λAPII, λt10, λt11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 본 발명에서 사용 가능한 벡터는 특별히 제한되는 것이 아니며 공지된 발현 벡터를 사용할 수 있다. 그 예로 pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pCES208 벡터 등을 사용할 수 있으나, 이에 제한되지 않는다.
또한, 숙주 세포 내 염색체 삽입용 벡터를 통해 염색체 내에 내재적 프로모터를 본 발명의 프로모터 활성을 갖는 핵산 분자로 교체시킬 수 있다. 상기 핵산 분자의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동 재조합에 의하여 이루어질 수 있다. 본 발명의 벡터는 상동 재조합을 일으켜서 염색체 내로 삽입될 수 있으므로, 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다.
선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
따라서, 본 발명의 상기 서열번호 1 또는 2의 염기서열을 포함하거나, 이로 이루어진 프로모터의 활성을 갖는 핵산 분자에 목적 유전자가 작동 가능하게 연결되지 않은 벡터일 경우에도, 숙주 세포, 그 예로 코리네박테리움 속 미생물 내의 내재적 프로모터와 상동 재조합에 의해 교체될 수 있다. 이에 의해 코리네박테리움 속 미생물의 내재적 유전자를 과발현시킴으로써, 해당 유전자의 활성을 내재적 활성에 비해 강화되도록 변형시킬 수 있다.
본 명세서에서 사용되는 용어 "내재적 활성"이란, 본래 미생물이 변형되지 않은 상태에서 가지고 있는 효소의 활성 상태를 의미하고, "내재적 활성에 비해 강화되도록 변형"된다는 의미는 변형 전 상태의 효소 활성과 비교할 때 당해 활성이 신규로 도입되거나 더 향상된 것을 의미한다.
본 명세서에서 "효소 활성의 강화"란, 내재적 유전자 활성의 증가, 내부 또는 외부 요인으로부터 내재적 유전자 증폭, 상기 유전자 발현의 억제 조절 인자의 결실, 유전자 카피수 증가, 외부로부터의 유전자 도입, 발현 조절 서열의 변형, 특히 프로모터 교체 또는 변형 및 유전자 내 돌연변이에 의한 효소 활성의 증가 등에 의해 그 활성이 증가되는 것을 포함한다.
본 명세서에서 "내재적 활성에 비하여 강화되도록 변형"되었다는 것은, 상기 유전자 발현의 억제 조절 인자의 결실 또는 발현 조절 서열의 변형, 예를 들어 개량된 프로모터의 사용 등과 같은 조작이 이루어지기 전의 미생물이 가지는 활성에 비하여 조작이 이루어진 이후의 미생물이 가지고 있는 활성이 증가된 상태를 의미한다.
본 명세서에서 "과발현"이란 보통 상태에서 세포 내 해당 유전자가 발현되는 수준보다 높은 수준의 발현을 일컫는 것으로, 게놈 상에 존재하는 유전자의 프로모터를 강력한 프로모터로 치환하거나, 발현 벡터에 해당 유전자를 클로닝하여 세포에 형질전환시키는 방법을 통해 발현량을 증가시키는 것 등을 포함하는 개념이다.
본 발명에 있어서, 상기 프로모터에는 목적 단백질을 코딩하는 유전자가 작동 가능하게 연결될 수 있다. 바람직하게는 상기 프로모터 또는 이의 변이체의 다운스트림(downstream)에 목적 유전자가 작동 가능하게 연결될 수 있다. 용어 "작동 가능하게 연결되어 있는(perably linked)"은 발현이 필요한 유전자와 이의 조절 서열이 서로 기능적으로 결합되어 유전자 발현을 가능케 하는 방식으로 연결되어 있는 것을 의미한다.
본 명세서에서 용어 "목적 단백질" 또는 "목적 산물"은 숙주 세포 또는 미생물에서 과발현시키거나 대량으로 생산하고자 하는 단백질 또는 산물을 의미한다. 구체적으로, 그람 양성균, 보다 바람직하게는 코리네박테리움 속 미생물 내에서 과발현시키거나, 대량으로 생산하고자 하는 단백질 또는 산물이라면 제한없이 포함할 수 있다.
예를 들어, 본 발명의 벡터는 정량화할 수 있는 단백질을 코딩하는 유전자(이하, '리포터 유전자'라 함)가 발현되도록 프로모터의 다운스트림에 연결시켜 프로모터 활성 정도를 측정할 수도 있다. 리포터 유전자로는 녹색 형광단백질(Green Fluorescent Protein, GFP)을 이용하는 것이 바람직하나, 이에 제한되는 것은 아니다.
따라서, 본 발명에 따른 J0 프로모터 또는 J1 프로모터에 작동 가능하게 연결된 목적 단백질을 코딩하는 유전자의 발현량은 하기 서열번호 3의 염기서열을 포함하는 H36 프로모터와 작동 가능하게 연결된 동일 목적 유전자의 발현량보다 높을 수 있다. 예를 들어, 목적 단백질을 코딩하는 유전자의 발현량은 H36 프로모터와 작동 가능하게 연결된 경우보다 약 1.5배, 약 2배 또는 약 3배 더 높을 수 있다.
ggtacctcta tctggtgccc taaacggggg aatattaacg ggcccagggt ggtcgcacct tggttggtag gagtagcatg ggatcc (서열번호 3)
본 발명의 구체적인 일 실시예에서는, 코리네박테리움 WT bioD::sfGFP 균주를 이용하여, 본 발명의 J0 프로모터 및 J1 프로모터의 유전자 발현능을 비교 평가하였다. WT bioD::sfGFP 균주는 야생형 코리네박테리움 균주의 유전자 bioD 위치에 합성프로모터 H36로 형광 단백질 sfGFP를 발현시키는 서열이 삽입 되어있는 균주이다. 발현능 비교 결과, 도 3에 나타난 바와 같이 신규 합성 프로모터인 J0 및 J1 프로모터를 포함하는 코리네박테리움 글루타미쿰 균주가 기존 합성 프로모터인 H36 프로모터를 포함하는 코리네박테리움 글루타미쿰 균주 보다 월등히 높은 형광을 나타내어 목적 유전자의 발현능이 현저히 개선되었음을 확인하였다.
본 발명에 따른 숙주 세포는 전술한 벡터로 형질전환된 형질전환체이다.
본 발명에서 용어 "형질전환"은 목적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주 세포 내에 도입하여 숙주 세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주 세포 내에 발현될 수 있기만 한다면, 숙주 세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함한다. 또한, 상기 폴리뉴클레오티드는 목적 단백질을 코딩하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주 세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는, 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주 세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함한다. 본 발명의 목적상 상기 프로모터는 본 발명에 따른 서열번호 1 또는 서열번호 2의 염기서열을 포함하거나 이로 이루어진 프로모터의 활성을 갖는 핵산 분자를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주 세포에 도입되어, 숙주 세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있다.
본 발명의 벡터를 형질전환시키는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주 세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법(electroporation), 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2) 침전, 미세주입법(microinjection), 폴리에틸렌글리콜(PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
상기 숙주 세포로는 DNA의 도입 효율이 높고, 도입된 DNA의 발현 효율이 높은 숙주를 사용하는 것이 좋은데, 원핵 및 진핵을 포함한 모든 미생물을 사용 가능하다. 예를 들어, 상기 숙주 세포는 리조비움(Rhizobium), 비피도박테리움(Bifidobacterium), 로도코커스(Rhodococcus), 칸디다(Candida), 에르위니아(Erwinia), 엔테로박터(Enterobacter), 파스테렐라(Pasteurella), 멘하이미아(Mannheimia), 액티노바실러스(Actinobacillus), 아그레가티박터(Aggregatibacter), 잔토모나스(Xanthomonas), 비브리오(Vibrio), 슈도모나스(Pseudomonas), 아조토박터(Azotobacter), 애시네토박터(Acinetobacter), 랄스토니아(Ralstonia), 아그로박테리움(Agrobacterium), 로도박터(Rhodobacter), 자이모모나스(Zymomonas), 바실러스(Bacillus), 스테필로코커스(Staphylococcus), 락토코커스(Lactococcus), 스트렙토코커스(Streptococcus), 락토바실러스(Lactobacillus), 클로스트리디움(Clostridium), 코리네박테리움(Corynebacterium), 스트렙토마이세스(Streptomyces) 또는 사이클로박테리움(Cyclobacterium) 유래일 수 있다. 바람직하게는 상기 숙주 세포는 그람 양성균 유래일 수 있다. 예를 들어, 상기 그람 양성균은 코리네박테리움(Corynebacterium), 비피도박테리움(Bifidobacterium), 로도코커스(Rhodococcus), 칸디다(Candida), 바실러스(Bacillus), 스테필로코커스(Staphylococcus), 락토코커스(Lactococcus), 스트렙토코커스(Streptococcus), 락토바실러스(Lactobacillus), 클로스트리디움(Clostridium), 스트렙토마이세스(Streptomyces) 또는 비피도박테리움(Bifidobacterium)일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 구체적인 일 실시예에 따른 상기 숙주 세포는 코리네박테리움 글루타미쿰 유래일 수 있고, 보다 바람직하게는 코리네박테리움 글루타미쿰 ATCC 13032일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 따른 프로모터를 포함하는 벡터로 형질전환된 숙주 세포는 기존 프로모터에 비해 목적 단백질을 코딩하는 유전자를 과발현시킬 수 있어, 목적 단백질 또는 목적 산물을 대량 생산하는데 유용하다.
따라서, 본 발명의 제4 측면은 전술한 숙주 세포를 배양하여 목적 단백질을 생산하는 단계를 포함하는, 목적 단백질의 제조방법에 관한 것이다.
본 발명에서 용어 "배양"은 숙주 세포를 적당히 인공적으로 조절한 환경조건에서 생육시키는 것을 의미한다. 본 발명에서 그람 양성균, 예를 들어 코리네박테리움 속 유래의 숙주 세포를 이용하여 목적 산물을 제조하는 방법은 당업계에 널리 알려져 있는 방법을 이용하여 수행할 수 있다. 구체적으로, 상기 배양은 배치 공정, 주입 배치 또는 반복 주입 배치 공정(fed batch or repeated fed batch process)에서 연속식으로 배양할 수 있으나, 이에 제한되는 것은 아니다.
배양에 사용되는 배지는 적절한 방식으로 특정 균주의 요건을 충족해야 한다. 전술한 그람 양성균, 특히 코리네박테리움 속 균주에 대한 배양 배지는 공지되어 있다(예를 들면, Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981). 사용될 수 있는 당원으로는 글루코스(glucose), 수크로스(sucrose), 락토스(lactose), 프럭토스(fructose), 말토스(maltose), 전분(starch), 셀룰로스(cellulose)와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 글루콘산, 아세트산, 피루브산과 같은 유기산이 포함될 수 있으나, 이에 제한되는 것은 아니다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있다. 사용될 수 있는 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산 암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산 암모늄이 포함될 수 있으나, 이에 제한되는 것은 아니다. 질소원 또한 개별적으로 또는 혼합물로서 사용할 수 있다. 사용될 수 있는 인원(phosphorus source)으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염이 포함될 수 있으나, 이에 제한되는 것은 아니다. 또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있다. 마지막으로, 상기 물질에 더하여 아미노산 및 비타민과 같은 필수 성장 물질이 사용될 수 있다. 또한, 배양 배지에 적절한 전구체들이 사용될 수 있다. 상기된 원료들은 배양과정에서 배양물에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있다. 이러한 다양한 배양 방법은 예를 들어 문헌 ("Biochemical Engineering" by James M. Lee, Prentice-Hall International Editions, pp 138-176)에 개시되어 있다.
수산화나트륨, 수산화칼륨, 암모니아와 같은 기초 화합물 또는 인산 또는 황산과 같은 산 화합물을 적절한 방식으로 사용하여 배양물의 pH를 조절할 수 있다. 또한, 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 호기 상태를 유지하기 위해 배양물 내로 산소 또는 산소-함유 기체(예를 들어, 공기)를 주입할 수 있다. 배양물의 온도는 보통 20℃ 내지 45℃, 바람직하게는 25℃ 내지 40℃일 수 있으나, 조건에 따라 변경이 가능하나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 목적 단백질의 제조방법은 상기 생산된 목적 단백질을 회수하는 단계를 추가로 포함할 수 있다. 숙주 세포 또는 이의 배양물로부터 목적 단백질을 회수하는 방법은 당업계에 알려진 방법, 예컨대 원심분리, 여과, 음 이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있으나, 이들 예에 한정되는 것은 아니다.
상기 회수 단계는 정제 공정을 포함할 수 있으며, 당업자는 공지된 여러 정제 공정 중 필요에 따라 선택하여 활용할 수 있다.
이하, 본 발명을 실시예를 통해 보다 상세하게 설명한다. 단, 본 발명은 다양한 변경을 가할 수 있고 여러 가지 형태를 가질 수 있는바, 이하에서 기술하는 특정 실시예 및 설명은 본 발명의 이해를 돕기 위한 것일 뿐, 본 발 명을 특정한 개시 형태에 대해 한정하려는 것이 아니다. 본 발명의 범위는 본 발명의 사상 및 기술 범위에 포함되는 모든 변경, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다.
[실시예 1]
신규 합성 프로모터의 제작
코리네박테리움 속에서 목적 유전자를 과발현시킬 수 있는 합성 프로모터를 개발하고자 한 결과, 합성 프로모터로 표 1의 서열번호 1의 염기서열과 서열번호 2의 염기서열로 이루어진 2종의 프로모터를 합성한 후, 이를 각각 'J0' 및 'J1'으로 명명하였다.
상기 2종의 프로모터는 글리세롤을 단일 탄소으로 사용하여 성장할 수 있는 변이 코리네박테리움 균주의 제작 시 삽입된 프로모터 H36에 변이가 나타난 것으로 확인되어 발굴된 것이다. 상기 변이 코리네박테리움 균주의 제작 방법은 대한민국 공개특허 제10-2019-0087091호에 개시되어 있으며, 제작 방법을 간략히 설명하면 다음과 같다. 야생형 코리네박테리움 글루타미쿰 ATCC 13032의 게놈 상에 유전자 glpFKD를 삽입한 후 실험실 적응 진화(adaptive laboratory evolution)를 통해 변이 균주를 선별하고, 선별된 균주를 '13g'로 명명하였다. glpFK 유전자 절편과 glpD 유전자 절편의 서열은 하기 표 1의 서열번호 4 및 5와 같다. 선별된 균주 '13g'는 2024년 04월 26일자로 한국생명공학연구원 생물자원센터 유전자은행(KCTC)에 기탁하여 수탁번호 KCTC 15895BP를 부여받았다.
더 나아가, 13g의 게놈 상에 J1 프로모터로 유전자 pduCDEGH를 발현하는 서열을 삽입하고자 하였다. 우선 상기 균주에 J1 프로모터와 pduCDEGH 유전자를 삽입하기 위하여, 서열번호 7과 서열번호 8의 프라이머를 사용하여 J1 프로모터를, 서열번호 9와 서열번호 10의 프라이머를 사용하여 pduCDEGH 유전자를 증폭하였다. pduCDEGH 유전자 절편의 서열은 하기 표 1의 서열번호 6과 같다. 또한, 상동성 암(homologous arm)이 되는 업스트림(왼쪽 암)을 서열번호 11과 서열번호 12의 프라이머를 사용하여 13g 유전체에서 증폭하였고, 다운스트림(오른쪽 암)을 서열번호 13과 서열번호 14의 프라이머를 사용하여 13g 유전체에서 증폭하였다. 그리고 이 4가지 증폭된 서열은 서열번호 11과 서열번호 14의 프라이머를 사용하여 오버랩핑 PCR을 수행하고, BamHI과 PstI으로 절단된 pK19mob-sacB(Park, S.H. et al., Nat. Commun 5, 4618, 2014)에 깁슨 어셈블리(Gibson assembly) 방법으로 삽입하여 최종 벡터 'pK19-msb-J1-pduCDEGH'를 제작하였다. 13g 균주에 'pK19-msb-J1-pduCDEGH'를 보고된 방법(Park, S.H. et al., Nat. Commun 5, 4618, 2014)으로 J1 프로모터와 pduCDEGH 유전자를 삽입하여 균주를 제작하였고, 이를 '13gp2'로 명명하였다. 균주 '13gp2'는 2024년 04월 26일자로 한국생명공학연구원 생물자원센터 유전자은행(KCTC)에 기탁하여 수탁번호 KCTC 15896BP를 부여받았다.
[표 1]
[실시예 2]
GFP 발현을 통한 신규 합성 프로모터 J0 및 J1의 활성 분석
상기 실시예 1에서 제조한 신규 합성 프로모터인 'J0' 및 'J1' 프로모터의 게놈 상 발현능을 확인하기 위해, 양성 대조군으로 기존에 코리네박테리움 속 미생물에서 작동하는 것으로 공지된 합성 프로모터 H36(대한민국 공개특허 제10-2014-0110134호, 서열번호 3)를 포함하는 균주와 비교 평가하였다.
코리네박테리움 WT bioD::sfGFP 균주는 야생형 코리네박테리움 균주(ATCC 13032)의 유전자 bioD 위치에 합성 프로모터 H36으로 형광 단백질 sfGFP(super-folder green fluorescent protein)를 발현시키는 서열이 삽입되어 있는 균주다. 우선 상기 균주에서 프로모터를 각각 J0 프로모터(서열번호 1) 및 J1 프로모터(서열번호 2)로 교체하기 위해서 서열번호 15와 서열번호 17의 프라이머를 사용하여 J0 프로모터를, 서열번호 16과 서열번호 17로 개량된 코리네박테리움 '13g' 균주 유전체에서 증폭하였다. 또한, 상동성 암(homologous arm)이 되는 업스트림(왼쪽 암)을 서열번호 18과 서열번호 19의 프라이머를 사용하여 WT bioD::sfGFP 유전체에서 증폭하였고, 다운스트림(오른쪽 암)을 서열번호 20과 서열번호 21의 프라이머를 사용하여 WT bioD::sfGFP 유전체에서 증폭하였다. 그리고 이 3가지 증폭된 서열은 서열번호 18과 서열번호 21의 프라이머를 사용하여 오버랩핑 PCR을 수행하고, BamHI과 PstI으로 절단된 pK19mob-sacB(Park, S.H. et al., Nat. Commun 5, 4618, 2014)에 깁슨 어셈블리(Gibson assembly) 방법으로 삽입하여 최종 벡터 'pK19-msb-H36-sfGFP-tnp1' 및 'pK19-msb-H36-sfGFP-tnp2'를 제작하였다.
WT bioD::sfGFP 균주에 'pK19-msb-H36-sfGFP-tnp1' 및 'pK19-msb- H36-sfGFP-tnp2'를 보고된 방법(Park, S.H. et al., Nat. Commun 5, 4618, 2014)으로 J0 및 J1 프로모터를 삽입시켜 각 프로모터를 포함하는 균주를 제작하였다.
[표 2]
상기 프로모터가 도입된 코리네박테리움 글루타미쿰을 BHIS[조성: 37 g/L 뇌심장침출(Brain Heart Infusion, BHI), 91 g/L 소르비톨] 배지에 접종하여, 24 시간 동안 30 ℃, 200 rpm에서 배양한 후, 신선한 BHI 배지에 1/100의 부피만큼 옮기고, 동일 조건에서 24 시간 동안 배양하였다. 각각의 코리네박테리움 글루타미쿰 균주 배양액을 6000 rpm으로 5 분간 원심분리하여 균체를 수득하고, PBS에 현탁하여 GFP의 발현량을 확인하기 위해 형광세기 분석을 수행하였다.
그 결과, 도 3에서 확인되는 바와 같이, 신규 합성 프로모터인 J0 및 J1 프로모터를 포함하는 코리네박테리움 글루타미쿰 균주가 기존 합성 프로모터인 H36 프로모터를 포함하는 코리네박테리움 글루타미쿰 균주 보다 월등히 높은 형광을 나타내었다. 이와 같은 결과는 본 발명의 2종의 프로모터가 코리네박테리움 속 미생물에서 과발현 프로모터로 유용하게 이용할 수 있음을 시사하는 것이다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
[수탁번호]
기탁기관명 : 한국생명공학연구원 생물자원센터(KCTC)
수탁번호 : KCTC15895BP
수탁일자 : 20240426
기탁기관명 : 한국생명공학연구원 생물자원센터(KCTC)
수탁번호 : KCTC15896BP
수탁일자 : 20240426

Claims (11)

  1. 서열번호 1 또는 서열번호 2의 염기서열을 포함하는 프로모터.
  2. 제1항의 프로모터를 포함하는 벡터.
  3. 제2항에 있어서, 상기 프로모터에 목적 단백질을 코딩하는 유전자가 작동 가능하게 연결되어 있는, 벡터.
  4. 제3항에 있어서, 상기 목적 단백질을 코딩하는 유전자의 발현량은 서열번호 3의 염기서열을 포함하는 H36 프로모터와 작동 가능하게 연결된 경우보다 높은 것인, 벡터.
  5. 서열번호 1의 염기서열을 포함하는 프로모터, 및 글리세롤 퍼실레이터(glycerol facilitator), 글리세롤 키나제(glycerol kinase) 및 글리세롤-3-인산 디하이드로게나제(glycerol-3-phosphate dehydrogenase)를 코딩하는 유전자 클러스터인 glpFKD를 포함하는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 균주 13g(수탁번호 KCTC 15895BP).
  6. 서열번호 2의 염기서열을 포함하는 프로모터, 및 프로판디올 디하이드라타제 라지 서브유닛 PduC(propanediol dehydratase large subunit PduC), 프로판디올 디하이드라타제 미디움 서브유닛 PduD(propanediol dehydratase medium subunit PduD), 프로판디올 디하이드라타제 스몰 서브유닛 PduE(propanediol dehydratase small subunit PduE), 프로판디올 디하이드라타제 리액티바제 알파 서브유닛 PduG(propanediol dehydratase reactivase alpha subunit PduG) 및 프로판디올 디하이드라타제 리액티바제 베타 서브유닛 PduH(propanediol　dehydratase　reactivase beta subunit　PduH)를 코딩하는 유전자 클러스터인 pduCDEGH를 포함하는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 균주 13gp2(수탁번호 KCTC 15896BP).
  7. 제2항 또는 제3항의 벡터로 형질전환된 숙주 세포.
  8. 제7항에 있어서, 상기 숙주 세포는 그람 양성균 유래인, 숙주 세포.
  9. 제8항에 있어서, 상기 그람 양성균은 코리네박테리움(Corynebacterium), 비피도박테리움(Bifidobacterium), 로도코커스(Rhodococcus), 칸디다(Candida), 바실러스(Bacillus), 스테필로코커스(Staphylococcus), 락토코커스(Lactococcus), 스트렙토코커스(Streptococcus), 락토바실러스(Lactobacillus), 클로스트리디움(Clostridium), 스트렙토마이세스(Streptomyces) 또는 비피도박테리움(Bifidobacterium)인, 숙주 세포.
  10. 제7항의 숙주 세포를 배양하여 목적 단백질을 생산하는 단계를 포함하는, 목적 단백질의 제조방법.
  11. 제10항에 있어서, 상기 생산된 목적 단백질을 회수하는 단계를 추가로 포함하는, 목적 단백질의 제조방법.
PCT/KR2025/009536 2024-07-03 2025-07-03 코리네박테리움 속 균주 유래의 신규 합성 프로모터 Pending WO2026010404A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2024-0087809 2024-07-03
KR1020240087809A KR20260006131A (ko) 2024-07-03 2024-07-03 코리네박테리움 속 균주 유래의 신규 합성 프로모터

Publications (1)

Publication Number Publication Date
WO2026010404A1 true WO2026010404A1 (ko) 2026-01-08

Family

ID=98318795

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2025/009536 Pending WO2026010404A1 (ko) 2024-07-03 2025-07-03 코리네박테리움 속 균주 유래의 신규 합성 프로모터

Country Status (2)

Country Link
KR (1) KR20260006131A (ko)
WO (1) WO2026010404A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080074286A (ko) * 2007-02-08 2008-08-13 씨제이제일제당 (주) 신규한 프로모터 및 이의 용도
CN113493785A (zh) * 2020-04-07 2021-10-12 江南大学 一种适用于谷氨酸棒杆菌的高强度启动子及应用

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101481142B1 (ko) 2013-03-04 2015-01-15 한국과학기술원 코리네박테리아 발현용 합성프로모터

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080074286A (ko) * 2007-02-08 2008-08-13 씨제이제일제당 (주) 신규한 프로모터 및 이의 용도
CN113493785A (zh) * 2020-04-07 2021-10-12 江南大学 一种适用于谷氨酸棒杆菌的高强度启动子及应用

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HENKE NADJA A., KRAHN IRENE, WENDISCH VOLKER F.: "Improved Plasmid-Based Inducible and Constitutive Gene Expression in Corynebacterium glutamicum", MICROORGANISMS, MDPI AG, SWITZERLAND, vol. 9, no. 1, Switzerland, pages 204 - 204-2, XP093386444, ISSN: 2076-2607, DOI: 10.3390/microorganisms9010204 *
LIU XIUXIA, SUN MANMAN, GAO ALEX XIONG, LEDESMA-AMARO RODRIGO, FANG QIUWU, YANG YANKUN, BAI ZHONGHU: "Leaderless Bicistronic Design for Precise and Reliable Control of Gene Expression in <i>Corynebacterium Glutamicum</i>", ACS SYNTHETIC BIOLOGY, AMERICAN CHEMICAL SOCIETY, WASHINGTON DC ,USA, vol. 12, no. 7, 21 July 2023 (2023-07-21), Washington DC ,USA , pages 2157 - 2167, XP093386373, ISSN: 2161-5063, DOI: 10.1021/acssynbio.3c00246 *
SUNG SUN YIM; SEUL JI AN; MISUK KANG; JINHO LEE; KI JUN JEONG: "Isolation of fully synthetic promoters for high‐level gene expression in Corynebacterium glutamicum", BIOTECHNOLOGY AND BIOENGINEERING, JOHN WILEY, HOBOKEN, USA, vol. 110, no. 11, 3 June 2013 (2013-06-03), Hoboken, USA, pages 2959 - 2969, XP071145940, ISSN: 0006-3592, DOI: 10.1002/bit.24954 *

Also Published As

Publication number Publication date
KR20260006131A (ko) 2026-01-13

Similar Documents

Publication Publication Date Title
CN107099469A (zh) 编码生物膜形成抑制蛋白质的基因和使用具有失活基因的细菌菌株生产l‑赖氨酸的方法
WO2013162274A1 (ko) 신규한 ｄ형 젖산 생산균주 및 그의 용도
WO2010093182A2 (ko) Ｌ-아미노산 생산용 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
WO2015163718A1 (ko) 퓨트레신 생산 변이주 및 이를 이용한 퓨트레신 생산방법
WO2022124671A1 (ko) 쉬와넬라 오네이덴시스 유래 단백질을 발현하는 미생물, 및 이를 이용한 l-아미노산 생산 방법
WO2021112469A1 (ko) 신규한 분지쇄 아미노산 아미노트랜스퍼라제 변이체 및 이를 이용한 류신 생산방법
WO2022215796A1 (ko) 신규한 전사 조절자 변이체 및 이를 이용한 l-발린 생산 방법
WO2015122569A1 (ko) L-쓰레오닌 생산능을 가지는 재조합 에스케리키아 속 미생물 및 이를 이용한 l-쓰레오닌의 생산방법
WO2014126384A1 (ko) L-쓰레오닌 생산능을 가지는 재조합 에스케리키아 속 미생물 및 이를 이용한 l-쓰레오닌의 생산방법
WO2023136421A1 (ko) L-히스티딘 생산능이 향상된 에스케리치아 속 변이주 및 이를 이용한 l-히스티딘의 생산 방법
WO2022139523A1 (ko) L-히스티딘 배출 단백질 및 이를 이용한 l-히스티딘 생산 방법
WO2022191357A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022163922A1 (ko) 신규한 아스파라긴 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163917A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
KR20260006131A (ko) 코리네박테리움 속 균주 유래의 신규 합성 프로모터
WO2016159536A1 (ko) 신규 프로모터 및 이의 용도
WO2022124670A1 (ko) 쉬와넬라 아틀란티카 유래 단백질을 발현하는 미생물, 및 이를 이용한 l-아미노산 생산 방법
WO2022191358A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022225320A1 (ko) 신규한 포스포글리세린산 디하이드로게나제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022231049A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022154190A1 (ko) 신규한 포스포노아세테이트 하이드롤라제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022215800A1 (ko) 신규한 분지쇄아미노산 투과효소 변이체 및 이를 이용한 l-발린 생산 방법
KR20220149379A (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
KR102869884B1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022231054A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 25833648

Country of ref document: EP

Kind code of ref document: A1