WO2025009883A1 - 스키조키트리움 속 미세조류를 활용한 장어용 사료 및 이의 제조 방법 - Google Patents

스키조키트리움 속 미세조류를 활용한 장어용 사료 및 이의 제조 방법 Download PDF

Info

Publication number
WO2025009883A1
WO2025009883A1 PCT/KR2024/009391 KR2024009391W WO2025009883A1 WO 2025009883 A1 WO2025009883 A1 WO 2025009883A1 KR 2024009391 W KR2024009391 W KR 2024009391W WO 2025009883 A1 WO2025009883 A1 WO 2025009883A1
Authority
WO
WIPO (PCT)
Prior art keywords
eel
weight
microalgae
acid
feed
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2024/009391
Other languages
English (en)
French (fr)
Inventor
이영미
조국진
임유진
서상현
김지영
안준철
정병철
백성준
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CJ CheilJedang Corp
Original Assignee
CJ CheilJedang Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CJ CheilJedang Corp filed Critical CJ CheilJedang Corp
Priority to CN202480045443.4A priority Critical patent/CN121941418A/zh
Publication of WO2025009883A1 publication Critical patent/WO2025009883A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
    • A23K10/16—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K61/00—Culture of aquatic animals
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/20—Inorganic substances, e.g. oligoelements
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K50/00—Feeding-stuffs specially adapted for particular animals
    • A23K50/80—Feeding-stuffs specially adapted for particular animals for aquatic animals, e.g. fish, crustaceans or molluscs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/20—Natural extracts
    • A23V2250/202—Algae extracts
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
    • Y02P60/60—Fishing; Aquaculture; Aquafarming

Definitions

  • the present application relates to a feed composition for eel using microalgae of the genus Schizochytrium and a method for producing the same.
  • Feed utilization rate varies depending on the protein source, and fish meal is made by drying and powdering fish waste or fish scraps left after extracting fish oil from fish. It has been used as the main protein source for aquaculture feed for a long time due to its high protein content, excellent amino acid composition, and high palatability. However, recently, its production has decreased rapidly, so the supply has become unstable and the price has risend, accounting for the largest portion of the cost of purchasing feed raw materials. The catch and production of various bycatch fish used to make fish meal is rapidly decreasing due to overfishing and marine environmental problems, and it is predicted that its production will continue to decrease until 2030. For this reason, much research is being conducted to find an inexpensive and high-quality alternative protein source that can replace fish meal in aquaculture compound feed.
  • Patent Document 01 Republic of Korea Publication Patent No. 10-2011-0026232
  • the inventors of the present invention have made extensive research efforts to develop a fish farming feed using microalgae. As a result, they have completed the present invention by elucidating that a feed composition containing biomass derived from Schizochytrium sp. microalgae promotes the growth of eels.
  • the purpose of the present application is to provide a feed composition for eel comprising biomass derived from microalgae of the genus Schizochytrium sp.
  • Another object of the present application is to provide a method for cultivating eels, and/or a method for promoting the growth of eels, comprising a step of feeding eels a feed composition for eels containing biomass derived from the microalgae of the genus Schizochytrium described above.
  • the present application provides a feed composition for eel comprising a biomass derived from Schizochytrium sp. microalgae; and/or a use of the microalgae-derived biomass and/or the eel feed composition for promoting eel growth.
  • microalgae refers to organisms that are not easily visible to the naked eye among plants but can be seen through a microscope and live freely floating in water, and are also called phytoplankton. There are various types of microalgae, and even strains that are incapable of photosynthesis and grow only through heterotrophy.
  • microalgae may be used interchangeably with “strain” in this specification.
  • Schizochytrium sp is one of the generic names belonging to the family Thraustochytriaceae of the order Thraustochytriales, and may be used interchangeably with the term “genus Schizochytrium .”
  • microalgae of the genus Schizochytrium are microorganisms belonging to the family of Thraustochytriaceae, and may be at least one selected from the group consisting of Schizochytrium aggregatum , Schizochytrium limacinum , and Schizochytrium minutum , but are not limited thereto.
  • the microalgae in the genus Schizochytrium may be Schizochytrium limacinum.
  • the microalgae in the genus Schizochytrium may be Schizochytrium aggregatum.
  • the microalgae of the genus Schizochytrium may be Schizochytrium minutum.
  • the above-described Schizochytrium strain may be, but is not limited to, CD03-7004 strain (accession number KCTC15006BP).
  • the present inventors irradiated a wild-type Schizochytrium sp. CD01-5000 strain (accession number KCTC 14344BP) with gamma rays to induce a mutation, selected a strain among the mutant strains having the ability to produce antioxidant pigments, and named it Schizochytrium sp. CD03-7004. It was deposited with the Korean Collection for Type Cultures (KCTC), an international depository institution under the Budapest Treaty, on June 20, 2022, and was assigned the accession number KCTC15006BP.
  • KCTC Korean Collection for Type Cultures
  • biomass refers to living organisms such as plants, animals, and microorganisms that can be used as chemical energy, i.e., the energy source of bioenergy, and ecologically, it also refers to the weight or energy amount of a specific organism existing within a unit of time and space.
  • the biomass may include, but is not limited to, compounds secreted by cells, and may contain cells and/or intracellular contents as well as extracellular substances.
  • the microalgae-derived biomass may include microalgae itself, a culture thereof, a fermented product thereof, a dried product thereof, a pulverized product thereof, or a product produced by culturing or fermenting the microalgae, or may include a concentrate or a dried product of the biomass, but is not limited thereto.
  • the microalgae-derived biomass may include at least one selected from the group consisting of microalgae, a culture of the microalgae, a dried product of the culture, and a pulverized product of the dried product.
  • the drying may be performed by, but is not limited to, spray drying, hot air drying, freeze drying, natural drying, or vacuum drying.
  • the "culture” of the above microalgae refers to a product produced by culturing the microalgae, and may specifically be a culture solution containing microalgae or a culture filtrate from which the microalgae have been removed, but is not limited thereto.
  • the "dry product” of the microalgae culture refers to a microalgae culture from which moisture has been removed, and may be, for example, a dried cell form of the microalgae, but is not limited thereto.
  • the "crushed product” of the dried product refers to a general term for the result of crushing the dried product from which moisture has been removed from the microalgae culture, and may be, for example, a dried cell powder, but is not limited thereto.
  • the culture of the microalgae can be produced by inoculating the microalgae into a microalgae culture medium and according to a culturing method known in the art, and the dried product of the culture and the crushed product thereof can also be produced according to a method for treating or drying microalgae or a culture solution known in the art.
  • the above-described microalgae-derived biomass may contain 40 wt% to 95 wt% of protein (crude protein), and more specifically, 40 wt% to 95 wt%, 40 wt% to 90 wt%, 40 wt% to 85 wt%, 40 wt% to 82.5 wt%, 40 wt% to 81.5 wt%, 40 wt% to 80.5 wt%, 50 wt% to 95 wt%, 50 wt% to 90 wt%, 50 wt% to 85 wt%, 50 wt% to 82.5 wt%, 50 wt% to 81.5 wt%, 50 wt% to 80.5 wt%, 60 wt% to 95 wt%, 60 wt% to 90 wt%, 60 wt% to 85 wt%, 60 wt% 82.5 wt%, 60 wt% to 81.5 wt%, 60 wt% to
  • the microalgae-derived biomass described above may contain 3 wt% to 30 wt% of fat (crude lipids), and more specifically, 3 wt% to 30 wt%, 3 wt% to 20 wt%, 3 wt% to 15 wt%, 3 wt% to 13 wt%, 3 wt% to 12 wt%, 6 wt% to 30 wt%, 6 wt% to 20 wt%, 6 wt% to 15 wt%, 6 wt% to 16 wt%, 6 wt% to 12 wt%, 9 wt% to 30 wt%, 9 wt% to 20 wt%, 9 wt% to 15 wt%, 9 wt% to 16 wt%, 9 wt% to 12 wt%, 10 wt% to 30 wt%, 10 wt% to 20 wt%, 10 wt% to 30 wt%, 10
  • the microalgae-derived biomass described above may contain moisture of 0.05 wt% to 5 wt%, and more specifically, 0.05 wt% to 5 wt%, 0.05 wt% to 3 wt%, 0.05 wt% to 1.75 wt%, 0.05 wt% to 1.5 wt%, 0.05 wt% to 1 wt%, 0.05 wt% to 0.7 wt%, 0.1 wt% to 5 wt%, 0.1 wt% to 3 wt%, 0.1 wt% to 1.75 wt%, 0.1 wt% to 1.5 wt%, 0.1 wt% to 1 wt%, 0.1 wt% to 0.7 wt%, 0.5 wt% to 5 wt%, 0.5 wt% to 3 wt%, 0.5 wt% to 1.75 % by weight, 0.5 wt % to 1.5 wt %, 0.5 wt% to
  • ash may mean ash produced by burning a sample or the sum of inorganic substances contained in the sample.
  • Ash may be used interchangeably with terms such as mineral, inorganic substance, inorganic salt, and mineral substance, and may include one or more inorganic elements selected from the group consisting of calcium, phosphorus, potassium, sulfur, sodium, chlorine, magnesium, iron, copper, manganese, iodine, cobalt, zinc, molybdenum, selenium, chromium, fluorine, boron, arsenic, tin, silicon, vanadium, and nickel.
  • the microalgae-derived biomass described above may contain ash in an amount of 2.5 wt% to 20 wt%, and more specifically, 2.5 wt% to 20 wt%, 2.5 wt% to 15 wt%, 2.5 wt% to 13.5 wt%, 2.5 wt% to 12.5 wt%, 2.5 wt% to 10 wt%, 2.5 wt% to 8 wt%, 2.5 wt% to 7.5 wt%, 5 wt% to 20 wt%, 5 wt% to 15 wt%, 5 wt% to 13.5 wt%, 5 wt% to 12.5 wt%, 5 wt% to 10 wt%, 5 wt% to 8 wt%, 5 wt% to 7.5 wt%, 7 wt% to 20 wt%, 7 wt% to 15 wt%, 7 % to 13.5 wt %, 7 wt %, w
  • the microalgae-derived biomass described above may contain 30 parts by weight to 70 parts by weight of glutamic acid based on 100 parts by weight of total amino acids, and more specifically, 30 parts by weight to 70 parts by weight, 30 parts by weight to 60 parts by weight, 30 parts by weight to 57 parts by weight, 30 parts by weight to 54 parts by weight, 45 parts by weight to 70 parts by weight, 45 parts by weight to 60 parts by weight, 45 parts by weight to 57 parts by weight, 45 parts by weight to 54 parts by weight, 50 parts by weight to 70 parts by weight, 50 parts by weight to 60 parts by weight, 50 parts by weight to 57 parts by weight, 50 parts by weight to 54 parts by weight, 53 parts by weight to 70 parts by weight, 53 parts by weight to 60 parts by weight, 53 parts by weight to 57 parts by weight, or 53 parts by weight. It may contain, but is not limited to, 54 parts by weight.
  • the microalgae-derived biomass described above may contain 7 to 25 parts by weight of arginine based on 100 parts by weight of total amino acids, and more specifically, may contain 7 to 25 parts by weight, 7 to 20 parts by weight, 7 to 15 parts by weight, 7 to 13 parts by weight, 10 to 25 parts by weight, 10 to 20 parts by weight, 10 to 15 parts by weight, 10 to 13 parts by weight, 12 to 25 parts by weight, 12 to 20 parts by weight, 12 to 15 parts by weight, or 12 to 13 parts by weight, but is not limited thereto.
  • the microalgae-derived biomass described above may contain 20 parts by weight to 50 parts by weight of palmitic acid based on 100 parts by weight of total fatty acids, and more specifically, may contain 20 parts by weight to 50 parts by weight, 20 parts by weight to 40 parts by weight, 20 parts by weight to 37 parts by weight, 30 parts by weight to 50 parts by weight, 30 parts by weight to 40 parts by weight, 30 parts by weight to 37 parts by weight, 36 parts by weight to 50 parts by weight, 36 parts by weight to 40 parts by weight, or 36 parts by weight to 37 parts by weight, but is not limited thereto.
  • the term “palmitic acid” refers to one of the saturated fatty acids having the chemical formula of CH 3 (CH 2 ) 14 COOH, also called hexadecanoic acid, and can also be abbreviated as C16:0.
  • the microalgae-derived biomass described above may contain 30 parts by weight to 60 parts by weight of docosahexaenoic acid ((4Z,7Z,10Z,13Z,16Z,19Z)-Docosa-4,7,10,13,16,19-hexaenoic acid, DHA) based on 100 parts by weight of total fatty acids, and more specifically, may contain 30 parts by weight to 60 parts by weight, 30 parts by weight to 50 parts by weight, 30 parts by weight to 46 parts by weight, 40 parts by weight to 60 parts by weight, 40 parts by weight to 50 parts by weight, 40 parts by weight to 46 parts by weight, 45 parts by weight to 60 parts by weight, 45 parts by weight to 50 parts by weight, or 45 parts by weight to 46 parts by weight, but is not limited thereto.
  • docosahexaenoic acid ((4Z,7Z,10Z,13Z,16Z,19Z)-Docosa-4,7,10,13,16,19-hexaeno
  • docosahexaenoic acid ((4Z,7Z,10Z,13Z,16Z,19Z)-Docosa-4,7,10,13,16,19-hexaenoic acid, DHA)
  • DHA docosahexaenoic acid
  • ALA alpha-linolenic acid
  • EPA eicosapentaenoic acid
  • the common name is cervonic acid, and it can also be abbreviated as C22:6n3. Since docosahexaenoic acid cannot be produced in the fish body, it must be ingested through feed, and is known as an essential fatty acid that plays an important role in the metabolism and cell function of fish.
  • the term "feed composition” may mean something that provides nutrition to an animal (including unicellular or multicellular heterotrophic organisms such as zooplankton, livestock, and fish) or is necessary for maintaining its health or growth.
  • the feed composition may be a single-ingredient feed, a compound feed, or a supplementary feed.
  • the single-ingredient feed may mean a plant-based, animal-based, or mineral-based material that is directly used as feed or as a raw material for a compound feed.
  • the supplementary feed may mean something added to feed to prevent deterioration of the quality of the feed or to increase the utility of the feed.
  • the compound feed may be a product obtained by mixing or processing single-ingredient feed, supplementary feed, etc. at an appropriate ratio.
  • the above feed composition may refer to a substance that supplies organic or inorganic nutrients necessary for sustaining the life of an animal, or for producing meat, milk, etc.
  • the feed composition may additionally contain nutrients necessary for sustaining the life of an animal, or for producing meat, milk, etc.
  • the feed composition may be manufactured into various forms of feed known in the art, and specifically may include concentrate feed, forage, and/or special feed.
  • the feed composition may be manufactured in the form of compound feed (Extruded pellet, EP feed, dry feed) or raw feed (Moist pellet, MP feed, wet feed), dough feed, etc.
  • feed additives may include substances added to feed for various purposes such as nutrient supplementation and prevention of weight loss, promotion of digestibility and availability of fiber in feed, improvement of milk quality, prevention of reproductive disorders and improvement of conception rate, and prevention of high temperature stress in summer.
  • the feed additives may refer to supplementary feeds under the Feed Management Act, and may additionally include mineral preparations such as sodium bicarbonate, bentonite, magnesium oxide, and complex minerals; mineral preparations that are trace minerals such as zinc, copper, cobalt, and selenium; vitamins such as carotene, vitamin E, vitamins A, D, E, nicotinic acid, and vitamin B complex; protected amino acids such as methionine and lysine; protected fatty acids such as fatty acid calcium salts; probiotics (lactic acid bacteria), yeast cultures, and mold fermentations; and yeast agents.
  • mineral preparations such as sodium bicarbonate, bentonite, magnesium oxide, and complex minerals
  • mineral preparations that are trace minerals such as zinc, copper, cobalt, and selenium such as carotene, vitamin E, vitamins A, D, E, nicotinic acid, and vitamin B complex
  • protected amino acids such as methionine and lysine
  • protected fatty acids such as fatty acid calcium salts
  • feed composition may be interpreted to encompass “feed additive”.
  • the above feed composition may further include grains, such as pulverized or crushed wheat, oats, barley, corn and rice; plant-based protein feeds, such as feeds mainly composed of soybeans and sunflower; animal-based protein feeds, such as fish meal, blood meal, meat meal and/or bone meal; dry ingredients composed of sugars and dairy products, such as various types of milk powder and whey powder, and may further include nutritional supplements, digestion and absorption enhancers, growth promoters, etc.
  • grains such as pulverized or crushed wheat, oats, barley, corn and rice
  • plant-based protein feeds such as feeds mainly composed of soybeans and sunflower
  • animal-based protein feeds such as fish meal, blood meal, meat meal and/or bone meal
  • dry ingredients composed of sugars and dairy products such as various types of milk powder and whey powder, and may further include nutritional supplements, digestion and absorption enhancers, growth promoters, etc.
  • the feed composition may be administered to an animal alone or in combination with other feed additives in an edible carrier.
  • the feed composition may be easily administered to an animal as a top dressing, or by mixing them directly into the feed, or in an oral formulation separate from the feed.
  • the composition When the composition is administered separately from the feed, it may be prepared as an immediate release or sustained release formulation by combining it with an edible carrier acceptable in the feed field, as is well known in the art.
  • the edible carrier may be a solid or liquid, for example, corn starch, lactose, sucrose, soybean flakes, peanut oil, olive oil, sesame oil, and propylene glycol.
  • the feed composition may be a tablet, capsule, powder, troche, or sugar tablet, or a top dressing in the form of a microdispersible form.
  • the feed composition may be in the form of a gelatin soft capsule, or a syrup, suspension, emulsion, or solution.
  • the feed composition may include, for example, a preservative, a stabilizer, a wetting or emulsifying agent, a cryoprotectant, or an excipient.
  • the cryoprotectant may be at least one selected from the group consisting of glycerol, trehalose, maltodextrin, skimmed milk powder, and starch.
  • the preservative, stabilizer, or excipient may be included in the composition in an effective amount sufficient to reduce deterioration of the microalgae included in the feed composition.
  • the cryoprotectant may be included in the composition in an effective amount sufficient to reduce deterioration of the microalgae included in the composition when the composition is in a dried state.
  • the above feed composition can be used by adding it to animal feed by immersion, spraying, or mixing.
  • the above feed composition can be applied to a number of animal diets including, but not limited to, mammals, birds, fish, crustaceans, cephalopods, reptiles, and amphibians.
  • the mammals can include pigs, cattle, sheep, goats, laboratory rodents, or pets, and the birds can include poultry, and the poultry can include, but is not limited to, chickens, turkeys, ducks, geese, pheasants, or quail.
  • the crustaceans can include, but are not limited to, shrimp, barnacles, and the like.
  • the feed composition can also be applied to a diet of zooplankton, such as rotifers, artemia, daphnia pulex, and the like.
  • the fish can include freshwater fish, saltwater fish, commercially farmed fish and fry thereof, ornamental fish, and the like.
  • feed composition for eel comprising biomass derived from the microalgae of the genus Schizochytrium sp. described above.
  • the above Schizochytrium sp. microalgae, the microalgae-derived biomass, and the feed composition are as described above.
  • the term “eel” refers to a fish belonging to the genus Eel of the family Eelidae, and may be used interchangeably with “freshwater eel” or “eel”.
  • the eel may be at least one selected from the group consisting of Japanese eel ( Anguilla japonica ), large eel ( Anguilla marmorata ), European eel ( Anguilla anguilla ), American eel ( Anguilla rostrata ), and bicolor eel ( Anguilla bicolor ), and more specifically, may be Japanese eel ( Anguilla japonica ), but is not limited thereto.
  • the feed composition containing the above-described microalgae biomass can promote the growth of eels.
  • the eel feed composition of the present application may comprise 2.25 wt% to 45 wt% of the microalgae-derived biomass described above, and more specifically, 2.25 wt% to 45 wt%, 2.25 wt% to 30 wt%, 2.25 wt% to 25 wt%, 2.25 wt% to 22.5 wt%, 2.25 wt% to 20 wt%, 2.25 wt% to 17.5 wt%, 2.25 wt% to 15 wt%, 2.25 wt% to 13.3 wt%, 2.25 wt% to 12 wt%, 2.25 wt% to 10 wt%, 2.25 wt% to 8 wt%, 2.25 wt% to 7.5 wt%, 2.25 wt% to 7 wt%, 2.25 wt% to 6.6 wt%, 2.25 wt% to 6.5 wt%, 2.25 wt% to 6
  • the feed composition for eel may contain 21 to 30 parts by weight of palmitic acid based on 100 parts by weight of total fatty acids, and more specifically, 21 to 30 parts by weight, 21 to 25 parts by weight, 21 to 23.75 parts by weight, 21 to 22.5 parts by weight, 21 to 21.25 parts by weight, 21.25 to 30 parts by weight, 21.25 to 25 parts by weight, 21.25 to 23.75 parts by weight, 21.25 to 22.5 parts by weight, 22.5 to 30 parts by weight, 22.5 to 25 parts by weight, 22.5 to 23.75 parts by weight, 23.75 to It can contain 30 parts by weight, 23.75 parts by weight to 25 parts by weight, or 25 parts by weight to 30 parts by weight.
  • the content of palmitic acid included in the eel feed composition may increase.
  • the feed composition for eel contains, based on 100 parts by weight of total fatty acids, 15 to 27 parts by weight of docosahexaenoic acid ((4Z,7Z,10Z,13Z,16Z,19Z)-Docosa-4,7,10,13,16,19-hexaenoic acid, DHA), more specifically, 15 to 27 parts by weight, 15 to 23 parts by weight, 15 to 20.25 parts by weight, 15 to 18 parts by weight, 15 to 16.25 parts by weight, 16.25 to 27 parts by weight, 16.25 to 23 parts by weight, 16.25 to 20.25 parts by weight, 16.25 to 18 parts by weight, 18 to It may include, but is not limited to, 27 parts by weight, 18 parts by weight to 23 parts by weight, 18 parts by weight to 20.25 parts by weight, 20.25 parts by weight to 27 parts by weight, 20.25 parts by weight to 23 parts by weight, or 23 parts by weight to 27 parts by weight.
  • docosahexaenoic acid ((4
  • the content of microalgae-derived biomass included in the eel feed composition increases, the content of docosahexaenoic acid included in the eel feed composition may increase.
  • the eel feed composition according to an example of the present application may further include protein, carbohydrate, fat, etc. Yeast, starch, cellulose, vitamins
  • the eel feed composition of the present application may additionally contain fishmeal.
  • the eel feed composition of the present application may additionally include at least one selected from the group consisting of yeast (e.g., live bacteria such as yeast culture and mold fermentation, yeast preparations), vitamins (e.g., vitamin preparations such as carotene, vitamin E, vitamins A, D, E, nicotinic acid, and vitamin B complex), minerals (e.g., mineral preparations such as sodium bicarbonate, bentonite, magnesium oxide, and complex minerals, and mineral preparations such as trace minerals such as zinc, copper, cobalt, and selenium), and starch.
  • yeast e.g., live bacteria such as yeast culture and mold fermentation, yeast preparations
  • vitamins e.g., vitamin preparations such as carotene, vitamin E, vitamins A, D, E, nicotinic acid, and vitamin B complex
  • minerals e.g., mineral preparations such as sodium bicarbonate, bentonite, magnesium oxide, and complex minerals, and mineral preparations such as trace minerals such as zinc, copper, cobalt, and
  • the eel feed composition may promote the growth of an eel. Promoting the growth of an eel may mean increasing a weight gain rate (WGR), a feed efficiency (FE), and/or a specific growth rate (SGR) of the eel. For example, when the eel feed composition is fed to an eel, the weight gain rate (WGR), feed efficiency (FE), and/or a specific growth rate (SGR) of the eel may increase compared to when a feed composition that does not include microalgae-derived biomass is fed.
  • WGR weight gain rate
  • FE feed efficiency
  • SGR specific growth rate
  • the weight gain rate (WGR), feed efficiency (FE), and/or specific growth rate (SGR) increased, confirming that the eel feed composition of the present application has the effect of promoting the growth of eels.
  • the feed composition of the present application described above promotes the growth of eels and can be usefully used as a feed composition for eels.
  • the present application provides a method for cultivating eels, comprising the step of feeding eels with a feed composition for eels containing biomass derived from microalgae of the genus Schizochytrium as described above.
  • a step of preparing an eel feed composition containing the above-described microalgae-derived biomass of the genus Schizochytrium may be additionally included.
  • the feeding step can be performed by any method for providing food to eels, and for example, can include, but is not limited to, a step of supplying or adding an eel feed composition comprising the biomass derived from the microalgae of the genus Schizochytrium described above to eels (which can be interpreted as including an aquatic environment containing the eel).
  • the feeding amount of the eel feed composition containing the biomass derived from the microalgae of the genus Schizochytrium is 1% (w/w) to 15% (w/w), more specifically 1% (w/w) to 15% (w/w), 1% (w/w) to 10% (w/w), 1% (w/w) to 8% (w/w), 1% (w/w) to 7% (w/w), 2% (w/w) to 15% (w/w), 2% (w/w) to 10% (w/w), 2% (w/w) to 8% (w/w), 2% (w/w) to 7% (w/w), 3% (w/w) to 15% (w/w), 3% (w/w) to 10% (w/w), 3% (w/w) to It may be, but is not limited to, 8%(w/w), or 3%(w/w) to 7%(w/w).
  • the biomass derived from the above-mentioned microalgae of the genus Schizochytrium, the feed composition for eel, and the growth promotion of eel are as described above.
  • the present application provides a method for promoting the growth of an eel, comprising the step of feeding an eel a feed composition for eel comprising biomass derived from microalgae of the genus Schizochytrium as described above.
  • the present application provides a use of the biomass derived from the microalgae of the genus Schizochytrium described above and/or an eel feed composition comprising the biomass derived from the microalgae of the genus Schizochytrium for promoting eel growth.
  • the present invention relates to a feed composition for eels comprising a biomass derived from microalgae of the genus Schizochytrium sp., and a method for cultivating eels using the same.
  • a feed composition for eels comprising a biomass derived from microalgae of the genus Schizochytrium sp. of the present invention
  • the feed composition for eels comprising the biomass derived from microalgae of the genus Schizochytrium sp. of the present invention
  • the growth of eels is promoted, and thus the feed composition can be usefully utilized as an eel feed composition or feed additive.
  • Figure 1 is a diagram showing the difference in color as a result of pure isolation and culture of a mutant strain of Schizochytrium sp. CD03-7004 and a wild-type Schizochytrium sp. strain CD01-5000.
  • Figure 2 is a diagram showing the sizes of amplified DNA fragments of the wild-type CD01-5000 strain and the mutant CD03-7004 strain, after performing PCR using a primer set that amplifies a DNA fragment containing an additional 15 bp base sequence in the mutant CD03-7004 strain compared to the wild-type CD01-5000 strain.
  • % used to indicate the concentration of a particular substance, unless otherwise noted, is (weight/weight) % for solid/solid, (weight/volume) % for solid/liquid, and (volume/volume) % for liquid/liquid.)
  • the tank was a 1-ton square tank (working vol 60 L), and was composed of 3 breeding tanks and 2 filtration tanks.
  • the test method was to transplant 25 freshwater eels ( Anguilla Japonica ) (approximately 20 g in size), which are currently being bred and managed at the Central Research Institute of Copacs Co., Ltd., into each test tank. After 1 week of acclimation, the manufactured test feed was supplied at 3-7% (w/w) of the body weight, twice a day (07:30, 14:30), and the fish were bred for 8 weeks. 20-30 minutes after the test feed was supplied, the remaining feed was recovered, freeze-dried, weighed, and then excluded from the feed supplied each time.
  • the temperature of each test tank was 29°C, DO was 6.5, and pH was 5.8 ⁇ 0.5.
  • NH3 , NO2 were Collect water from each test tank filtration tank once a day. It was measured by chemical analysis method.
  • Feed efficiency (wet weight gain/dry feed intake) x 100
  • Weight Gain Rate (final weight - initial weight) x 100/initial weight
  • a pure, isolated wild-type Schizochytrium sp. CD01-5000 strain (accession number KCTC 14344BP) was cultured in modified-GYEP (glucose 10 g/L, yeast extract 1 g/L, peptone 1 g/L, MgSO 4 ⁇ 7H 2 O 2 g/L, H 3 BO 3 5.0 mg/L, MnCl 2 3.0 mg/L, CuSO 4 0.2 mg/L, NaMo 4 ⁇ 2H 2 O 0.05 mg/L, CoSO 4 0.05 mg/L, ZnSO 4 ⁇ 7H 2 O 0.7 mg/L) medium containing 30 g/L glucose for about 24 h to reach the early exponential phase, and then the culture solution sample was centrifuged to harvest the cells. The harvested mycelia were suspended in 0.1 M Phosphate Buffer Solution containing 1.0% NaCl to a cell count of approximately 10 9 cells/mL and used for gamma irradiation.
  • modified-GYEP
  • the gamma-ray irradiation experiment was conducted at the Advanced Radiation Research Institute of the Korea Atomic Energy Research Institute, and gamma-ray doses of 2000–5000 GY were irradiated.
  • the microalgae culture samples irradiated with gamma rays underwent a recovery process in a darkroom for O/N, and were then spread on GYEP medium containing 20 g/L agar and cultured at 30°C for approximately 5 days. The number of growing colonies was counted to measure the death rate according to the gamma dose.
  • Mortality rate (%) [ ⁇ (number of colonies in untreated group) - (number of colonies in treated group) ⁇ /(number of colonies in untreated group)] X 100
  • the appropriate dose at which the number of growth colonies and the CFU value of viable cells were reduced by 95% or more was confirmed.
  • gamma-ray irradiation doses of 2.0, 3.0, 4.0, 4.5, and 5.0 kGY, 0%, 90.8%, 98.2%, 100%, and 100% were killed, respectively.
  • the gamma-ray dose condition of 4.5 GY or higher all were killed and it was impossible to secure microalgae colonies, so the gamma-ray dose condition of 4.0 kGY, which showed a kill rate of 98.2%, was selected.
  • the novel microalgae strain CD01-5000 was irradiated with 4.0 kGY gamma rays and cultured in GYEP medium. Colonies that could grow during the culture were selected, and passages were performed under the same medium and culture environment conditions. Morphologically red colonies were selected between passages, and the single cell line was purified and cultured. The results of the photographs are shown in Fig. 1.
  • the Schizochytrium strain was named Schizochytrium sp. CD03-7004 strain and deposited with the Korean Collection for Type Cultures (KCTC) of the Korea Research Institute of Bioscience and Biotechnology on June 20, 2022, and assigned the accession number KCTC15006BP.
  • the mutant CD03-7004 strain was confirmed to have an additional portion of 15 base pairs (the portion in bold in the sequence of SEQ ID NO. 1 below, SEQ ID NO. 5) when compared to the genome of the wild-type CD01-5000 strain.
  • Primer A: 5’-TTTCAGACTGCTTTTTGCTTTTTG-3’ (SEQ ID NO: 3) and primer B: 5’-CTCTCTTCGGATTGACTCTTTTCT-3’ (SEQ ID NO: 4) that amplify this part were selected, and PCR amplification reaction was performed using them.
  • the PCR reaction was performed using a reaction solution containing taq polymerase, denaturing at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 10 seconds, annealing at 50°C for 10 seconds, and polymerization at 72°C for 15 seconds, and then polymerization reaction was performed at 72°C for 5 minutes.
  • the reaction solution amplified through the PCR process was electrophoresed on a 1.7% agarose gel to confirm the amplified DNA size, which is shown in Fig. 2.
  • the DNA fragment amplified in the mutant CD03-7004 strain was found to be about 140 bp in size, confirming that it was different from the wild-type CD01-5000 strain in which a DNA fragment of about 120 bp in size was amplified.
  • primer A 5’-TTTCAGACTGCTTTTTGCTTTTTTTG-3’ (SEQ ID NO: 3) and primer B: 5’-CTCTCTTCGGATTGACTCTTTTCT-3’ (SEQ ID NO: 4) can be utilized to select the mutant CD03-7004 strain.
  • Microalgae biomass dry powder Schizochytrium sp. Manufacturing of
  • microalgae biomass dry powder used in the experiment was prepared using Schizochytrium sp. CD03-7004 strain (KCTC15006BP) using the following method.
  • each strain was inoculated into the GYEP medium containing 50 ml of working volume and 30 g/L of glucose in a 500 ml flask, and cultured in a shaking incubator at 30°C and 180 rpm for approximately 20 hours.
  • the preliminary culture was inoculated into a 30 L fermenter containing a medium under the same conditions, and fermented in a total working volume of 20 L.
  • Glucose corresponding to 20% of the working volume was continuously added for cell culture under the conditions of 30°C, 500 rpm, 0.5-1 vvm, and pH 5-7, and the glucose concentration at this time was maintained at the level of 20 g/L.
  • the culture was terminated when the supplied carbon source, glucose, was completely consumed.
  • the culture solution after cultivation was dried using a dryer so that the moisture content became approximately 5-8%.
  • the test feed was manufactured using fishmeal (Glumar Co., Chille) manufactured by KOPAX Feed Manufacturing Co., Ltd. and Schizochytrium sp. powder (CJ Co., Korea) manufactured in Example 1-2-3 as a protein source, yeast (Biolife Co., Brazil), vitamins (Seoul vet Pharm Co., Korea), minerals (Seoul vet Pharm Co., Korea), and starch (Asai Co., Thailand).
  • a control feed (CTL) consisting of 100% fish meal as a protein source, and test feeds (replacement feeds) T1, T2, T3, T4, and T5 in which 5%, 10%, 15%, 20%, and 30% of the fish meal were replaced with Schizochytrium sp. powder, respectively, were manufactured. Meanwhile, all protein sources were ground to about 100 mesh size using a grinder owned by KOPAX Research Institute and used. The composition of the control and test feeds is described in Table 8 below.
  • mice were randomly selected from each test group to measure the hepatosomatic index (HSI) and the intestinosomatic index (ISI).
  • HSA hepatosomatic index
  • ISI intestinosomatic index
  • the body weight and the weight of the liver and intestine removed after dissection were measured using an electronic scale, and the liver weight index [(liver weight/body weight) ⁇ 100] and the intestine weight index [(liver weight/body weight) ⁇ 100] were calculated.
  • the moisture, fat, protein and ash content of the research materials and fish bodies were analyzed.
  • the research materials were fish meal (Glumar Co., Chille) and the Schizochytrium sp. powder.
  • the analysis method was performed according to the food code method, and crude fat analysis was performed by the acid hydrolysis method considering the characteristics of Schizochytrium sp. powder.
  • the amino acid, fatty acid and Ca. P content of the research materials, fish meal and the Schizochytrium sp. powder, and fish body were evaluated.
  • the amino acid, fatty acid and Ca. P content were evaluated using the freeze-dried powder of the ground meat of 5 randomly collected from each test area. The analysis was requested to the Feed Testing and Certification Center of the Chungnam National University Agricultural Science Research Institute ( https:/agro.cnu.ac.kr/agro/index.do ).
  • composition amino acid content was performed using the ninhydrin post column reaction method using ion exchange chromatography by modifying the AOAC method (2005) to analyze 18 components.
  • 16 components of the composition amino acids 0.2 g of the sample was placed in a digestion tube, 10 ml of 6N HCl was added, nitrogen gas was injected, and hydrolyzed at 110 °C for 24 hours.
  • the filtrate was concentrated in a vacuum evaporator, diluted to 50 ml with 0.2 M sodium citrate buffer, and the filtrate filtered through a 0.20 ⁇ m cellulose acetate syringe filter was used as the analysis sample.
  • the sulfur-containing series, methionine and cysteine were analyzed using the performic acid oxidation method, and tryptophan was analyzed using the alkaline hydrolysis method.
  • the analysis conditions are shown in Tables 2 and 3.
  • Fatty acid composition was prepared by adding about 100 ml of a mixture of chloroform and methanol (2:1) to about 10 g of the crushed sample according to the method of Folch et al. (1957), extracting at room temperature for 24 hours, and then concentrating under reduced pressure. After methyl esterification with a 14% BF3-MeOH (Sigma, St Louis, Mo, USA) solution, the result was analyzed using a Gas Chromatograph (HP 6890, Heslett Packard Ltd., USA).
  • the column used was HP-88 (100 m ⁇ 0.25 mm id, film thickness 0.20 ⁇ m, Agilent, USA), and the temperature of the column oven was maintained at 140°C for 5 minutes, then increased by 4°C per minute and maintained at 240°C for 20 minutes.
  • the temperature of the inlet was 260°C
  • that of the detector FID was 270°C
  • the carrier gas was N2 at 1ml/min
  • the split ratio was adjusted to 1/50.
  • the analysis conditions of gas chromatography were as shown in Table 4 below, and the peaks of each fatty acid were identified by comparing them with the retention time of the methyl ester of the standard fatty acid.
  • the fatty acid composition was obtained by calculating the area of each identified peak and expressing each area ratio as a percentage.
  • the mineral content was measured by dissolving the residue after dry charring in a hydrochloric acid solution (1:1, v/v) to prepare a sample solution.
  • Calcium (Ca) was measured using an atomic absorption spectrophotometer (GBC Scientific Equipment, SavantAA, Australia), and phosphorus (P) was measured at 470 nm using a spectrophotometer (UV-2450, Shimadzu Co., Japan) according to the molybdenum blue colorimetric method. All reagents and distilled water were for mineral analysis.
  • mice were randomly selected from each test group and plasma for blood analysis was collected from the caudal vein using a disposable syringe into a heparin tube and centrifuged (2000 rpm, 15 min, 4°C).
  • Glutamate oxaloacetate transaminase (GOT) cholesterol (CHO), triglyceride (TG), alkaline phosphatase (ALP), and total protein (TP) were measured using a blood analyzer (NX500i, FUJI FILM, JAPAN).
  • lysozyme activity 50 ⁇ l of serum isolated from the arrhythmias of 10 eels for each test group after the end of the experiment and 1 ml of a solution containing Micrococcus lysodeikticus (0.2 mg/ml) suspended in 0.05 M sodium phosphate buffer (Sigma, USA, pH 6.2) were mixed in a 96-well plate. The reaction was measured at 0.5 and 5 minutes at an absorbance of 530 nm using a spectrophotometer (Molecular Device, USA) at 20°C. The activity unit of lysozyme was defined as the amount of enzyme that exhibited an absorbance decrease of 0.001 per minute.
  • cholecystokinin and the antioxidant enzyme superoxide dismutase SOD
  • blood was collected from 10 eels per test group, the serum was separated by centrifugation at 2,000 ⁇ g for 10 minutes at 4°C, and then stored at -70°C.
  • ELISA analysis using the serum was performed using a kit that can measure fish cholecystokinin (CUSABIO, USA) and SOD (CUSABIO, USA), and 50 ⁇ L of plasma per well was used in triplicate according to the manufacturer's protocol.
  • Example 2 Analysis of research materials (fishmeal and Schizochytrium microalgae powder)
  • Schizochytrium sp. meal had lower moisture and ash contents than fish meal, and higher crude protein and crude fat contents than fish meal.
  • Amino acids (g/total amino acids 100g) Fishmeal powder (FP) Schizochytrium sp. powder (SP) Aspartic acid 9.99 4.65 Threonine* 4.62 2.14 Serine 4.39 2.23 Glutamic acid 14.41 53.56 Proline 4.62 1.40 Glycine 6.73 2.53 Alanine 6.77 3.00 Cysteine 0.21 0.11 Valine* 5.22 3.01 Methionine* 3.24 1.51 Isoleucine* 4.29 1.96 Leucine* 7.85 3.45 Tyrosine 3.32 1.49 Phenylalanine* 4.08 1.93 Histidine* 4.67 1.18 Lysine* 8.83 3.65 Arginine* 6.76 12.18
  • the fatty acid composition of the fat contained in the two proteins used in this study was evaluated and expressed as g/100 g of total fatty acid, as shown in Table 7.
  • the content ratios of some fatty acids between the two protein sources showed very large differences.
  • the fatty acids showing major differences were myristic acid (C14:0, FP, 5.60; SP, 1.70), palmitic acid (C16:0, FP, 19.96; SP, 36.70), stearic acid (C18:0, FP, 6.68; SP, 1.51), palmitoleic acid (C16:1, FP, 5.99; SP, 0.11), oleic acid (C18:1n9, FP, 18.87; SP, 0.51), linoleic acid (C18:2n6, FP, 2.37; SP, 0.37), linolenic acid (C18:3n3, FP, EPA (eicosapentaenoic acid) (C16:0, FP, 9.63; SP, 0.72), nervonic acid (C24:1n9, FP, 3.25; SP, 0.40), and DHA (docosahexanoic acid
  • a control feed (CTL) containing 100% fish meal as a protein source, and test feeds (replacement feeds) T1, T2, T3, T4, and T5 in which 5%, 10%, 15%, 20%, and 30% of the fish meal were replaced with Schizochytrium sp. were prepared with the compositions shown in Table 8 below.
  • control feed CTL
  • test feeds replacement feeds
  • the fatty acid composition ratio (profile) of the control feed (CTL) and test feeds (replacement feeds) T1 to T5 used in this experiment was evaluated and expressed as g/100 g of total fatty acid, as shown in Table 10.
  • the growth performance was evaluated by feeding the control and test diets T1 to T5 twice a day for 8 weeks to freshwater eels ( A. japonica , approximately 20 g in size) in the growth stage, and the results are shown in Table 11 below.
  • Feed Efficiency (wet weight gain/dry feed intake) x 100
  • the body weight gain (WGR) was in the order of T2 (196.25 ⁇ 13.47) > control feed (188.59 ⁇ 4.84) > T1 (182.87 ⁇ 4.77) > T3 (182.07 ⁇ 4.47) > T4 (176.52 ⁇ 8.32 > T5 (175.99 ⁇ 6.99), and the feed efficiency (FE) was in the order of T2 (90.86 ⁇ 5.0) > control feed (87.09 ⁇ 2.16) > T1 (85.55 ⁇ 1.52) > T3 (84.53 ⁇ 1.89) > T4 (81.54 ⁇ 3.54) > T5 (81.45 ⁇ 2.97), and the daily growth rate (SGR) was also in the order of T2 (1.94 ⁇ 0.08) > control feed (1.89 ⁇ 0.03 n ) > T1 (1.86 ⁇ 0.03) > T3 (1.85 ⁇ 0.03) > T4 (1.82 ⁇ 0.05) > T5 (1.81 ⁇ 0.05), and it was confirmed that the best growth rate, feed efficiency, and daily growth rate were shown in test feed T2.
  • the survival rate (SR) did not show
  • liver weight index HAI
  • ISI intestine weight index
  • both the control feed-fed eel group and the test feed (T1–T5)-fed groups showed similar values for blood concentrations of GOT (also known as aspartate aminotransferase (AST)), a blood liver damage index, cholesterol (CHO), alkaline phosphatase (ALP), a major liver enzyme, and total protein (TP).
  • GOT also known as aspartate aminotransferase (AST)
  • AST aspartate aminotransferase
  • CHO cholesterol
  • ALP alkaline phosphatase
  • TP total protein
  • Blood triglyceride (TG) tended to decrease compared to the control feed-fed eel group as the fish meal replacement ratio increased in the test feeds T1 to T5, but there was no significant difference.
  • Example 6 Nonspecific immunity, cholecystokinin and superoxide dismutase assays
  • the digestive function was evaluated by assessing cholecystokinin, a hormone that promotes gallbladder contraction and pancreatic enzyme secretion, and the blood antioxidant activity was compared by assessing the activity of superoxide dismutase (SOD), an antioxidant enzyme in the blood (Table 14).
  • SOD superoxide dismutase
  • lysozyme activity, phagocytic activity, cholecystokinin activity, and superoxide dismutase activity all showed similar levels between the eel groups fed the alternative feed and the test feed, confirming that fish meal can be safely replaced with Schizochytrium sp. meal within the content ratio range of the test feed.
  • the moisture content, crude protein, crude fat, ash, Ca, and P contents of the whole fish body were similar between the eel group fed the control diet (CTL) and the eel group fed the test diet (T1 ⁇ T5), confirming that fish meal can be safely replaced with Schizochytrium sp. meal within the content ratio range of the test diet.
  • the amino acid composition of the whole eel body was similar between the eel group fed the control diet (CTL) and the eel groups fed the test diets (T1-T5).
  • CTL control diet
  • T1-T5 test diets
  • some polyunsaturated fatty acids such as linoleic acid (CTL, 1.12 > T1, 1.16 > T2, 1.05 > T3, 0.91 > T4, 0.96 > T5, 0.92), EPA (CTL, 2.05 > T1, 2.01 > T2, 2.00 > T3, 1.82 > T4, 1.76 > T5, 1.55), and DHA (CTL, 5.36 ⁇ T1, 5.75 ⁇ T2, 6.33 ⁇ T3, 6.82 ⁇ T4, 7.95 ⁇ T5, 8.27), showed content differences proportional to the replacement ratio of Schizochytrium sp . This was confirmed to be the case between the fish meal used in the test evaluation and Schizochytrium sp.
  • CTL linoleic acid
  • EPA CTL, 2.05 > T1, 2.01 > T2, 2.00 > T3, 1.82 > T4, 1.76 > T5, 1.55
  • DHA CTL, 5.36 ⁇ T1, 5.75 ⁇ T2, 6.33 ⁇ T3, 6.82 ⁇ T4, 7.95 ⁇ T5, 8.27

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Polymers & Plastics (AREA)
  • Zoology (AREA)
  • Animal Husbandry (AREA)
  • Engineering & Computer Science (AREA)
  • Food Science & Technology (AREA)
  • Environmental Sciences (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Microbiology (AREA)
  • Health & Medical Sciences (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Inorganic Chemistry (AREA)
  • Insects & Arthropods (AREA)
  • Birds (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Physiology (AREA)
  • Fodder In General (AREA)
  • Feed For Specific Animals (AREA)
  • Farming Of Fish And Shellfish (AREA)

Abstract

본 발명은 스키조키트리움 속 (Schizochytrium sp.) 미세조류 유래 바이오매스를 포함하는 장어용 사료 조성물, 이를 이용한 장어의 양식방법에 관한 것이다. 본 발명의 스키조키트리움 속 (Schizochytrium　sp.) 미세조류 유래 바이오매스를 포함하는 장어용 사료 조성물을 장어에 급이하는 경우, 장어의 성장이 촉진되므로, 장어용 사료 조성물 또는 사료 첨가제로서 유용하게 활용될 수 있다.

Description

스키조키트리움 속 미세조류를 활용한 장어용 사료 및 이의 제조 방법
관련 출원(들)과의 상호 인용
본 개시는 2023년 7월 4일자 대한민국 특허출원 제10-2023-0086717호에 기초한 우선권의 이익을 주장하며, 해당 대한민국 특허출원의 문헌에 개시된 모든 내용은 본 개시의 일부로서 포함된다.
본 개시 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 개시에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 출원은 스키조키트리움 속 미세조류를 활용한 장어용 사료 조성물 및 이의 제조 방법에 관한 것이다.
전 세계적인 인구 증가와 곡물 및 어업 생산량의 정체와 지속적인 감소에 따라, 미래의 식량 안보에 대한 우려는 계속되고 있으며, 양식산업은 이러한 식량 문제를 해결할 유일한 잠재력을 가지고 있는 것으로 많은 과학자들이 추정하고 있다. 세계 양식어 생산량은 반세기 전에 240만 톤을 시작으로 2020년에는 87.5백만 톤으로 수산물 전체 생산의 49%를 양식어가 차지하고 있으며, 이들 양식어 중 해산어, 갑각류의 사료 섭취가 고성장하고 있으며 (FAO 2022), 이러한 증가 추세는 지속될 것으로 전망하고 있다. 오늘날 양어사료 영양분야는 양식 산업 성공의 중요한 몇 가지 열쇠 중의 하나이다. 양식 산업에 있어 우선 양식 가능한 중요 어종을 선택하여 종묘생산기술이 개발되면, 질 좋은 사료에 의한 사육관리가 뒷받침되어야 하는 것은 잘 알려진 사실이다. 특히 사료비가 어종별로 차이는 있지만 양식 생산단가의 30~60%를 차지하는 것을 보아서도 사료 영양의 중요성을 알 수 있다.
사료 이용율은 단백질 원료에 따라 차이를 나타내며, 어분(fish meal)은 생선으로부터 어유를 짜고 남은 어박이나 생선 부스러기 등을 건조시켜 가루로 만든 것으로 높은 단백질 함량과 우수한 아미노산 조성 및 높은 기호성으로 오랫동안 양어사료의 주 단백질원으로 사용되어 왔다. 하지만 최근 그 생산량이 급격히 저하됨에 따라 공급이 불안정하고 가격이 치솟아 사료원료 구입비용에서 가장 큰 부분을 차지한다, 어분을 만드는 여러 잡어들의 어획생산량이 남획과 해양환경 문제로 급격히 줄어들고 있으며 향후 2030년도까지 그 생산량이 계속적으로 감소할 것으로 예측되고 있다. 이러한 이유로 양어용 배합사료에서 어분을 대체할 수 있는 값싸고 질 좋은 대체단백질원을 찾기 위해 많은 연구가 진행되고 있다.
[선행기술문헌]
[특허문헌]
(특허문헌 01) 대한민국 공개특허 제10-2011-0026232호
본 발명자들은 미세조류를 활용한 어류 양식 사료를 개발하고자 예의 연구 노력하였다. 그 결과, 스키조키트리움 속 (Schizochytrium　sp.) 미세조류 유래 바이오매스를 포함하는 사료 조성물이 장어의 성장을 촉진함을 규명함으로써, 본 발명을 완성하게 되었다.
따라서, 본 출원의 목적은 스키조키트리움 속 (Schizochytrium　sp.) 미세조류 유래 바이오매스를 포함하는 장어용 사료 조성물을 제공하는 것이다.
본 출원의 또 다른 목적은 상술한 스키조키트리움 속 미세조류 유래 바이오매스를 포함하는 장어용 사료 조성물을 장어에 급이하는 단계를 포함하는 장어의 양식방법, 및/또는 장어의 성장 촉진 방법을 제공하는 것이다.
본 출원의 일 양태에 따르면, 본 출원은 스키조키트리움 속 (Schizochytrium　sp.) 미세조류 유래 바이오매스를 포함하는 장어용 사료 조성물; 및/또는 상기 미세조류 유래 바이오매스 및/또는 상기 장어용 사료 조성물의 장어 성장 촉진 용도를 제공한다.
스키조키트리움 속 ( Schizochytrium sp.) 미세조류
본 명세서에서, 용어 “미세조류(microalgae)"는 식물 중 육안으로 쉽게 볼 수 없어 현미경을 통해 볼 수 있으며 물 속에서 자유로이 부유하여 살아가는 생물을 의미하며, 식물플랑크톤(Phytoplankton)이라고도 한다. 상기 미세조류에는 다양한 종류가 있으며, 광합성이 불가능하여 종속영양으로만 생장하는 균주까지 포함한다. 상기 용어 "미세조류(microalgae)"는 본 명세서에서“균주”와 혼용될 수 있다.
본 명세서에서, 용어 “스키조키트리움 속(Schizochytrium sp.)"은 트라우스토키트리알레스(Thraustochytriales) 목의 트라우스토키트리아세애(Thraustochytriaceae) 과에 속하는 속명 중 하나로, 용어 "스키조키트리움 속(genus Schizochytrium)"과 혼용될 수 있다.
본 명세서에서, 스키조키트리움 속 미세조류 (microalgae of genus Schizochytrium)는 트라우스토키트리아세과 (family of Thraustochytriaceae)에 속하는 미생물로 스키조키트리움 아그레가툼 (Schizochytrium aggregatum), 스키조키트리움 리마시눔 (Schizochytrium limacinum) 및 스키조키트리움 미누툼 (Schizochytrium minutum)으로 이루어지는 군에서 선택되는 1종 이상일 수 있으나, 이에 한정되는 것은 아니다.
일 예에서 상기 스키조키트리움 속 미세조류는 스키조키트리움 리마시눔일 수 있다.
일 예에서 상기 스키조키트리움 속 미세조류는 스키조키트리움 아그레가툼일 수 있다.
일 예에서 상기 스키조키트리움 속 미세조류는 스키조키트리움 미누툼일 수 있다.
본 발명의 일 구현예에 있어서, 상술한 스키조키트리움 속 균주는 CD03-7004 균주(기탁번호 KCTC15006BP)일 수 있으나, 이에 한정되는 것은 아니다.
본 발명자들은 야생형 스키조키트리움 속 CD01-5000 균주(기탁번호 KCTC 14344BP)에 감마선을 조사하여 돌연변이를 발생시키고, 상기 돌연변이 균주 중 항산화 색소 생산능이 있는 균주를 선별하여, 이를 스키조키트리움 속(Schizochytrium sp.) CD03-7004로 명명하였고, 2022년 6월 20일자로 부다페스트 조약 하의 국제 기탁 기관인 한국생명공학연구원 생물자원센터(Korean Collection for Type Cultures: KCTC)에 기탁하여 수탁번호 KCTC15006BP를 부여받았다.
스키조키트리움 속 ( Schizochytrium sp.) 미세조류 유래 바이오매스(biomass)
본 명세서에서, 용어 “바이오매스(biomass)”는 화학적 에너지로 사용 가능한 식물, 동물, 미생물 등의 생물체, 즉 바이오에너지의 에너지원을 의미하며, 생태학적으로 단위 시간 및 공간 내에 존재하는 특정 생물체의 중량 또는 에너지량을 의미하기도 한다. 또한, 상기 바이오매스는 세포에 의해 분비되는 화합물을 포함하지만 이에 한정되지 않고, 세포외 물질뿐만 아니라 세포 및/또는 세포 내 내용물을 함유하는 것일 수 있다.
본 명세서에서, 미세조류 유래 바이오매스는 미세조류 그 자체, 이의 배양물, 이의 발효물, 이의 건조물, 이의 파쇄물, 또는 상기 미세조류를 배양하거나 발효하여 생산된 산물을 포함할 수 있으며, 또는 상기 바이오매스의 농축물 또는 건조물을 포함할 수 있으나, 이에 한정되는 것은 아니다. 일 구현예에 있어서, 상기 미세조류 유래 바이오매스는 미세조류, 상기 미세조류의 배양물, 상기 배양물의 건조물, 및 상기 건조물의 파쇄물로 이루어지는 군에서 선택되는 1종 이상을 포함하는 것일 수 있다. 건조는 분무건조, 열풍건조, 동결건조, 자연건조, 진공건조에 의하여 이루어질 수 있으나, 이에 제한되지 않는다.
상기 미세조류의 "배양물"은 상기 미세조류를 배양하여 생성된 산물을 지칭하는 것으로, 구체적으로 미세조류를 포함하는 배양액 또는 상기 배양액에서 미세조류가 제거된 배양여액일 수 있으나, 이에 제한되는 것은 아니다. 상기 미세조류 배양물의 "건조물"은 상기 미세조류 배양물에서 수분이 제거된 것으로, 예를 들어 상기 미세조류의 건조 균체 형태일 수 있으나, 이에 제한되는 것은 아니다. 또한, 상기 건조물의 "파쇄물"은 상기 미세조류 배양물에서 수분이 제거된 건조물을 파쇄한 결과물을 총칭하는 것으로, 예를 들어 건조 균체 분말일 수 있으나, 이에 제한되는 것은 아니다. 상기 미세조류의 배양물은 미세조류 배양 배지에 상기 미세조류를 접종하고, 당업계에 공지된 배양 방법에 따라 제조될 수 있고, 상기 배양물의 건조물 및 이의 파쇄물 역시 당업계에 공지된 미세조류 또는 배양액의 처리 또는 건조 방법에 따라 제조될 수 있다.
일 구현예에 있어서, 상술한 미세조류 유래 바이오매스는 단백질(조단백질, crude protein)을 40 중량% 내지 95 중량%로 포함할 수 있고, 보다 구체적으로, 40 중량% 내지 95 중량%, 40 중량% 내지 90 중량%, 40 중량% 내지 85 중량%, 40 중량% 내지 82.5 중량%, 40 중량% 내지 81.5 중량%, 40 중량% 내지 80.5 중량%, 50 중량% 내지 95 중량%, 50 중량% 내지 90 중량%, 50 중량% 내지 85 중량%, 50 중량% 내지 82.5 중량%, 50 중량% 내지 81.5 중량%, 50 중량% 내지 80.5 중량%, 60 중량% 내지 95 중량%, 60 중량% 내지 90 중량%, 60 중량% 내지 85 중량%, 60 중량% 내지 82.5 중량%, 60 중량% 내지 81.5 중량%, 60 중량% 내지 80.5 중량%, 70 중량% 내지 95 중량%, 70 중량% 내지 90 중량%, 70 중량% 내지 85 중량%, 70 중량% 내지 82.5 중량%, 70 중량% 내지 81.5 중량%, 70 중량% 내지 80.5 중량%, 75 중량% 내지 95 중량%, 75 중량% 내지 90 중량%, 75 중량% 내지 85 중량%, 75 중량% 내지 82.5 중량%, 75 중량% 내지 81.5 중량%, 75 중량% 내지 80.5 중량%, 77.5 중량% 내지 95 중량%, 77.5 중량% 내지 90 중량%, 77.5 중량% 내지 85 중량%, 77.5 중량% 내지 82.5 중량%, 77.5 중량% 내지 81.5 중량%, 77.5 중량% 내지 80.5 중량%, 79.5 중량% 내지 95 중량%, 79.5 중량% 내지 90 중량%, 79.5 중량% 내지 85 중량%, 79.5 중량% 내지 82.5 중량%, 79.5 중량% 내지 81.5 중량%, 또는 79.5 중량% 내지 80.5 중량%로 포함할 수 있으나, 이에 한정되는 것은 아니다.
일 구현예에 있어서, 상술한 미세조류 유래 바이오매스는 지방(조지방, crude lipids)을 3 중량% 내지 30 중량%로 포함할 수 있고, 보다 구체적으로, 3 중량% 내지 30 중량%, 3 중량% 내지 20 중량%, 3 중량% 내지 15 중량%, 3 중량% 내지 13 중량%, 3 중량% 내지 12 중량%, 6 중량% 내지 30 중량%, 6 중량% 내지 20 중량%, 6 중량% 내지 15 중량%, 6 중량% 내지 16 중량%, 6 중량% 내지 12 중량%, 9 중량% 내지 30 중량%, 9 중량% 내지 20 중량%, 9 중량% 내지 15 중량%, 9 중량% 내지 16 중량%, 9 중량% 내지 12 중량%, 10 중량% 내지 30 중량%, 10 중량% 내지 20 중량%, 10 중량% 내지 15 중량%, 10 중량% 내지 16 중량%, 10 중량% 내지 12 중량%, 11 중량% 내지 30 중량%, 11 중량% 내지 20 중량%, 11 중량% 내지 15 중량%, 11 중량% 내지 16 중량%, 또는 11 중량% 내지 12 중량%로 포함할 수 있으나, 이에 한정되는 것은 아니다.
일 구현예에 있어서, 상술한 미세조류 유래 바이오매스는 수분(moisture)을 0.05 중량% 내지 5 중량%로 포함할 수 있고, 보다 구체적으로, 0.05 중량% 내지 5 중량%, 0.05 중량% 내지 3 중량%, 0.05 중량% 내지 1.75 중량%, 0.05 중량% 내지 1.5 중량%, 0.05 중량% 내지 1 중량%, 0.05 중량% 내지 0.7 중량%, 0.1 중량% 내지 5 중량%, 0.1 중량% 내지 3 중량%, 0.1 중량% 내지 1.75 중량%, 0.1 중량% 내지 1.5 중량%, 0.1 중량% 내지 1 중량%, 0.1 중량% 내지 0.7 중량%, 0.5 중량% 내지 5 중량%, 0.5 중량% 내지 3 중량%, 0.5 중량% 내지 1.75 중량%, 0.5 중량% 내지 1.5 중량%, 0.5 중량% 내지 1 중량%, 0.5 중량% 내지 0.7 중량%, 0.6 중량% 내지 5 중량%, 0.6 중량% 내지 3 중량%, 0.6 중량% 내지 1.75 중량%, 0.6 중량% 내지 1.5 중량%, 0.6 중량% 내지 1 중량%, 0.6 중량% 내지 0.7 중량%로 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서 회분은 시료를 태워 생기는 재 또는 시료에 포함된 무기질의 총합을 의미할 수 있다. 회분은 미네랄, 무기질, 무기염류, 광물질 등의 용어와 혼용되어 사용될 수 있으며, 칼슘, 인, 칼륨, 황, 나트륨, 염소, 마그네슘, 철, 구리, 망간, 요오드, 코발트, 아연, 몰리브덴, 셀레늄, 크로뮴, 플루오르, 붕소, 비소, 주석, 규소, 바나듐, 및 니켈 등으로 이루어지는 군에서 선택되는 1종 이상의 무기원소를 포함할 수 있다.
일 구현예에 있어서, 상술한 미세조류 유래 바이오매스는 회분(ash)을 2.5 중량% 내지 20 중량%로 포함할 수 있고, 보다 구체적으로, 2.5 중량% 내지 20 중량%, 2.5 중량% 내지 15 중량%, 2.5 중량% 내지 13.5 중량%, 2.5 중량% 내지 12.5 중량%, 2.5 중량% 내지 10 중량%, 2.5 중량% 내지 8 중량%, 2.5 중량% 내지 7.5 중량%, 5 중량% 내지 20 중량%, 5 중량% 내지 15 중량%, 5 중량% 내지 13.5 중량%, 5 중량% 내지 12.5 중량%, 5 중량% 내지 10 중량%, 5 중량% 내지 8 중량%, 5 중량% 내지 7.5 중량%, 7 중량% 내지 20 중량%, 7 중량% 내지 15 중량%, 7 중량% 내지 13.5 중량%, 7 중량% 내지 12.5 중량%, 7 중량% 내지 10 중량%, 7 중량% 내지 8 중량%, 또는 7 중량% 내지 7.5 중량%로 포함할 수 있으나, 이에 한정되는 것은 아니다.
일 구현예에 있어서, 상술한 미세조류 유래 바이오매스는, 총 아미노산 100 중량부를 기준으로, 글루탐산(glutamic acid)을 30 중량부 내지 70 중량부로 포함할 수 있고, 보다 구체적으로, 30 중량부 내지 70 중량부, 30 중량부 내지 60 중량부, 30 중량부 내지 57 중량부, 30 중량부 내지 54 중량부, 45 중량부 내지 70 중량부, 45 중량부 내지 60 중량부, 45 중량부 내지 57 중량부, 45 중량부 내지 54 중량부, 50 중량부 내지 70 중량부, 50 중량부 내지 60 중량부, 50 중량부 내지 57 중량부, 50 중량부 내지 54 중량부, 53 중량부 내지 70 중량부, 53 중량부 내지 60 중량부, 53 중량부 내지 57 중량부, 또는 53 중량부 내지 54 중량부로 포함할 수 있으나, 이에 한정되는 것은 아니다.
일 구현예에 있어서, 상술한 미세조류 유래 바이오매스는, 총 아미노산 100 중량부를 기준으로, 아르기닌(arginine)을 7 중량부 내지 25 중량부로 포함할 수 있고, 보다 구체적으로, 7 중량부 내지 25 중량부, 7 중량부 내지 20 중량부, 7 중량부 내지 15 중량부, 7 중량부 내지 13 중량부, 10 중량부 내지 25 중량부, 10 중량부 내지 20 중량부, 10 중량부 내지 15 중량부, 10 중량부 내지 13 중량부, 12 중량부 내지 25 중량부, 12 중량부 내지 20 중량부, 12 중량부 내지 15 중량부, 또는 12 중량부 내지 13 중량부로 포함할 수 있으나, 이에 한정되는 것은 아니다.
일 구현예에 있어서, 상술한 미세조류 유래 바이오매스는, 총 지방산 100 중량부를 기준으로, 팔미트산(palmitic acid)을 20 중량부 내지 50 중량부로 포함할 수 있고, 보다 구체적으로, 20 중량부 내지 50 중량부, 20 중량부 내지 40 중량부, 20 중량부 내지 37 중량부, 30 중량부 내지 50 중량부, 30 중량부 내지 40 중량부, 30 중량부 내지 37 중량부, 36 중량부 내지 50 중량부, 36 중량부 내지 40 중량부, 또는 36 중량부 내지 37 중량부로 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서, 용어 “팔미트산(palmitic acid)”은 CH3(CH2)14COOH의 화학식을 갖는 포화지방산 중 하나로, 헥사데칸산(hexadecanoic acid)이라고도 불리며, 약칭으로 C16:0 으로도 표기될 수 있다.
일 구현예에 있어서, 상술한 미세조류 유래 바이오매스는, 총 지방산 100 중량부를 기준으로, 도코사헥사엔산(docosahexaenoic acid, (4Z,7Z,10Z,13Z,16Z,19Z)-Docosa-4,7,10,13,16,19-hexaenoic acid, DHA)을 30 중량부 내지 60 중량부로 포함할 수 있고, 보다 구체적으로, 30 중량부 내지 60 중량부, 30 중량부 내지 50 중량부, 30 중량부 내지 46 중량부, 40 중량부 내지 60 중량부, 40 중량부 내지 50 중량부, 40 중량부 내지 46 중량부, 45 중량부 내지 60 중량부, 45 중량부 내지 50 중량부, 또는 45 중량부 내지 46 중량부로 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서, 용어 “도코사헥사엔산(docosahexaenoic acid, (4Z,7Z,10Z,13Z,16Z,19Z)-Docosa-4,7,10,13,16,19-hexaenoic acid, DHA)”은 C22H32O2의 화학식을 갖는 다중불포화지방산 중 하나로, 알파-리놀렌산(α-linolenic acid: ALA) 및 에이코사펜타엔산(eicosapentaenoic acid: EPA)과 함께 오메가-3 지방산에 해당하며, 관용명은 세르본산(cervonic acid)이고, 약칭으로 C22:6n3으로도 표기될 수 있다. 도코사헥사엔산은 어류 체내에서 생산할 수 없기 때문에 먹이를 통해 섭취해야 하며, 어류의 신진대사와 세포 기능에 중요한 역할을 하는 필수 지방산으로 알려져 있다.
사료 조성물
본 명세서에서, 용어 "사료 조성물"은 동물 (동물성 플랑크톤, 가축, 어류 등의 단세포 또는 다세포 종속영양 생물을 포함한다)에 영양이 되거나 그 건강유지 또는 성장에 필요한 것을 의미할 수 있다. 상기 사료 조성물은 단미사료, 배합사료, 또는 보조사료일 수 있다. 상기 단미사료는 식물성, 동물성 또는 광물성 물질로서 사료로 직접 사용되거나 배합사료의 원료로 사용되는 것을 의미할 수 있다. 상기 보조사료는 사료의 품질저하 방지 또는 사료의 효용을 높이기 위하여 사료에 첨가하는 것을 의미할 수 있다. 상기 배합사료는 단미사료, 보조사료 등을 적정한 비율로 배합 또는 가공한 것일 수 있다.
상기 사료 조성물은 동물의 생명을 유지, 또는 고기, 젖 등을 생산하는데 필요한 유기 또는 무기 영양소를 공급하는 물질을 의미할 수 있다. 상기 사료 조성물은 동물의 생명 유지, 또는 고기, 젖 등을 생산하는 필요한 영양성분을 추가적으로 포함할 수 있다. 상기 사료 조성물은 당업계의 공지된 다양한 형태의 사료로 제조 가능하며, 구체적으로는 농후사료, 조사료 및/또는 특수사료가 포함될 수 있다. 또는 상기 사료 조성물은 배합사료 (Extruded pellet, EP사료, 건사료) 또는 생사료 (Moist pellet, MP사료, 습사료), 반죽사료 등의 형태로 제조할 수 있다.
본 명세서에서 사료 첨가제는 영양소 보충 및 체중감소 예방, 사료 내 섬유소의 소화 이용성 증진, 유질 개선, 번식장애 예방 및 수태율 향상, 하절기 고온 스트레스 예방 등 다양한 효과를 목적으로 사료에 첨가하는 물질을 포함할 수 있다. 상기 사료 첨가제는 사료관리법상의 보조사료를 의미할 수 있으며, 탄산수소나트륨, 벤토나이트(bentonite), 산화마그네슘, 복합광물질 등의 광물질제제, 아연, 구리, 코발트, 셀레늄 등의 미량 광물질인 미네랄제제, 케로틴, 비타민 E, 비타민 A, D, E, 니코틴산, 비타민 B 복합체 등의 비타민제, 메티오닌, 리신 등의 보호아미노산제, 지방산 칼슘염 등의 보호지방산제, 생균제(유산균제), 효모배양물, 곰팡이 발효물 등의 생균, 효모제 등을 추가로 포함할 수 있다.
본 명세서에서, 용어 “사료 조성물”은 “사료 첨가제”를 포괄하는 의미로 해석될 수 있다.
상기 사료 조성물은 곡물, 예를 들면 분쇄 또는 파쇄된 밀, 귀리, 보리, 옥수수 및 쌀; 식물성 단백질 사료, 예를 들면 콩 및 해바라기를 주성분으로 하는 사료; 동물성 단백질 사료, 예를 들면 어분, 혈분, 육분 및/또는 골분; 당분 및 유제품, 예를 들면 각종 분유 및 유장 분말로 이루어지는 건조 성분 등을 더 포함할 수 있으며, 이외에도 영양 보충제, 소화 및 흡수 향상제, 성장 촉진제 등을 더 포함할 수 있다.
상기 사료 조성물은 동물에게 단독으로 투여하거나 식용 담체 중에서 다른 사료 첨가제와 조합하여 투여할 수도 있다. 또한, 상기 사료 조성물은 탑 드레싱으로서 또는 이들을 사료에 직접 혼합하거나 또는 사료와 별도의 경구 제형으로 용이하게 동물에게 투여할 수 있다. 상기 조성물을 사료와 별도로 투여할 경우, 당해 기술분야에 잘 알려진 바와 같이 사료 분야에서 허용 가능한 식용 담체와 조합하여, 즉시 방출 또는 서방성 제형으로 제조할 수 있다. 상기 식용 담체는 고체 또는 액체, 예를 들어 옥수수 전분, 락토오스, 수크로오스, 콩 플레이크, 땅콩유, 올리브유, 참깨유 및 프로필렌글리콜일 수 있다. 고체 담체가 사용될 경우, 상기 사료 조성물은 정제, 캡슐제, 산제, 트로키제 또는 함당정제 또는 미분산성 형태의 탑 드레싱일 수 있다. 액체 담체가 사용될 경우, 상기 사료 조성물은 젤라틴 연질 캡슐제, 또는 시럽제나 현탁액, 에멀젼제, 또는 용액제의 제형일 수 있다.
상기 사료 조성물은, 예를 들어, 보존제, 안정화제, 습윤제 또는 유화제, 동결보호제, 또는 부형제 등을 포함할 수 있다. 상기 동결보호제는, 글리세롤, 트레할로스, 말토덱스트린, 탈지분유 및 전분으로 이루어진 군으로부터 선택되는 하나 이상일 수 있다. 상기 보존제, 안정화제, 또는 부형제는 상기 사료 조성물에 포함되는 미세조류의 저하(deterioration)를 감소시키는데 충분한 유효량으로 조성물에 포함되는 것일 수 있다. 또한, 상기 동결보호제는 상기 조성물이 건조된 상태일 때 조성물에 포함되는 상기 미세조류의 저하를 감소시키는데 충분한 유효량으로 조성물에 포함되는 것일 수 있다.
상기 사료 조성물은 침주, 분무 또는 혼합하여 동물의 사료에 첨가하여 이용될 수 있다.
상기 사료 조성물은 포유류, 조류, 어류, 갑각류, 두족류, 파충류 및 양서류를 포함하는 다수의 동물 식이에 적용할 수 있으나, 이에 제한되지 않는다. 예를 들어, 상기 포유류는 돼지, 소, 양, 염소, 실험용 설치 동물, 또는 애완 동물 등을 포함할 수 있고, 상기 조류는 가금류를 포함할 수 있고, 상기 가금류는 닭, 칠면조, 오리, 거위, 꿩, 또는 메추라기 등을 포함할 수 있으나, 이에 제한되지 않는다. 상기 갑각류는 새우, 따개비 등을 포함할 수 있으나, 이에 제한되지 않는다. 또한, 상기 사료 조성물은 동물성 플랑크톤, 예컨대 로티퍼(rotifer), 알테미아(artemia), 물벼룩(daphnia pulex) 등의 식이에도 적용될 수 있다. 또한, 상기 어류는 담수어류, 해수어류, 상업적 축양 어류 및 이의 치어류, 관상어 등을 포함할 수 있다.
장어용 사료 조성물
본 출원의 일 예는 상술한 스키조키트리움 속 (Schizochytrium sp.) 미세조류 유래 바이오매스를 포함하는, 장어용 사료 조성물을 제공한다.
상기 스키조키트리움 속 (Schizochytrium sp.) 미세조류, 상기 미세조류 유래 바이오매스 및 사료 조성물은 앞서 설명한 바와 같다.
본 명세서에서, 용어 “장어”는 장어과 장어속에 속하는 어류를 의미하며, “민물장어” 또는 “뱀장어”와 혼용되어 사용될 수 있다. 일 구현예에서, 상기 장어는 일본장어(Anguilla japonica), 큰장어(Anguilla marmorata), 유럽장어(Anguilla anguilla), 미국장어(Anguilla rostrata) 및 비콜라장어(Anguilla bicolor)로 이루어지는 군으로부터 선택되는 1종 이상인 것일 수 있고, 보다 구체적으로 일본장어(Anguilla japonica)일 수 있으나, 이에 한정되지 않는다.
후술할 실시예에서 입증된 바와 같이, 상술한 미세조류 바이오매스를 포함하는 사료 조성물은 장어의 성장을 촉진할 수 있다.
일 구현예에서, 본 출원의 장어용 사료 조성물은 상술한 미세조류 유래 바이오매스를 2.25 중량% 내지 45 중량%으로 포함할 수 있고, 보다 구체적으로, 2.25 중량% 내지 45 중량%, 2.25 중량% 내지 30 중량%, 2.25 중량% 내지 25 중량%, 2.25 중량% 내지 22.5 중량%, 2.25 중량% 내지 20 중량%, 2.25 중량% 내지 17.5 중량%, 2.25 중량% 내지 15 중량%, 2.25 중량% 내지 13.3 중량%, 2.25 중량% 내지 12 중량%, 2.25 중량% 내지 10 중량%, 2.25 중량% 내지 8 중량%, 2.25 중량% 내지 7.5 중량%, 2.25 중량% 내지 7 중량%, 2.25 중량% 내지 6.6 중량%, 2.25 중량% 내지 6.5 중량%, 2.25 중량% 내지 6 중량%, 2.25 중량% 내지 5 중량%, 2.25 중량% 내지 4 중량%, 2.25 중량% 내지 3.3 중량%, 3 중량% 내지 45 중량%, 3 중량% 내지 30 중량%, 3 중량% 내지 25 중량%, 3 중량% 내지 22.5 중량%, 3 중량% 내지 20 중량%, 3 중량% 내지 17.5 중량%, 3 중량% 내지 15 중량%, 3 중량% 내지 13.3 중량%, 3 중량% 내지 12 중량%, 3 중량% 내지 10 중량%, 3 중량% 내지 8 중량%, 3 중량% 내지 7.5 중량%, 3 중량% 내지 7 중량%, 3 중량% 내지 6.6 중량%, 3 중량% 내지 6.5 중량%, 3 중량% 내지 6 중량%, 3 중량% 내지 5 중량%, 3 중량% 내지 4 중량%, 3 중량% 내지 3.3 중량%, 4 중량% 내지 45 중량%, 4 중량% 내지 30 중량%, 4 중량% 내지 25 중량%, 4 중량% 내지 22.5 중량%, 4 중량% 내지 20 중량%, 4 중량% 내지 17.5 중량%, 4 중량% 내지 15 중량%, 4 중량% 내지 13.3 중량%, 4 중량% 내지 12 중량%, 4 중량% 내지 10 중량%, 4 중량% 내지 8 중량%, 4 중량% 내지 7.5 중량%, 4 중량% 내지 7 중량%, 4 중량% 내지 6.6 중량%, 4 중량% 내지 6.5 중량%, 4 중량% 내지 6 중량%, 4 중량% 내지 5 중량%, 5 중량% 내지 45 중량%, 5 중량% 내지 30 중량%, 5 중량% 내지 25 중량%, 5 중량% 내지 22.5 중량%, 5 중량% 내지 20 중량%, 5 중량% 내지 17.5 중량%, 5 중량% 내지 15 중량%, 5 중량% 내지 13.3 중량%, 5 중량% 내지 12 중량%, 5 중량% 내지 10 중량%, 5 중량% 내지 8 중량%, 5 중량% 내지 7.5 중량%, 5 중량% 내지 7 중량%, 5 중량% 내지 6.6 중량%, 5 중량% 내지 6.5 중량%, 5 중량% 내지 6 중량%, 6 중량% 내지 45 중량%, 6 중량% 내지 30 중량%, 6 중량% 내지 25 중량%, 6 중량% 내지 22.5 중량%, 6 중량% 내지 20 중량%, 6 중량% 내지 17.5 중량%, 6 중량% 내지 15 중량%, 6 중량% 내지 13.3 중량%, 6 중량% 내지 12 중량%, 6 중량% 내지 10 중량%, 6 중량% 내지 8 중량%, 6 중량% 내지 7.5 중량%, 6 중량% 내지 7 중량%, 6 중량% 내지 6.6 중량%, 6 중량% 내지 6.5 중량%, 6.5 중량% 내지 45 중량%, 6.5 중량% 내지 30 중량%, 6.5 중량% 내지 25 중량%, 6.5 중량% 내지 22.5 중량%, 6.5 중량% 내지 20 중량%, 6.5 중량% 내지 17.5 중량%, 6.5 중량% 내지 15 중량%, 6.5 중량% 내지 13.3 중량%, 6.5 중량% 내지 12 중량%, 6.5 중량% 내지 10 중량%, 6.5 중량% 내지 8 중량%, 6.5 중량% 내지 7.5 중량%, 6.5 중량% 내지 7 중량%, 6.5 중량% 내지 6.6 중량%, 6.6 중량% 내지 45 중량%, 6.6 중량% 내지 30 중량%, 6.6 중량% 내지 25 중량%, 6.6 중량% 내지 22.5 중량%, 6.6 중량% 내지 20 중량%, 6.6 중량% 내지 17.5 중량%, 6.6 중량% 내지 15 중량%, 6.6 중량% 내지 13.3 중량%, 6.6 중량% 내지 12 중량%, 6.6 중량% 내지 10 중량%, 6.6 중량% 내지 8 중량%, 6.6 중량% 내지 7.5 중량%, 6.6 중량% 내지 7 중량%, 7 중량% 내지 45 중량%, 7 중량% 내지 30 중량%, 7 중량% 내지 25 중량%, 7 중량% 내지 22.5 중량%, 7 중량% 내지 20 중량%, 7 중량% 내지 17.5 중량%, 7 중량% 내지 15 중량%, 7 중량% 내지 13.3 중량%, 7 중량% 내지 12 중량%, 7 중량% 내지 10 중량%, 7 중량% 내지 8 중량%, 7 중량% 내지 7.5 중량%, 7.5 중량% 내지 45 중량%, 7.5 중량% 내지 30 중량%, 7.5 중량% 내지 25 중량%, 7.5 중량% 내지 22.5 중량%, 7.5 중량% 내지 20 중량%, 7.5 중량% 내지 17.5 중량%, 7.5 중량% 내지 15 중량%, 7.5 중량% 내지 13.3 중량%, 7.5 중량% 내지 12 중량%, 7.5 중량% 내지 10 중량%, 7.5 중량% 내지 8 중량%, 8 중량% 내지 45 중량%, 8 중량% 내지 30 중량%, 8 중량% 내지 25 중량%, 8 중량% 내지 22.5 중량%, 8 중량% 내지 20 중량%, 8 중량% 내지 17.5 중량%, 8 중량% 내지 15 중량%, 8 중량% 내지 13.3 중량%, 8 중량% 내지 12 중량%, 8 중량% 내지 10 중량%, 10 중량% 내지 45 중량%, 10 중량% 내지 30 중량%, 10 중량% 내지 25 중량%, 10 중량% 내지 22.5 중량%, 10 중량% 내지 20 중량%, 10 중량% 내지 17.5 중량%, 10 중량% 내지 15 중량%, 10 중량% 내지 13.3 중량%, 10 중량% 내지 12 중량%, 12 중량% 내지 45 중량%, 12 중량% 내지 30 중량%, 12 중량% 내지 25 중량%, 12 중량% 내지 22.5 중량%, 12 중량% 내지 20 중량%, 12 중량% 내지 17.5 중량%, 12 중량% 내지 15 중량%, 12 중량% 내지 13.3 중량%, 13.3 중량% 내지 45 중량%, 13.3 중량% 내지 30 중량%, 13.3 중량% 내지 25 중량%, 13.3 중량% 내지 22.5 중량%, 13.3 중량% 내지 20 중량%, 13.3 중량% 내지 17.5 중량%, 13.3 중량% 내지 15 중량%, 15 중량% 내지 45 중량%, 15 중량% 내지 30 중량%, 15 중량% 내지 25 중량%, 15 중량% 내지 22.5 중량%, 15 중량% 내지 20 중량%, 15 중량% 내지 17.5 중량%, 17.5 중량% 내지 45 중량%, 17.5 중량% 내지 30 중량%, 17.5 중량% 내지 25 중량%, 17.5 중량% 내지 22.5 중량%, 17.5 중량% 내지 20 중량%, 20 중량% 내지 45 중량%, 20 중량% 내지 30 중량%, 20 중량% 내지 25 중량%, 또는 20 중량% 내지 22.5 중량%로 포함할 수 있으나, 이에 한정되는 것은 아니다.
일 구현예에 있어서, 상기 장어용 사료 조성물은, 총 지방산 100 중량부를 기준으로, 팔미트산(palmitic acid)을 21 중량부 내지 30 중량부로 포함할 수 있고, 보다 구체적으로, 21 중량부 내지 30 중량부, 21 중량부 내지 25 중량부, 21 중량부 내지 23.75 중량부, 21 중량부 내지 22.5 중량부, 21 중량부 내지 21.25 중량부, 21.25 중량부 내지 30 중량부, 21.25 중량부 내지 25 중량부, 21.25 중량부 내지 23.75 중량부, 21.25 중량부 내지 22.5 중량부, 22.5 중량부 내지 30 중량부, 22.5 중량부 내지 25 중량부, 22.5 중량부 내지 23.75 중량부, 23.75 중량부 내지 30 중량부, 23.75 중량부 내지 25 중량부, 25 중량부 내지 30 중량부로 포함할 수 있다.
일 구현예에 있어서, 상기 장어용 사료 조성물에 포함되는 미세조류 유래 바이오매스의 함량이 증가할수록, 상기 장어용 사료 조성물에 포함되는 팔미트산의 함량이 증가할 수 있다.
일 구현예에 있어서, 상기 장어용 사료 조성물은, 총 지방산 100 중량부를 기준으로, 도코사헥사엔산(docosahexaenoic acid, (4Z,7Z,10Z,13Z,16Z,19Z)-Docosa-4,7,10,13,16,19-hexaenoic acid, DHA)을 15 중량부 내지 27 중량부, 보다 구체적으로, 15 중량부 내지 27 중량부, 15 중량부 내지 23 중량부, 15 중량부 내지 20.25 중량부, 15 중량부 내지 18 중량부, 15 중량부 내지 16.25 중량부, 16.25 중량부 내지 27 중량부, 16.25 중량부 내지 23 중량부, 16.25 중량부 내지 20.25 중량부, 16.25 중량부 내지 18 중량부, 18 중량부 내지 27 중량부, 18 중량부 내지 23 중량부, 18 중량부 내지 20.25 중량부, 20.25 중량부 내지 27 중량부, 20.25 중량부 내지 23 중량부, 또는 23 중량부 내지 27 중량부로 포함할 수 있으나, 이에 한정되는 것은 아니다.
일 구현예에 있어서, 상기 장어용 사료 조성물에 포함되는 미세조류 유래 바이오매스의 함량이 증가할수록, 상기 장어용 사료 조성물에 포함되는 도코사헥사엔산의 함량이 증가할 수 있다.
본 출원의 일 예에 따른 장어용 사료 조성물은 단백질, 탄수화물, 지방 등을 더 포함할 수 있다. 이스트, 녹말, 셀룰로오스, 비타민
일 구현예에서, 본 출원의 장어용 사료 조성물은 어분을 추가적으로 포함할 수 있다.
일 구현예에 있어서, 본 출원의 장어용 사료 조성물은 효모(예컨대 효모배양물, 곰팡이 발효물 등의 생균, 효모제), 비타민(예컨대 케로틴, 비타민 E, 비타민 A, D, E, 니코틴산, 비타민 B 복합체 등의 비타민제), 미네랄(예컨대 탄산수소나트륨, 벤토나이트(bentonite), 산화마그네슘, 복합광물질 등의 광물질제제, 아연, 구리, 코발트, 셀레늄 등의 미량 광물질인 미네랄 제제) 및 전분으로 이루어지는 군으로부터 선택되는 1종 이상을 추가적으로 포함할 수 있다.
일 구현예에 있어서, 상기 장어용 사료 조성물은 장어의 성장을 촉진시키는 것일 수 있다. 상기 장어의 성장을 촉진시키는 것은, 장어의 증체율(WGR, Weight Gain Rate), 사료효율(FE, Feed Efficiency), 및/또는 일성장률(SGR, Specific Growth Rate)을 증가시키는 것일 수 있다. 예를 들어, 상기 장어용 사료 조성물을 장어에 급이하는 경우, 미세조류 유래 바이오매스를 포함하지 않는 사료용 조성물을 급이하는 경우 대비 장어의 증체율(WGR, Weight Gain Rate), 사료효율(FE, Feed Efficiency), 및/또는 일성장률(SGR, Specific Growth Rate)이 증가할 수 있다.
후술할 실시예에서 입증된 바와 같이, 상기 미세조류 유래 바이오매스를 포함하는 장어용 사료 조성물을 섭취한 장어의 경우, 증체율(WGR, Weight Gain Rate), 사료효율(FE, Feed Efficiency), 및/또는 일성장률(SGR, Specific Growth Rate)이 증가되어, 본 출원의 장어용 사료 조성물이 장어의 성장을 촉진시키는 효과를 가짐을 확인할 수 있었다.
상술한 본 출원의 사료 조성물은 장어의 성장을 촉진시켜, 장어용 사료 조성물로 유용하게 사용될 수 있다.
장어의 양식방법
본 출원의 다른 양태에 따르면, 본 출원은 상술한 스키조키트리움 속 미세조류 유래 바이오매스를 포함하는 장어용 사료 조성물을 장어에 급이하는 단계를 포함하는 장어의 양식방법을 제공한다.
상기 방법에 있어서, 상기 급이하는 단계 이전에, 상술한 스키조키트리움 속 미세조류 유래 바이오매스를 포함하는 장어용 사료 조성물을 준비하는 단계를 추가로 포함할 수 있다.
상기 방법에 있어서, 상기 급이하는 단계는 장어에 먹이를 제공하는 모든 방법에 의하여 수행될 수 있으며, 예를 들어, 상술한 스키조키트리움 속 미세조류 유래 바이오매스를 포함하는 장어용 사료 조성물을 장어(상기 장어가 포함된 수생 환경을 포함하는 것으로 해석될 수 있음)에 공급 또는 첨가하는 단계를 포함할 수 있으나, 이에 제한되는 것은 아니다.
상기 방법에 있어서, 상술한 스키조키트리움 속 미세조류 유래 바이오매스를 포함하는 장어용 사료 조성물의 급이량은 급이 대상 장어의 종류, 크기, 상태, 급이 목적 등에 따라서 적절히 결정될 수 있다. 일 구체예에서, 상기 스키조키트리움 속 미세조류 유래 바이오매스를 포함하는 장어용 사료 조성물의 급이량은 장어 체중을 기준으로 1%(w/w) 내지 15%(w/w), 보다 구체적으로 1%(w/w) 내지 15%(w/w), 1%(w/w) 내지 10%(w/w), 1%(w/w) 내지 8%(w/w), 1%(w/w) 내지 7%(w/w), 2%(w/w) 내지 15%(w/w), 2%(w/w) 내지 10%(w/w), 2%(w/w) 내지 8%(w/w), 2%(w/w) 내지 7%(w/w), 3%(w/w) 내지 15%(w/w), 3%(w/w) 내지 10%(w/w), 3%(w/w) 내지 8%(w/w), 또는 3%(w/w) 내지 7%(w/w)일 수 있으나, 이에 한정되는 것은 아니다.
상기 스키조키트리움 속 미세조류 유래 바이오매스, 장어용 사료 조성물, 및 장어의 성장 촉진은 앞서 설명한 바와 같다.
본 출원의 다른 양태에 따르면, 본 출원은 상술한 스키조키트리움 속 미세조류 유래 바이오매스를 포함하는 장어용 사료 조성물을 장어에 급이하는 단계를 포함하는, 장어의 성장 촉진 방법을 제공한다.
본 출원의 다른 양태에 따르면, 본 출원은 상술한 스키조키트리움 속 미세조류 유래 바이오매스 및/또는 스키조키트리움 속 미세조류 유래 바이오매스를 포함하는 장어용 사료 조성물의 장어 성장 촉진 용도를 제공한다.
상기 스키조키트리움 속 미세조류 유래 바이오매스, 장어용 사료 조성물, 및 장어의 성장 촉진은 앞서 설명한 바와 같다.
본 발명은 스키조키트리움 속 (Schizochytrium sp.) 미세조류 유래 바이오매스를 포함하는 장어용 사료 조성물, 이를 이용한 장어의 양식방법에 관한 것이다. 본 발명의 스키조키트리움 속 (Schizochytrium　sp.) 미세조류 유래 바이오매스를 포함하는 장어용 사료 조성물을 장어에 급이하는 경우, 장어의 성장이 촉진되므로, 장어용 사료 조성물 또는 사료 첨가제로서 유용하게 활용될 수 있다.
도 1은 스키조키트리움 속 (Schizochytrium sp.) CD03-7004 변이균주와 야생형 스키조키트리움 속(Schizochytrium sp.) 균주 CD01-5000의 순수 분리 배양 결과, 색깔의 차이를 나타낸 도이다.
도 2는 야생형 CD01-5000 균주 대비 돌연변이 CD03-7004 균주에서 추가된 15 bp의 염기서열을 포함하는 DNA 단편을 증폭하는 프라이머 세트를 이용하여 PCR을 수행한 후, 야생형 CD01-5000 균주와 돌연변이 CD03-7004 균주의 증폭된 DNA 단편의 크기를 확인한 도이다.
이하, 실시예를 통하여 본 출원을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 출원을 보다 구체적으로 설명하기 위한 것으로, 본 출원의 요지에 따라 본 출원의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
(본 명세서 전체에 걸쳐, 특정 물질의 농도를 나타내기 위하여 사용되는 "%"는 별도의 언급이 없는 경우, 고체/고체는 (중량/중량) %, 고체/액체는 (중량/부피) %, 그리고 액체/액체는 (부피/부피) %이다.)
실시예 1: 연구재료 및 방법
1-1. 시험어 및 사육 관리
수조는 1 톤 사각수조 (working vol 60L)를 사용하며, 사육수조 3기와 여과조 2기로 1 set로 구성하였다. 시험방법은 현재 (주)코팩스 중앙연구소에서 사육 관리중인 시험어인 육성기 장어(민물장어, Anguilla Japonica) (약 20 g size)를 각 시험수조에 25마리씩 이식한 다음. 1주간의 순치양식 후 제조된 시험사료를 체중(body weight)의 3-7%(w/w)로, 1일 2회 (07:30, 14:30) 공급하여 8주간 사육하였다. 시험사료 공급 20-30분 후 잔여사료는 회수하여 동결건조하여 무게 측정한 다음 매회 사료공급 량에서 제외하였다. 각 시험구 수조는 온도는 29℃, D.O.는 6.5, pH 5.8 ±0.5로 관리하였다. NH3, NO2는 각 시험수조 여과조에서 1회/1일 채수하여 화학적 분석방법으로 측정하였다.
사육시험 종료 후 모든 수조의 장어 개체는 전수 무게를 측정하였으며, 이를 토대로 성장 성과(growth performance)를 다음과 같이 평가하였다.
초기무게 (IW) (g), Initial Weight (g/fish)
최종무게 (FW) (g), Final Weight (g/fish)
증체량 (WG) (g), Weight Gain = final weight - initial weight
총사료섭이량 (DFI) (g), Total Dry Feed Intake
사료효율 (FE) (%), Feed Efficiency = (wet weight gain/dry feed intake) x 100
증체율 (WGR) (%), Weight Gain Rate = (final weight - initial weight) x 100/initial weight
일성장률 (SGR) (%), Specific Growth Rate (%/day) = (log final weight - log initial weight)/days x 100
생존율 (SR) (%), Survival Rate = (No. of fish at end of experiment/No. of fish at start of experiment) x 100
1-2. 신규 스키조키트리움 속( Schizochytrium sp.) CD03-7004 변이균주의 준비
1-2-1. 감마선 조사 방법을 통한 신규 스키조키트리움 속( Schizochytrium sp.) CD03-7004 변이균주의 개발
순수 분리된 야생형 스키조키트리움 속(Schizochytrium sp.) CD01-5000 균주(기탁번호 KCTC 14344BP)를 글루코스 30 g/L를 포함하는 modified-GYEP(글루코스 10 g/L, 효모 추출물 1 g/L, 펩톤 1 g/L, MgSO4·7H2O 2 g/L, H3BO3 5.0 mg/L, MnCl2 3.0 mg/L, CuSO4 0.2 mg/L, NaMo4·2H2O 0.05 mg/L, CoSO4 0.05 mg/L, ZnSO4·7H2O 0.7 mg/L) 배지에 약 24시간 이상 배양하여 초기 대수기(Early Exponential phase)단계에 이르도록 한 후, 배양액 샘플을 원심분리하여 균체를 수확하였다. 수확된 균체는 세포수가 약 109 cells/mL가 되도록 NaCl 1.0%를 포함하는 0.1M Phosphate Buffer Solution에 현탁하여 감마선 조사에 활용하였다.
감마선 조사 실험은 한국원자력연구원 첨단방사선연구소에서 진행하였으며, 2000~5000 GY 선량의 감마선을 조사하였다. 감마선이 조사된 미세조류 배양액 샘플은 암실에서 O/N 동안 Recovery 과정을 거친 후, 한천(Agar) 20 g/L를 포함한 GYEP 배지에 도말하여 30℃에서 약 5일간 배양한 후 생육 콜로니 수를 계수하여 감마선량 별 사멸율을 측정하였다.
[계산식 1]
사멸률(%) = [{(무처리구의 콜로니 수) - (처리구의 콜로니 수)}/(무처리구의 콜로니 수)] X 100
감마선 선량 (kGY) 생육 콜로니 수 (EA) 사멸률 (%)
2.0 ≥ 250 -　
3.0 ≥ 23 90.8
4.0 ≥ 7 98.2
4.5 0 100
5.0 0 100
방사선 무처리구 ≥ 250 0
그 결과, 표 1에 나타낸 바와 같이, 감마선 조사선량에 따른 생육 콜로니 수, 생균수의 CFU값이 95% 이상 감소되는 적정 선량을 확인하였다. 구체적으로, 2.0, 3.0, 4.0, 4.5, 5.0 kGY의 감마선 조사선량에서 각각 0%, 90.8%, 98.2%, 100%, 100%가 사멸되는 결과를 나타냈다. 4.5 GY 이상의 감마선 선량 조사 조건에서는 모두 사멸되어 미세조류 콜로니를 확보할 수 없었으며, 98.2%의 사멸률을 나타내는 4.0 kGY의 감마선 선량 조건을 선택하였다.
동일한 방법으로 신규 미세조류 균주 CD01-5000에 4.0 kGY 선량의 감마선을 조사한 후 GYEP 배지에서 배양하였다. 배양 중에 생육이 가능한 콜로니를 선별하여, 동일한 배지 및 배양 환경 조건에서 계대를 진행하였다. 계대 간 형태적으로 붉은색을 띄는 콜로니를 선별하여 단일 세포주로 순수 분리 배양한 후, 이를 촬영한 결과를 도 1에 나타내었다. 상기 스키조키트리움 속 균주를 스키조키트리움 속 (Schizochytrium sp.) CD03-7004 균주로 명명하고, 2022년 6월 20일자로 한국생명공학연구원 생물자원센터(Korean Collection for Type Cultures: KCTC)에 기탁하여 수탁번호 KCTC15006BP를 부여받았다.
1-2-2. CD03-7004 돌연변이 균주와 야생형 CD01-5000 균주의 구별 마커 도출
야생형 스키조키트리움 속(Schizochytrium sp.) CD01-5000 균주와 돌연변이 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주의 전체 게놈 서열(whole genome sequence)를 비교하여 CD03-7004에서 변이된 서열을 찾아 PCR 마커(marker)를 제작하였다.
구체적으로, 돌연변이 CD03-7004 균주는 게놈 상에서 야생형 CD01-5000 균주의 게놈과 비교하였을 때, 15 base pairs의 추가된 부분(하기 서열번호 1의 서열에서 굵은 글씨 부분, 서열번호 5)이 있음을 확인하였다.
[돌연변이 CD03-7004 균주의 증폭 대상 DNA 단편 서열(서열번호 1)]
tttcagactgctttttgctttttgcttgcttgctttttgcttgcttgcttttggcttgctttctttttgcttcttcctgcttgatccggtgaagaagaacggagcgaactaaaagaaaagagtcaatccgaagagag
[야생형 CD01-5000 균주의 증폭 대상 DNA 단편 서열(서열번호 2)]
tttcagactgctttttgctttttgcttgcttgcttttggcttgctttctttttgcttcttcctgcttgatccggtgaagaagaacggagcgaactaaaagaaaagagtcaatccgaagagag
이 부분을 증폭하는 프라이머 A: 5’-TTTCAGACTGCTTTTTGCTTTTTG-3’(서열번호 3), 프라이머 B: 5’-CTCTCTTCGGATTGACTCTTTTCT-3’(서열번호 4)를 선정하였고, 이를 이용하여 PCR 증폭 반응을 진행하였다. PCR 반응은 taq polymerase를 함유하는 반응용액을 활용하여 95℃에서 5분간 변성 후, 95℃ 10초 변성, 50℃ 10초 어닐링, 72℃ 15초 중합을 35회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다. PCR 과정을 통하여 증폭된 반응액은 1.7% 아가로즈겔에 전기영동하여 증폭된 DNA 크기를 확인하여 도 2에 나타내었다.
그 결과, 도 2에 나타난 바와 같이, 돌연변이 CD03-7004 균주에서 증폭된 DNA 단편은 약 140 bp 크기로 나타나, 약 120 bp 크기의 DNA 단편이 증폭된 야생형 CD01-5000 균주와 차이가 있음을 확인하였다.
따라서, 상기 결과를 통해, 돌연변이 CD03-7004 균주를 선별하기 위해 프라이머 A: 5’-TTTCAGACTGCTTTTTGCTTTTTG-3’(서열번호 3)와 프라이머 B: 5’-CTCTCTTCGGATTGACTCTTTTCT-3’(서열번호 4)를 활용할 수 있음을 알 수 있다.
1-2-3. 미세조류 바이오매스 건조분말( Schizochytrium sp. 분)의 제조
실험에서 사용할 미세조류 바이오매스 건조분말은 스키조키트리움 속(Schizochytrium sp.) CD03-7004 균주(KCTC15006BP)를 이용하여 다음과 같은 방법으로 제조하였다.
30 L scale의 본 배양에 앞선 예비 배양을 위해, 500 ml 플라스크에서 작업량(working volume) 50 ml 및 글루코스 30 g/L를 포함하는 GYEP 배지에 각 균주를 접종하고, 진탕 인큐베이터(Shaking incubator)에서 30℃, 180 rpm으로 약 20시간 동안 배양하였다. 예비 배양물은 동일한 조건의 배지를 포함한 30 L 발효조에 접종하여 총 작업량(working volume) 20 L에서 발효 배양하였다. 30℃, 500 rpm, 0.5-1 vvm, pH 5-7 조건에서 작업량(working volume)의 20%에 해당하는 글루코스를 연속 투입하여 세포 배양에 활용하고, 이때의 글루코스 농도는 20 g/L 수준에서 유지되도록 주입하였다. 공급한 탄소원인 글루코스가 모두 소모되면 배양을 종료하였다. 배양이 끝난 배양액은 건조기를 활용하여 수분 함량이 약 5~8%가 되도록 건조하였다.
1-3. 시험사료 제조
시험사료 제조는 단백원으로 코팩스 사료제조 어분(Glumar Co., Chille))과 상기 실시예 1-2-3.에서 제조된 Schizochytrium sp. 분 (CJ Co., Korea)을 사용하였으며, 효모 (Biolife Co., Brazil). 비타민 (Seoul vet Pharm Co., Korea), 미네랄 (Seoul vet Pharm Co., Korea), 전분 (Asai Co., Thailand)을 사용하였으며, 단백원으로 어분 100%인 대조사료 (CTL)와, 어분의 5%, 10%, 15%, 20%, 및 30%를 각각 Schizochytrium sp. 분으로 대체한 시험사료(대체사료) T1, T2, T3, T4, 및 T5를 제조하였다. 한편, 단백원은 모두 (주)코팩스 연구소 보유 분쇄기를 통하여 약 100 mesh 크기로 분쇄하여 사용하였다. 대조사료 및 시험사료의 조성은 하기 표 8에 후술하였다.
1-4. 생물(간중량) 지수 평가
실험 종료 후 각 시험군에서 10 마리를 무작위 선별하여 간중량지수 (hepatosomatic index, HSI)와 장중량지수 (intestinosomatic index, ISI)를 측정하였다. 체중과 해부 후 적출된 간과 장의 무게를 전자저울을 사용하여 조사하였고 간중량지수 [(간 무게/체중)×100]와 장중량지수 [(간 무게/체중)×100]를 계산하였다.
1-5. 연구재료 및 어체 기본성분 분석
연구재료 및 어체의 수분, 지방, 단백질 및 회분 분석을 수행하였다. 연구재료는 어분(Glumar Co., Chille))및 상기 Schizochytrium sp. 분을 사용하였으며, 어체의 경우 각 시험구당 유사한 중량의 장어 5마리씩을 무작위로 채포하여 세절기에 곱게 분쇄한 후 수분, 지방, 단백질 및 회분 분석을 수행하였다. 분석방법은 식품공전방법에 따라서 수행되었으며, 조지방 분석은 Schizochytrium sp. 분의 특성을 감안하여 산 분해법에 의하여 수행되었다.
1-6. 아미노산, 지방산 분석 및 Ca, P 분석
연구재료인 어분 및 상기 Schizochytrium sp. 분, 어체의 아미노산, 지방산 및 Ca. P 함량평가를 수행하였다. 어체의 경우, 각 시험구에서 무작위 채포된 5마리의 분쇄육의 동결건조 분을 이용하여 아미노산, 지방산 및 Ca. P 함량평가를 수행하였다. 분석은 충남대 농업과학연구소 사료검정인정센터 (https:/agro.cnu.ac.kr/agro/index.do) 에 의뢰하였다.
1-6-1. 아미노산 분석 방법
구성 아미노산 함량 분석은 AOAC 법 (2005)을 변형하여 이온 교환 크로마토그래피법를 이용한 ninhydrin post column 반응법으로 18 성분을 분석하였다. 구성 아미노산 16 성분의 경우 시료 0.2 g을 분해관에 넣고 6N HCl 10 ㎖를 가하고 질소가스를 주입한 후 110 ℃에서 24 시간 가수분해 시켰다. 여액을 감압농축기로 농축 후 0.2 M sodium citrate buffer로 50 ㎖로 정용한 후, 0.20 μm의 Cellulose acetate syringe filter로 여과한 여액을 분석시료로 사용하였다. 황함유 계열인 메티오닌(methionine)과 시스테인(cysteine)은 performic acid 산화법, tryptophan은 알칼리 가수분해법을 이용하였다. 분석조건은 표 2 및 표 3에 나타냈다.
총 아미노산에 대한 아미노산 자동 분석기의 분석 조건
Items Conditions
Instrument Hitachi, L-8900
Column Ion exchange column (#2622PH column)
4.6 × 60 ㎜
Mobile phase Buffer set (PH-SET KANTO)
Detector UV/Vis (440, 570 ㎚)
Flow rate Ninhydrin ; 0.30 ㎖/min
Buffer ; 0.35 ㎖/min
Injection volume 20 μL
트립토판의 HPLC 분석 조건
Items Conditions
Instrument Waters Isocratic 600 pump, 486 UV/VIS detector
Column CAPCELL PAK C18 (4.6 x 250 ㎜)
Mobile phase 0.0085M Sodium acetate : methanol = 95 : 5
Detector UV 280 ㎚
Flow rate 1.0 ㎖/min
Injection volume 20 ㎕
1-6-2. 지방산 조성 분석 방법
지방산 조성은 분쇄한 시료 약 10g에 Folch et al. (1957)의 방법에 따라 클로로폼과 메탄올 혼합액(2:1) 약 100㎖를 가하여 상온에서 24시간 추출한 후 감압농축하여 추출물을 제조하였다. 14% BF3-MeOH (Sigma, St Louis, Mo, USA) 용액으로 메틸에스테르화 시킨 후. Gas Chromatograph(HP 6890, Heslett Packard Ltd.,USA)로 분석하였다. Column은 HP-88 (100 m×0.25 mm i.d., film thickness 0.20 μm, Agilent, USA)을 사용하였으며, 컬럼오븐의 온도는 140℃에서 5분간 유지 후, 1분당 4℃씩 승온하여 240℃로 20분간 유지하였다. 주입구의 온도는 260℃로, 검출기 FID의 온도는270℃로 하였으며 운반기체는 N2를 1㎖/min으로 사용하였으며 split ratio을1/50으로 조정하였다. Gas chromatography의 분석조건은 하기 표 4에서와 같은 조건으로 분석을 행하였고 각 지방산의 peak들은 표준지방산의 methyl ester의 머무름 시간과 비교하여 확인하였다. 지방산조성은 동정된 각 peak의 면적을 구한 뒤 각각의 면적비를 백분율로 나타내었다.
지방산에 대한 기체 크로마토그래피 분석 조건
Items Conditions
Instrument HEWLETT PACKARD 6890
Column HP-88(100 m × 0.25 mm, 0.2 μm)
Injection port 260℃
Detection port 270℃
Column oven 140℃(5min), 4℃/min, 240℃(20min)
Detector FID
Carrier gas N2
Injection volumn 1㎕
Split ratio 50:1
1-6-3. 무기질 분석 방법
무기질 함량은 건식회화법으로 회화한 후의 잔사를 염산용액(1:1, v/v)에 녹여 시료용액을 조제한 후 칼슘(calcium, Ca)은 원자흡광분광광도계(GBC Scientific Equipment, SavantAA, Australia)로 측정하였으며, 인(P)은 몰리브덴청 비색법에 따라서 분광광도계(UV-2450, Shimadzu Co., Japan)로 470 ㎚에서 측정하였다. 모든 시약과 증류수는 무기질 분석용을 사용하였다.
1-7. 혈액 화학요소 분석
실험 종료 후 각 시험구에서 10마리를 무작위 채포하여 미부 정맥에서 혈액분석을 위한 plasma는 일회용 주사기로 heparin tube에 채혈하여 원심분리(2000 rpm, 15 min, 4 ℃) 후 획득하였고, Glutamate oxaloacetate transaminase(GOT), 콜레스테롤(cholesterol, CHO), 중성지방(triglyceride, TG), alkaline phosphatase (ALP), 및 총단백질 (total protein, TP)의 측정에는 혈액 분석기(NX500i, FUJI FILM, JAPAN)를 사용하였다.
1-8. 비특이적 면역분석
라이소자임 활성도(Lysozyme activity) 측정을 위해 실험종료 후 각각의 시험구별 10마리의 장어 미부정맥에서 분리한 혈청 50 ul와 0.05M sodium phosphate buffer(Sigma, USA, pH 6.2)에 Micrococcus lysodeikticus(0.2 mg/ml)를 부유시킨 solution 1ml을 96-well plate에 혼합하였다. 반응은 20℃ 조건에서 분광광도계(Molecular Device, USA)의 흡광도 530 nm에서 0.5분과 5분에 측정하였다. Lysozyme의 활성 단위는 분당 0.001의 흡광도 감소를 나타내는 효소양으로 정의하였다.
중성백혈구의 식세포 활성도(phagocyte activity) 측정을 위해 실험종료 후 각각의 시험구별 10마리의 장어 미부정맥에서 분리한 혈청과 NBT solution (Sigma, USA)을 1:1의 비율로 각각 50 μL씩 혼합한 후, 25 ℃에서 30분 동안 반응시킨 반응물을 50 μL씩 유리튜브에 옮긴 후, formazan 생성을 감소시키기 위해 dimethyl formamide(Sigma, USA)를 1 mL씩 넣었다. 이후 2,000 ×g에서 5분 동안 원심분리하여 상층액을 취한 후, 분광광도계(Molecular Device, USA)를 이용하여 540 nm에서 NBT의 감소 범위를 측정하였다. Blank는 dimethyl formamide(Sigma, USA)를 사용하였다.
1-9. 콜레시스토키닌 및 슈퍼옥사이드 디스뮤테이스 분석
소화효소인 콜레시스토키닌(Cholecystokinin)와 항산화효소인 슈퍼옥사이드 디스뮤테이스(Superoxide dismutase, SOD)의 활성 분석을 위해 시험구별 10마리의 장어에서 혈액을 채취하여 4°C에서 2,000×g로 10분동안 원심분리기로 혈청을 분리한 후 -70°C에 보관하였다. 혈청을 이용한 ELISA 분석은 어류용 Cholecystokinin (CUSABIO, USA), SOD(CUSABIO, USA)를 측정할 수 있는 Kit를 사용하였으며, 제조사의 protocol에 따라 well당 50 μL의 혈장을 사용하여 3반복 진행하였다. 활성정도는 분광광도계(Molecular Device, USA)를 이용하여 450 nm의 흡광도에서 측정하였고, 결과값은 standard curve를 기준으로 ng/ml(SOD) 또는 pg/mL(Cholecystokinin)단위로 산정하였다.
실시예 2: 연구재료(어분 및 스키조키트리움 속 미세조류 분말) 분석
2-1. 일반성분 (Proximate components)
본 연구에 사용된 단백원인 어분(Fishmeal powder)과 스키조키트리움 속 미세조류 분말 (Schizochytrium sp. 분)의 일반성분을 평가하고, 하기 표 5에 나타냈다.
일반성분 (Proximate components) (%) 어분 분말 (Fishmeal powder; FP) Schizochytrium sp. 분 (Schizochytrium sp. powder; SP)
수분 (Moisture) 1.76 0.63
조단백질 (Crude protein) 74.25 80.31
조지방 (Crude lipids) 9.91 11.36
회분 (Ash) 13.65 7.25
조섬유 (Crude fiber) 0.4 0.45
칼로리 (Calorie) (cal/100g) 447.25 493.08
표 5에 나타난 바와 같이, Schizochytrium sp. 분은 어분에 비하여 낮은 수분, 회분 함량을 갖고, 어분에 비하여 높은 조단백질 및 조지방 함량을 가짐을 확인할 수 있었다.
2-2. 아미노산 (Amino acids)
본 연구에 사용한 두 가지 단백분인 어분과 Schyzochytrium sp. 분의 구성 아미노산 조성을 평가하고, g/총 아미노산100g 로 표시하여 표 6에 나타냈다.
Amino acids (g/총 아미노산100g) 어분 분말 (Fishmeal powder; FP) Schizochytrium sp. powder (SP)
Aspartic acid 9.99 4.65
Threonine* 4.62 2.14
Serine 4.39 2.23
Glutamic acid 14.41 53.56
Proline 4.62 1.40
Glycine 6.73 2.53
Alanine 6.77 3.00
Cysteine 0.21 0.11
Valine* 5.22 3.01
Methionine* 3.24 1.51
Isoleucine* 4.29 1.96
Leucine* 7.85 3.45
Tyrosine 3.32 1.49
Phenylalanine* 4.08 1.93
Histidine* 4.67 1.18
Lysine* 8.83 3.65
Arginine* 6.76 12.18
* 필수 아미노산
표 6에 나타난 바와 같이, 대부분의 아미노산 함량은 어분에서 높았으나, 글루탐산(glutamic acid) 함량은 어분에 비교하여 Schyzochytrium sp. 분 내에서 4배 정도에 이르렀으며, 필수아미노산인 아르기닌(arginine)은 역시 어분에서보다 Schyzochytrium sp. 분에서 높은 함량을 보였다.
2-3. 지방산 (Fatty acids)
본 연구에 사용한 두 가지 단백분에 포함된 지방의 지방산 조성을 평가하고, g/총 지방산100g로 표시하여 표 7에 나타냈다.
지방산 (g/총 지방산100g) 약칭 어분 분말 (Fishmeal powder; FP) Schizochytrium sp. powder (SP)
포화
지방산		 Caproic acid C6:0 0.04 0.04
Caprylic acid C8:0 0.02 0.02
Capric acid C10:0 0.03 0.03
Lauric acid C12:0 0.06 0.05
Myristic acid C14:0 5.60 1.70
Pentadecanoic acid C15:0 0.52 0.12
Palmitic acid C16:0 19.96 36.70
Magaric acid C17:0 0.68 0.07
Stearic acid C18:0 6.68 1.51
Arachidic acid C20:0 0.07 0.21
Heneicosylic acid C21:0 0.90 0.00
Behenic acid C22:0 0.24 0.00
Lignoceric acid C24:0 1.58 1.67
불포화
지방산		 Myristoleic acid C14:1 0.17 0.11
Pentadecenoic acid C15:1 0.25 0.00
Palmitoleic acid C16:1 5.99 0.11
Magaoleic acid C7:1 0.83 0.04
Oleic acid C18:1n9 18.87 0.51
Linoleic acid C18:2n6 2.37 0.37
γ-linoleic acid C18:3n6 0.26 0.23
Linolenic acid C18:3n3 0.64 0.25
Eicosenoic acid C20:1n9 1.89 0.01
Eicosadienoic acid C20:2n6 0.16 0.00
Dihomo-δ-Linoleicacid C20:3n6 0.07 0.00
Eicosatrienoic acid C20:3n3 0.31 0.00
Arachidonic acid C20:4n6 2.84 0.12
EPA (eicosapentaenoic acid) C20:5n3 9.63 0.72
Erucic aicd C22:1n9 0.29 0.24
Docosadienoic acid C22:2n6 0.68 0.66
Nervonic acid C24:1n9 3.25 0.40
DHA (docosahexaenoic acid) C22:6n3 15.09 45.12
두 단백원 소재 간 일부 지방산의 함량비는 매우 큰 차이를 보였다. 주요 차이를 보이는 지방산은 미리스트산 (Myristic acid) (C14:0, FP, 5.60; SP, 1.70), 팔미트산 (palmitic acid) (C16:0, FP, 19.96; SP, 36.70), 스테아르산 (stearic acid) (C18:0, FP, 6.68; SP, 1.51), 팔미톨레산 (palmitoleic acid) (C16:1, FP, 5.99; SP, 0.11), 올레산 (oleic acid) (C18:1n9, FP, 18.87; SP, 0.51), 리놀레산 (linoleic acid) (C18:2n6, FP, 2.37; SP, 0.37), 리놀렌산 (linolenic acid) (C18:3n3, FP, 0.64; SP, 0.25), 이코사디엔산 (eicosadienoic acid) (C20:1n9, FP, 1.89; SP, 0.01), 아라키돈산 (arachidonic acid) (C20:4n6, FP, 2.84; SP, 0.12), EPA (이코사펜타에노산, eicosapentaenoic acid) (C16:0, FP, 9.63; SP, 0.72), 네르본산 (Nervonic acid) (C24:1n9, FP, 3.25; SP, 0.40) 및 DHA (도코사헥사엔산, docosahexanoic acid) (C22:6n3), FP, 15.09; SP, 45.12)가 있었다. Schizochytrium sp. 분에서는 많은 지방산이 어분보다 낮은 경향이었지만, 반면에 팔미트산 및 DHA의 조성비는 어분에 비교하여 Schizochytrium sp. 분에서 매우 높았다.
2-4. 대조사료 및 시험사료의 제조
단백원으로 어분 100%인 대조사료 (control, CTL)와, 어분의 5%, 10%, 15%, 20%, 및 30%를 각각 Schizochytrium sp. 분으로 대체한 시험사료(대체사료) T1, T2, T3, T4, 및 T5를 하기 표 8에 나타낸 조성으로 제조하였다.
Components (%) CTL T1 T2 T3 T4 T5
Brown Fish meal
(Jack mackerel)a 		72 68.4 64.8 61.2 57.6 50.4
Schizochytrium sp. powderb 0 3.3 6.6 10 13.3 20
Brewer's Yeastc 3 3 3 3 3 3
Starchd 23 23 23 23 23 23
Cellulosee 0 0.3 0.6 0.8 1.1 1.6
Vitaminf 1 1 1 1 1 1
Mineralf 1 1 1 1 1 1
Total 100 100 100 100 100 100
a, Glumar Co., Chille
b, CJ Co., Korea
c, Biolife Co., Brazil
d, Asai Co., Thailand
e, Nelson-Jameson, Inc., USA
f, Seoul vet Pharma Co., Korea
2-5. 시험사료 일반성분
본 실험에 사용한 대조사료 (CTL)와 시험사료(대체사료) T1 내지 T5의 기본 성분을 평가하여 표 9에 나타냈다.
일반성분 (Proximate components) (%) CTL T1 T2 T3 T4 T5
수분 (Moisture) 3.36 3.84 3.84 3.36 3.68 3.49
조단백질 (Crude protein) 43.66 43.52 45.20 44.86 44.93 45.45
조지방 (Crude lipids) 6.93 7.24 6.79 6.83 6.39 6.11
조탄수화물 (Crude carbohydrates) 24.00 24.00 24.00 24.00 24.00 24.00
회분 (Ash) 22.05±1.65 21.4±1.83 20.17±0.56 20.95±0.70 21.0±0.38 20.95±1.65
칼로리 (Calorie) (cal/100g) 353.80 356.96 358.28 357.40 352.40 351.12
표 9에 나타난 바와 같이, 수분, 조단백질 함량, 조지방 함량 및 회분 등에서 차이가 없었으며, 조탄수화물 함량도 동일하게 평가되었고, 칼로리 역시 사료 간의 차이가 거의 없었음을 확인할 수 있었다.
2-6. 시험사료 지방산 분석
본 실험에 사용한 대조사료 (CTL)와 시험사료(대체사료) T1 내지 T5의 지방산 조성비(profile)를 평가하고, g/총 지방산100g 로 표시하여 표 10에 나타냈다.
지방산 (g/총 지방산100g) 약칭 CTL T1 T2 T3 T4 T5
포화
지방산		 Caproic acid C6:0 0.04 0.05 0.05 0.07 0.13 0.05
Caprylic acid C8:0 0.03 0.03 0.02 0.03 0.07 0.08
Capric acid C10:0 0.10 0.12 0.10 0.03 0.12 0.07
Lauric acid C12:0 0.10 0.09 0.10 0.11 0.10 0.10
Myristic acid C14:0 5.77 5.50 5.40 5.11 5.05 4.66
Pentadecanoic acid C15:0 0.82 0.77 0.62 0.51 0.54 0.43
Palmitic acid C16:0 20.67 21.12 21.36 23.47 24.10 26.16
Magaric acid C17:0 0.84 0.54 0.50 0.52 0.48 0.51
Stearic acid C18:0 6.86 6.29 6.35 6.54 6.11 5.79
Arachidic acid C20:0 0.08 0.04 0.06 0.05 0.05 0.05
Heneicosylic acid C21:0 0.92 0.86 0.83 0.80 0.76 0.70
Behenic acid C22:0 0.23 0.20 0.19 0.17 0.17 0.15
Lignoceric acid C24:0 1.47 1.41 1.37 1.34 1.25 1.08
불포화
지방산		 Myristoleic acid C14:1 0.16 0.16 0.15 0.14 0.14 0.11
Pentadecenoic acid C15:1 0.21 0.21 0.20 0.20 0.21 0.13
Palmitoleic acid C16:1 6.11 5.89 5.64 5.19 5.20 4.54
Magaoleic acid C7:1 0.75 1.01 0.73 0.69 0.63 0.61
Oleic acid C18:1n9 18.36 18.89 17.89 16.12 15.70 13.23
Linoleic acid C18:2n6 2.27 2.22 2.12 2.02 1.99 1.76
γ-linoleicacid C18:3n6 0.27 0.29 0.28 0.28 0.26 0.27
Linolenic acid C18:3n3 0.66 0.63 0.62 0.63 0.60 0.60
Eicosenoic acid C20:1n9 2.08 1.77 1.69 1.70 1.47 1.29
Eicosadienoic acid C20:2n6 0.18 0.14 0.14 0.16 0.12 0.11
Dihomo-δ-Linoleic acid C20:3n6 0.05 0.03 0.03 0.05 0.06 0.03
Eicosatrienoic acid C20:3n3 0.32 0.35 0.33 0.30 0.30 0.25
Arachidonic acid C20:4n6 2.64 2.36 2.27 2.36 2.02 1.75
EPA C20:5n3 9.40 8.89 8.54 8.08 7.71 7.01
Erucic aicd C22:1n9 0.29 0.28 0.29 0.32 0.29 0.28
Docosadienoic acid C22:2n6 0.67 0.63 0.67 0.68 0.64 0.65
Nervonic acid C24:1n9 3.18 3.08 2.98 2.80 2.72 2.44
DHA C22:6n3 14.47 16.14 16.57 19.53 21.01 25.11
상기 표 10에 나타난 바와 같이, 어분과 Schizochytrium sp. 분을 일정비율로 혼합한 시험사료에서는 혼합비에 비례하여 지방산 조성에서의 차이가 확인되었다. Schizochytrium sp. 분의 혼합비가 증가할수록, 팔미트산 및 DHA의 함량이 증가함을 확인할 수 있었다.
실시예 3: 성장 성과(Growth performance) 평가
육성기 민물장어 (A. japonica, 약 20g size)를 대상으로 대조사료 및 시험사료 T1 내지 T5를 각 8 주간 1일 2회 공급하여 성장 성과(Growth performance)를 평가하고, 하기 표 11에 나타냈다.
CTL T1 T2 T3 T4 T5
IWa (g) 255.00±0.00 225.67±0.58 255.5±0.71 255.33±0.58 225.00±0.50 225.33±0.58
FWb (g) 649.33±10.89 638.33±10.77 668.00±28.28 635.59±8.53 622.17±18.11 621.87±14.18
WGc (g) 424.33±10.89 412.67±10.75 422.5±28.99 410.25±9.08 397.17±18.32 396.53±14.76
DFId (g) 487.22±0.42 482.34±4.87 487.01±0.26 485.31±0.75 487.04±1.37 486.81±0.36
FEe (%) 87.09±2.16 85.55±1.52 90.86±5.0 84.53±1.89 81.54±3.54 81.45±2.97
WGRf (%) 188.59±4.84 182.87±4.77 196.25±13.47 182.07±4.47 176.52±8.32 175.99±6.99
SGRg (%/day) 1.89±0.03 1.86±0.03 1.94±0.08 1.85±0.03 1.82±0.05 1.81±0.05
SRh (%) 100±0.00 100±0.00 100±0.00 97.78±3.85 100±0.00 97.78±3.85
aIW (g), 초기무게, Initial Weight (g/fish)
bFW (g), 최종무게, Final Weight (g/fish)
cWG (g), 증체량, Weight Gain = final weight - initial weight
dDFI (g), 총사료섭이량, Total Dry Feed Intake
eFE (%), 사료효율, Feed Efficiency = (wet weight gain/dry feed intake) x 100
fWGR (%), 증체율, Weight Gain Rate = (final weight - initial weight) x 100/initial weight
gSGR (%), 일성장률, Specific Growth Rate (%/day) = (log final weight - log initial weight)/days x 100
hSR (%), 생존율, Survival Rate = (No. of fish at end of experiment/No. of fish at start of experiment) x 100
상기 표 11에 나타난 바와 같이, 증체율 (WGR)은 T2 (196.25±13.47) > 대조사료 (188.59±4.84) > T1(182.87±4.77) > T3 (182.07±4.47) > T4 (176.52±8.32 > T5 (175.99±6.99) 순이었고, 사료효율 (FE)은 T2 (90.86±5.0) > 대조사료 (87.09±2.16) > T1 (85.55±1.52) > T3 (84.53±1.89) > T4 (81.54±3.54) > T5 (81.45±2.97) 순이었으며, 일성장률 (SGR) 역시 T2 (1.94±0.08) > 대조사료 (1.89±0.03n) > T1 (1.86±0.03) > T3 (1.85±0.03) > T4 (1.82±0.05) > T5(1.81±0.05) 순으로, 시험사료 T2에서 가장 우수한 증체율, 사료효율 및 일성장률을 보였음을 확인할 수 있었다. 생존율(SR)은 시험구간 97.72%∼100% 사이로 유의한 차이를 보이지 않았다.
이와 같이, 시험사료 T2의 혼합비로 어분을 Schizochytrium sp. 분으로 대체하는 경우, 장어의 성장이 촉진되어 장어용 사료 조성물로 유용하게 사용될 수 있음을 확인할 수 있었다.
실시예 4: 생물지수 평가
생물학적 특성인 간중량지수(HSI)와 장중량지수(ISI)는 일반적으로 어류의 사료영양상태나 서식환경조건 및 스트레스 등에 따라 차이를 보이는 것으로 알려져 있다. 대조사료 및 시험사료 T1 내지 T5를 급이한 장어군의 간중량지수 및 장중량지수를 평가한 결과를 하기 표 12에 나타냈다.
CTL T1 T2 T3 T4 T5
간중량지수a(HSI) 1.86±0.37 2.02±059 1.91±0.22 1.86±0.24 2.15±0.45 1.99±0.22
장중량지수b(VSI) 5.34±1.03 5.34±1.43 5.11±0.59 5.52±0.73 5.97±1.25 5.40±0.61
a Liver weight(g)/Body weight(g) x 100b Intestine weight(g)/Body weight(g) x 100
표 12에 나타난 바와 같이, 대조사료 및 시험사료(T1 내지 T5) 공급 장어군 간 간중량지수와 장중량지수에서는 유의적인 차이가 나타나지 않았으며, 이에 따라 시험사료의 함량비 범위로 어분을 Schizochytrium sp. 분으로 안전하게 대체할 수 있음을 확인할 수 있었다.
실시예 5: 혈액 화학요소 분석
어류 혈액의 화학적 검사는 다양한 질병의 진단 혹은 장기의 손상여부 및 스트레스의 정도 등의 생리학적 상태변화를 진단할 수 있어 오래전부터 건강진단의 지표로 활용되고 있다. 8주간의 대조사료 및 시험사료를 공급한 시험어 각 10마리를 무작위 채포하여 혈장 내 Glutamate oxaloacetate transaminase (GOT), 중성지방(triglyceride, TG), 콜레스테롤(cholesterol, CHO), alkaline phosphatase (ALP), 및 총단백질 (total protein, TP)를 측정하고, 표 13에 나타냈다.
CTL T1 T2 T3 T4 T5
GOT 107.2±37.1 118.2±34.2 103.4±27.5 93.8±19.6 111.6±33.5 181.8±126.9
TG 1324.0±721.5 1192±360.7 1048.8±574.4 1023.2±260.5 980.8±381.9 746.4±274.7
CHO 363.8±59.0 356.8±128.8 346.8±59.0 345.3±38.2 354±68.2 311.4±57.5
ALP 1326.4±585.4 888.2±375.2 1061.2±459.3 1166.6±380.8 1168.4±459.2 1155.6±394.0
TP 4.5±0.3 4.62±0.6 4.36±0.4 4.2±0.1 4.34±0.5 4.86±1.3
표 13에 나타난 바와 같이, 대조사료 공급 장어군과 시험사료 (T1∼T5) 공급군 모두 혈중 간 손상지수인 GOT(GOT는 aspartate aminotransferase(AST)로도 알려져 있다), 콜레스테롤 (CHO), 간의 주요 효소인 Alkaline phosphatase (ALP), 총 단백질 (TP)의 혈중 농도에 있어 유사한 수치를 보였다. 혈중 중성지방 (TG)은 시험사료 T1 내지 T5에서, 어분 대체 비율이 증가함에 따라 대조사료 공급 장어군에 비교하여 감소하는 경향을 보였으나, 유의한 차이는 나타나지 않았다.
이에 따라, 시험사료의 함량비 범위로 어분을 Schizochytrium sp. 분으로 안전하게 대체할 수 있음을 확인할 수 있었다.
실시예 6: 비특이적 면역, 콜레시스토키닌 및 슈퍼옥사이드 디스뮤테이스 분석
척추동물인 어류 역시 면역은 비특이적 면역과 특이적 면역에 의한 방어체계를 갖고 있으며, 면역활성은 먹이환경과 수질환경 등의 변화에 민감하게 반응한다고 알려져 있다. 체액성 면역인자인 라이소자임(lysozyme)의 활성과 세포성 면역요소인 중성백혈구의 식세포 활성(phagocytic activity)을 평가함으로써 대조사료 (CTL) 공급 장어군과 시험사료 T1 내지 T5 공급 장어군 사이의 비특이적 면역에 미치는 효과를 평가하였다(표 14).
아울러, 담낭의 수축과 췌장의 효소분비 촉진호르몬인 콜레시스토키닌(choesystokinin)의 평가를 통한 소화기능을 평가하였고, 혈액 내 항산화 효소인 슈퍼옥사이드 디스뮤테이스(Superoxide dismutase, SOD) 활성을 평가하여 혈중 항산화 활성을 비교하였다(표 14).
CTL T1 T2 T3 T4 T5
Lysozyme activity 23.27±3.90ns 22.69±5.07 24.52±4.96 22.77±3.21 22.89±4.10 22.74±3.40
Phagocytic activity 140.99±65.35ns 108.04±53.14 166.45±10.328 124.25±47.28 128.61±81.61 122.32±36.48
Cholecystokinin activity 1827.00±1266.53ns 727.40
±682.68		 2645.5
±1141.55		 1494.20
±596.29		 2601.40
±990.34		 2189.70
±1132.49
Superoxide dismutase
activity		 21.21±0.83ns 21.17±1.29 20.33±3.10 21.68±0.21 21.74±0.35 21.03±1.12
표 14에 나타난 바와 같이, 라이소자임 활성(Lysozyme activity), 식세포 활성(Phagocytic activity), 콜레시스토키닌 활성(Cholecystokinin activity), 슈퍼옥사이드 디스뮤테이스 활성(Superoxide dismutase activity)은 모두 대체사료 및 시험사료 공급 장어군 간 유사한 수준을 보여, 시험사료의 함량비 범위로 어분을 Schizochytrium sp. 분으로 안전하게 대체할 수 있음을 확인할 수 있었다.
실시예 7: 전어체 분석
7-1. 기본성분
전어체 5마리를 마쇄 혼합한 후 수분함량을 측정하였으며, 건조 마쇄분을 대상으로는 기본성분 (조단백, 조지방, 회분)과 Ca, P 함량을 측정하고, 그 결과를 표 15에 나타냈다.
일반성분 (Proximate components) (%) CTL T1 T2 T3 T4 T5
수분 (Moisture) 66.16 65.73 68.13 66.61 67.35 68.64
조단백질 (Crude protein) 14.79 14.69 13.43 14.06 13.57 14.16
조지방 (Crude lipids) 13.09 14.15 12.52 13.33 13.27 12.10
회분 (Ash) 5.96 5.43 5.92 6.00 5.81 5.10
Ca 1.05 1.00 1.10 1.14 1.08 1.00
P 1.17 1.05 1.14 1.12 1.13 1.07
표 15에 나타난 바와 같이, 전어체의 수분함량, 조단백질, 조지방, 회분, Ca, P의 함량에서 대조사료 (CTL) 공급 장어군과 시험사료 (T1∼T5) 공급 장어군 간 유사한 수준을 보여, 시험사료의 함량비 범위로 어분을 Schizochytrium sp. 분으로 안전하게 대체할 수 있음을 확인할 수 있었다.
7-2. 구성 아미노산
대조사료 (CTL) 공급 장어군과 시험사료 (T1∼T5) 공급 장어군의 아미노산 조성을 평가한 결과를 하기 표 16에 나타냈다.
Amino acids (g/총 아미노산100g) CTL (%) T1 (%) T2 (%) T3 (%) T4 (%) T5 (%)
Aspartic acid 4.24(9.3) 4.07(9.4) 4.29(9.3) 4.29(9.3) 4.49(9.3) 4.53(9.3)
Threonine* 2.03(4.5) 1.94(4.5) 2.07(4.5) 2.04(4.4) 2.14(4.5) 2.16(4.4)
Serine 2.02(4.4) 1.89(4.4) 2.07(4.5) 2.02(4.4) 2.12(4.4) 2.12(4.4)
Glutamic acid 6.02(13.2) 5.77(13.4) 6.17(13.3) 6.17(13.3) 6.52(13.6) 6.53(13.4)
Proline 2.72(6.0) 2.38(5.5) 2.81(6.1) 2.79(6.0) 2.86(6.0) 2.84(5.8)
Glycine 4.51(9.9) 3.82(8.9) 4.67(10.1) 4.56(9.9) 4.69(9.8) 4.59(9.4)
Alanine 3.34(7.3) 3.04(7.0) 3.41(7.4) 3.37(7.3) 3.49(7.3) 3.50(7.2)
Valine* 2.01(4.4) 1.98(4.6) 2.00(4.3) 2.00(4.3) 2.10(4.4) 2.17(4.5)
Isoleucine* 1.70(3.7) 1.70(3.9) 1.68(3.6) 1.71(3.7) 1.81(3.8) 1.87(3.8)
Leucine* 3.27(7.2) 3.20(7.4) 3.27(7.1) 3.30(7.1) 3.46(7.2) 3.53(7.3)
Tyrosine 1.26(2.8) 1.28(3.0) 1.29(2.8) 1.32(2.9) 1.38(2.9) 1.36(2.8)
Phenylalanine* 1.75(3.8) 1.69(3.9) 1.76(3.8) 1.76(3.8) 1.84(3.8) 1.88(3.9)
Histidine* 1.75(3.8) 1.73(4.0) 1.78(3.8) 1.80(3.9) 1.86(3.9) 1.97(4.1)
Lysine* 3.74(8.2) 3.69(8.5) 3.76(8.1) 3.80(8.2) 3.96(8.2) 4.04(8.3)
Arginine* 3.08(6.8) 2.89(6.7) 3.14(6.8) 3.19(6.9) 3.28(6.9) 3.29(6.8)
Cysteine 0.48(1.1) 0.51(1.2) 0.53(1.1) 0.52(1.1) 0.51(1.1) 0.55(1.1)
Methionine* 1.47(3.2) 1.54(3.6) 1.56(3.4) 1.53(3.3) 1.49(3.1) 1.64(3.4)
Tryptophan* 0.15(0.3) 0.08(0.2) 0.13(0.3) 0.11(0.2) 0.11(0.2) 0.12(0.3)
Total 45.54 43.20 46.39 46.28 48.11 48.69
* 필수 아미노산
표 16에 나타난 바와 같이, 전어체의 구성 아미노산 조성에서 대조사료 (CTL) 공급 장어군과 시험사료 (T1∼T5) 공급 장어군 간 유사한 수준을 보였다. 이와 같이, 어분과 Schizochytrium sp. 분 사이에는 필수아미노산을 포함하여 아미노산 조성비에서 큰 차이를 보였지만(표 6), 표 16에 나타난 바와 같이 어분을 Schizochytrium sp. 분으로 대체한 시험사료를 급이한 장어 전어체의 구성 단백질에 미치는 영향은 거의 없는 것으로 판단되어, 시험사료의 함량비 범위로 어분을 Schizochytrium sp. 분으로 안전하게 대체할 수 있음을 확인할 수 있었다.
7-3. 지방산
대조사료 (CTL) 공급 장어군과 시험사료 (T1∼T5) 공급 장어군의 지방산 조성을 평가한 결과를 하기 표 17에 나타냈다.
지방산 (g/총 지방산100g) 약칭 CTL T1 T2 T3 T4 T5
포화
지방산		 Caproic acid C6:0 0.02 0.01 0.02 0.02 0.02 0.02
Caprylic acid C8:0 0.02 0.01 0.02 0.02 0.02 0.02
Capric acid C10:0 0.02 0.02 0.02 0.04 0.06 0.01
Lauric acid C12:0 0.07 0.06 0.07 0.08 0.08 0.07
Myristic acid C14:0 4.14 3.77 4.04 3.80 3.78 3.59
Pentadecanoic acid C15:0 0.25 0.23 0.27 0.23 0.23 0.22
Palmitic acid C16:0 22.62 20.89 21.13 21.67 21.53 21.70
Magaric acid C17:0 0.32 0.33 0.34 0.28 0.29 0.29
Stearic acid C18:0 3.56 3.60 3.28 3.77 3.57 3.57
Arachidic acid C20:0 0.15 0.13 0.15 0.15 0.14 0.14
Heneicosylic acid C21:0 0.15 0.14 0.09 0.09 0.14 0.13
Behenic acid C22:0 0.11 0.11 0.10 0.12 0.12 0.12
Lignoceric acid C24:0 0.39 0.37 0.40 0.37 0.36 0.34
불포화
지방산		 Myristoleic acid C14:1 0.17 0.14 0.19 0.19 0.18 0.16
Pentadecenoic acid C15:1 0.04 0.04 0.04 0.04 0.04 0.03
Palmitoleic acid C16:1 8.87 9.02 9.34 8.61 8.55 8.68
Magaoleic acid C7:1 0.46 0.43 0.48 0.44 0.44 0.39
Oleic acid C18:1n9 43.88 45.79 44.53 44.62 43.84 43.92
Linoleic acid C18:2n6 1.12 1.16 1.05 0.91 0.96 0.92
γ-linoleicacid C18:3n6 0.17 0.15 0.14 0.15 0.14 0.14
Linolenic acid C18:3n3 0.23 0.21 0.23 0.23 0.22 0.22
Eicosenoic acid C20:1n9 1.56 1.42 1.47 1.40 1.39 1.48
Eicosadienoic acid C20:2n6 0.43 0.41 0.44 0.37 0.4 0.4
Dihomo-δ-Linoleicacid C20:3n6 0.21 0.2 0.21 0.19 0.24 0.21
Eicosatrienoic acid C20:3n3 0.02 0.03 0.02 0 0.02 0.02
Arachidonic acid C20:4n6 0.73 0.65 0.66 0.63 0.64 0.63
EPA (eicosapentaenoic acid) C20:5n3 2.05 2.01 2 1.82 1.76 1.55
Erucic aicd C22:1n9 0.11 0.12 0.11 0.11 0.11 0.11
Docosadienoic acid C22:2n6 0.49 0.54 0.57 0.52 0.55 0.52
Nervonic acid C24:1n9 2.29 2.27 2.27 2.28 2.23 2.11
DHA (docosahexaenoic acid) C22:6n3 5.36 5.75 6.33 6.82 7.95 8.27
표 17에 나타난 바와 같이, 일부 고도불포화지방산, 예컨대 리놀레산(Linoleic acid) (CTL, 1.12 > T1, 1.16 > T2, 1.05 > T3, 0.91 > T4, 0.96 > T5, 0.92), EPA (CTL, 2.05 > T1, 2.01 > T2, 2.00 > T3, 1.82 > T4, 1.76 > T5, 1.55), DHA (CTL, 5.36 < T1, 5.75 < T2, 6.33 < T3, 6.82 < T4, 7.95 < T5, 8.27)등은 Schizochytrium sp. 분의 대체비율에 비례한 함량차이를 나타낸 것을 확인할 수 있었다. 이는, 시험평가에 사용된 어분과 Schizochytrium sp. 분의 지방산 조성비 중 일부 지방산은 구성비는 두 원료 간 큰 차이(표 7)를 보인 바 있으며, 대조사료 (CTL)와 시험사료 T1 내지 T5에서도 Schizochytrium sp. 분의 혼합비에 따른 차이(표 10)를 보인 바 있었던 결과와 일관된 것이다. 이와 같이, 어분과 Schizochytrium sp. 분의 지방산 조성은 큰 차이를 보였으며, 이 중 일부 필수 고도 불포화 지방산의 조성 차이는 사료 공급 후 어체 지방산 조성의 차이에도 영향을 미치는 것을 확인할 수 있었다.
[수탁번호]
기탁기관명 : 한국생명공학연구원 생물자원센터 (KCTC)
수탁번호 : KCTC15006BP
수탁일자 : 20220620
Figure PCTKR2024009391-appb-img-000001

Claims (14)

  1. 스키조키트리움 속 (Schizochytrium　sp.) 미세조류 유래 바이오매스를 2.25 중량% 내지 45 중량%로 포함하는 장어용 사료 조성물.
  2. 제1항에 있어서, 상기 미세조류 유래 바이오매스는 미세조류, 상기 미세조류의 배양물, 상기 배양물의 건조물, 및 상기 건조물의 파쇄물로 이루어지는 군에서 선택되는 1종 이상을 포함하는 것인, 장어용 사료 조성물.
  3. 제1항에 있어서, 상기 미세조류 유래 바이오매스를 4 중량% 내지 8 중량%로 포함하는 것인, 장어용 사료 조성물.
  4. 제1항에 있어서, 상기 미세조류 유래 바이오매스는 단백질을 40 중량% 내지 95 중량%로 포함하는 것인, 장어용 사료 조성물.
  5. 제1항에 있어서, 상기 미세조류 유래 바이오매스는 지방을 3 중량% 내지 30 중량%로 포함하는 것인, 장어용 사료 조성물.
  6. 제1항에 있어서, 상기 스키조키트리움 속 미세조류는 스키조키트리움 아그레가툼 (Schizochytrium aggregatum), 스키조키트리움 리마시눔 (Schizochytrium limacinum) 및 스키조키트리움 미누툼 (Schizochytrium minutum)으로 이루어지는 군으로부터 선택되는 1종 이상인 것인, 장어용 사료 조성물.
  7. 제1항에 있어서, 상기 장어는 일본장어(Anguilla japonica), 큰장어(Anguilla marmorata), 유럽장어(Anguilla anguilla), 미국장어(Anguilla rostrata) 및 비콜라장어(Anguilla bicolor)로 이루어지는 군으로부터 선택되는 1종 이상인 것인, 장어용 사료 조성물.
  8. 제1항에 있어서, 장어의 성장을 촉진하는 것인, 장어용 사료 조성물.
  9. 제8항에 있어서, 상기 장어의 성장을 촉진하는 것은 장어의 증체율(WGR, Weight Gain Rate)을 증가시키는 것인, 장어용 사료 조성물.
  10. 제8항에 있어서, 상기 장어의 성장을 촉진하는 것은 장어의 사료효율(FE, Feed Efficiency)을 증가시키는 것인, 장어용 사료 조성물.
  11. 제8항에 있어서, 상기 장어의 성장을 촉진하는 것은 장어의 일성장률(SGR, Specific Growth Rate)을 증가시키는 것인, 장어용 사료 조성물.
  12. 제1항 내지 제11항 중 어느 한 항의 장어용 사료 조성물을 장어에 급이하는 단계를 포함하는, 장어의 양식방법.
  13. 제1항 내지 제11항 중 어느 한 항의 장어용 사료 조성물을 장어에 급이하는 단계를 포함하는, 장어의 성장 촉진 방법.
  14. 제1항 내지 제11항 중 어느 한 항의 장어용 사료 조성물의 장어 성장 촉진 용도.
PCT/KR2024/009391 2023-07-04 2024-07-03 스키조키트리움 속 미세조류를 활용한 장어용 사료 및 이의 제조 방법 Ceased WO2025009883A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202480045443.4A CN121941418A (zh) 2023-07-04 2024-07-03 使用裂殖壶菌属微藻的鳗鱼饲料及其制造方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20230086717 2023-07-04
KR10-2023-0086717 2023-07-04

Publications (1)

Publication Number Publication Date
WO2025009883A1 true WO2025009883A1 (ko) 2025-01-09

Family

ID=94172029

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2024/009391 Ceased WO2025009883A1 (ko) 2023-07-04 2024-07-03 스키조키트리움 속 미세조류를 활용한 장어용 사료 및 이의 제조 방법

Country Status (4)

Country Link
KR (1) KR20250007431A (ko)
CN (1) CN121941418A (ko)
TW (1) TWI901246B (ko)
WO (1) WO2025009883A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2015107085A (ja) * 2013-12-05 2015-06-11 長浦　善昭 生のクロレラを飼料としてワムシを増養殖している水槽の内部にてウナギ、及びクロマグロの幼生であるプレレプトセアルスを飼育する方法。
KR101611139B1 (ko) * 2015-11-06 2016-04-08 경상남도 엽상자어의 먹이조성물을 이용한 종묘생산방법
KR20190060026A (ko) * 2017-11-23 2019-06-03 전북대학교산학협력단 어류용 기능성 첨가물과 이를 포함하는 어류용 사료 및 이의 급이방법
KR20220080593A (ko) * 2020-12-07 2022-06-14 씨제이제일제당 (주) 단일 미세조류로부터 단백질 및 오메가-3 지방산을 포함하는 바이오매스를 제조하는 방법 및 이에 의해 제조된 바이오매스

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110026232A (ko) 2009-09-07 2011-03-15 재단법인 하동녹차연구소 육질개선 및 어병예방용 녹차 양식어류 사료

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2015107085A (ja) * 2013-12-05 2015-06-11 長浦　善昭 生のクロレラを飼料としてワムシを増養殖している水槽の内部にてウナギ、及びクロマグロの幼生であるプレレプトセアルスを飼育する方法。
KR101611139B1 (ko) * 2015-11-06 2016-04-08 경상남도 엽상자어의 먹이조성물을 이용한 종묘생산방법
KR20190060026A (ko) * 2017-11-23 2019-06-03 전북대학교산학협력단 어류용 기능성 첨가물과 이를 포함하는 어류용 사료 및 이의 급이방법
KR20220080593A (ko) * 2020-12-07 2022-06-14 씨제이제일제당 (주) 단일 미세조류로부터 단백질 및 오메가-3 지방산을 포함하는 바이오매스를 제조하는 방법 및 이에 의해 제조된 바이오매스

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
RATUCOREH CHRISTIN YOHANA, RETNOAJI BAMBANG: "The growth and histology structure of Indonesian eel (Anguilla bicolor bicolor McClelland, 1844) fed with microalgae", AIP CONFERENCE PROCEEDINGS. 2018, vol. 2002, 1 January 2018 (2018-01-01), XP093259191, DOI: 10.1063/1.5050105 *

Also Published As

Publication number Publication date
TWI901246B (zh) 2025-10-11
KR20250007431A (ko) 2025-01-14
CN121941418A (zh) 2026-04-28
TW202508460A (zh) 2025-03-01

Similar Documents

Publication Publication Date Title
Li et al. Defatted black soldier fly (Hermetia illucens) larvae meal in diets for juvenile Jian carp (Cyprinus carpio var. Jian): Growth performance, antioxidant enzyme activities, digestive enzyme activities, intestine and hepatopancreas histological structure
EP2953487B1 (en) Method to convert insects or worms into nutrient streams
US8895767B2 (en) Obtaining fatty acids from insect larvae
WO2022124590A1 (ko) 신규한 스키조키트리움 속 균주 및 이를 이용한 다중불포화지방산 생산방법
WO2011031020A2 (en) Method for preparing a fermented soybean meal using bacillus strains
WO2015115790A1 (ko) 발효 대두박 생산능이 향상된 바실러스 속 균주 및 이를 이용하여 발효 대두박을 제조하는 방법
WO2013151361A1 (ko) 신규 바실러스 서브틸리스
WO2013151362A1 (ko) 신규 바실러스 서브틸리스
WO2019226002A1 (ko) 락토바실러스 크리스파투스 kbl693 균주 및 그 용도
WO2023120896A1 (ko) 신규한 락티플란티바실러스 플란타럼 ｂｎｔ＿ｇ401 균주 및 이의 용도
WO2022124482A1 (ko) 단일 미세조류로부터 단백질 및 오메가-3 지방산을 포함하는 바이오매스를 제조하는 방법 및 이에 의해 제조된 바이오매스
CN1558722A (zh) 含有五环型三萜类的饲料和肥料
Liu et al. Effects of dietary fish meal replacement by Periplaneta americana meal on growth, metabolism, intestinal health and resistance against Aeromonas hydrophila of Micropterus salmoides
WO2018034492A1 (ko) 페디오코쿠스 펜토사세우스를 유효성분으로 포함하는 th1-매개 면역 질환, th17-매개 면역 질환 또는 th2-매개 면역 질환의 예방, 개선 또는 치료용 조성물
WO2014189176A1 (ko) 체중 감소용 감태 추출물 및 이의 제조방법
WO2025009883A1 (ko) 스키조키트리움 속 미세조류를 활용한 장어용 사료 및 이의 제조 방법
WO2020251208A1 (ko) 코리네박테리움 속 균주 및 이의 배양물을 포함하는 위장질환 예방, 치료 또는 개선용 조성물
WO2020197362A1 (ko) 패칼리박테리움속 미생물 및 이를 포함하는 항암 조성물
EP3362573A1 (en) Bio-based n-acetyl-l-methionine and use thereof
EP4278901A1 (en) Composition for controlling intestinal bacterial flora
WO2014098438A1 (ko) 레스베라트롤 생합성 벼 및 이의 용도
WO2025174210A1 (ko) 영양분이 풍부한 미세조류인 스키조키트리움 속 균주를 활용한 먹이생물 영양강화 제품 제조 방법
WO2022250389A1 (ko) 신규 두나리엘라 살리나 및 이의 용도
WO2024039163A1 (ko) 고함량의 단백질, 항산화 색소 및 오메가-3 지방산을 포함하는 바이오매스를생산하는 신규한 스키조키트리움 속 균주 및 이의 용도
WO2023080399A1 (ko) 세포 내 오일 추출이 용이한 신규한 스키조키트리움 속 균주 및 이를 이용한 오메가3를 함유한 오일 생산방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24836331

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE