WO2024136117A1 - 디오스게닌 유도체를 포함하는 신경염증질환의 예방 또는 치료용 조성물 - Google Patents

디오스게닌 유도체를 포함하는 신경염증질환의 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2024136117A1
WO2024136117A1 PCT/KR2023/017850 KR2023017850W WO2024136117A1 WO 2024136117 A1 WO2024136117 A1 WO 2024136117A1 KR 2023017850 W KR2023017850 W KR 2023017850W WO 2024136117 A1 WO2024136117 A1 WO 2024136117A1
Authority
WO
WIPO (PCT)
Prior art keywords
formula
disease
preventing
diosgenin
represented
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2023/017850
Other languages
English (en)
French (fr)
Inventor
전병선
이상희
유영훈
이지희
남민호
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Institute of Science and Technology KIST
Original Assignee
Korea Institute of Science and Technology KIST
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea Institute of Science and Technology KIST filed Critical Korea Institute of Science and Technology KIST
Publication of WO2024136117A1 publication Critical patent/WO2024136117A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D493/00—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system
    • C07D493/02—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system in which the condensed system contains two hetero rings
    • C07D493/10—Spiro-condensed systems
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/58—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids containing heterocyclic rings, e.g. danazol, stanozolol, pancuronium or digitogenin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/24—Antidepressants
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/322—Foods, ingredients or supplements having a functional effect on health having an effect on the health of the nervous system or on mental function
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/30—Other Organic compounds

Definitions

  • the present invention relates to a composition for preventing or treating neuroinflammatory diseases containing a diosgenin derivative, and more specifically, to a composition for preventing or treating neuroinflammatory diseases containing a diosgenin derivative, or a composition for preventing or treating depression. It's about.
  • Microglia which are phagocytes in the brain, can cause chronic neuroinflammation by producing superoxide and neurotoxin, and activators and neurotoxic substances produced by microglia can cause Parkinson's disease. It is directly related to the pathological progression of diseases caused by neuroinflammation, such as
  • microglial activation is involved in the development of multiple neurodegenerative disorders such as Parkinson's disease (PD), Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), and multiple sclerosis (MS). It is connected to the mechanism. Tumor necrosis factor- ⁇ (TNF- ⁇ ), interleukin-1 ⁇ (IL-1 ⁇ ), interleukin-12 (IL-12), interleukin-6 (IL) -6), its relationship with pro-inflammatory cytokines such as prostaglandin E2 (PGE 2 ) and cyclooxygenase-2 (COX-2) has also been proven.
  • Other toxins have been established as neurotoxins such as lipopolysaccharide, 6-OHDA, and hydrogen peroxide (H 2 O 2 ).
  • Diosgenine is a decomposition product of dioscin, a type of plant steroid saponin, and belongs to the class of triterpenes.
  • Diocin or diosgenin has been studied for its efficacy in suppressing neuroinflammation (Bangrong Cai et. al., Oxid Med Cell Longev, 2020:3153082, 2020; Ze Zhang et al. Chem Pharm Bull (Tokyo), 68(8) ):717-725, 2020), diocin or diosgenin has the disadvantage of being cytotoxic.
  • diosgenin derivatives were synthesized to solve the cytotoxicity problem of dioscin or diosgenin, which has the effect of treating neuroinflammation, and as a result, dioses represented by Formulas 1-4, Formulas 1-9 and Formulas 1-10 were obtained. It was confirmed that genin derivatives suppress neuroinflammation without cytotoxicity. In particular, it was confirmed that the diosgenin derivative represented by Formula 1-4 not only protects nerve cells but also has an antidepressant effect, and the present invention was completed.
  • the purpose of the present invention is to provide a novel diosgenin derivative.
  • Another object of the present invention is to provide a composition for preventing or treating neuroinflammatory diseases containing a diosgenin derivative.
  • Another object of the present invention is to provide a composition for preventing or treating depressive disorder containing a diosgenin derivative.
  • a diosgenin derivative represented by the following formula (1) is provided.
  • R is -OH, -OCH 3 , -NH 2 , -N(CH 3 ) 2 , -N(CH 3 ) 3 , -NHCH 3 , -O-glucose, -Br, -SH or - N is 3 .
  • Formula 1 may preferably be a compound represented by Formula 1-4, a compound represented by Formula 1-9, or a compound represented by Formula 1-10.
  • the present invention provides a pharmaceutical composition for preventing or treating neuroinflammatory diseases containing the diosgenin derivative as an active ingredient.
  • the present invention provides a composition for health functional food for preventing or improving neuroinflammatory diseases containing the diosgenin derivative as an active ingredient.
  • the neuroinflammatory disease is multiple sclerosis, neuroblastoma, ischemic stroke, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, Creutzfeldt-Jakob disease, post-traumatic stress disorder, depression, schizophrenia, or It may be selected from the group consisting of amyotrophic lateral sclerosis.
  • the diosgenin derivative (i) inhibits the production of inflammatory mediators including NO or iNOS; (ii) inhibiting the production of pro-inflammatory cytokines including IL-1 ⁇ , IL-6, and TNF- ⁇ ; (iii) promoting the expression of anti-inflammatory genes, including Heme oxygenase-1 (HO-1); Or (iv) astrocyte or microglia activity can be suppressed by suppressing the production of GFAP (Glial fibrillary acidic protein) or IBA1 (ionized calcium-binding adapter molecule 1).
  • GFAP Gaal fibrillary acidic protein
  • IBA1 ionized calcium-binding adapter molecule
  • the diosgenin derivative can protect nerve cells.
  • the present invention provides a pharmaceutical composition for preventing or treating depressive disorders containing the diosgenin derivative as an active ingredient.
  • the present invention provides a composition for health functional food for preventing or improving depressive disorders containing the diosgenin derivative as an active ingredient.
  • the novel diosgenin derivative synthesized in the present invention was confirmed to suppress neuroinflammation without cytotoxicity, protect nerve cells, and have an antidepressant effect. Therefore, the diosgenin derivative of the present invention can be used as a composition for preventing or treating neuroinflammatory diseases or depressive disorders.
  • Figure 1 shows (a) NF- ⁇ B inhibitory activity, (b) cell survival rate, (c) NF- ⁇ B inhibitory activity and cell survival rate compared to the control group, and (c) NO production level and cell survival rate compared to the control group according to the concentration of diocin. This is confirmed data.
  • the LPS and diocin untreated group was used as a control group.
  • Figure 2 shows data confirming the NO production inhibitory effect and cytotoxicity of the diosgenin derivative synthesized in the present invention.
  • Figure 2a shows diosgenin represented by Formula 2
  • Figure 2b shows diosgenin derivative represented by Formula 1-1
  • Figure 2c shows diosgenin derivative represented by Formula 1-2
  • Figure 2d shows diosgenin represented by Formula 1-3.
  • Genin derivatives Figure 2e is a diosgenin derivative represented by Formula 1-4
  • Figure 2f is a diosgenin derivative represented by Formula 1-5
  • Figure 2g is a diosgenin derivative represented by Formula 1-6
  • Figure 2h is Formula 1 A diosgenin derivative represented by -7
  • Figure 2i shows a diosgenin derivative represented by Formula 1-8
  • Figure 2j shows a diosgenin derivative represented by Formula 1-9
  • Figure 2k shows a diosgenin derivative represented by Formula 1-10.
  • Figure 3 shows the degree of inhibition of (a) iNOS (NOS2), (b) IL-1 ⁇ , (c) IL-6, and (d) TNF- ⁇ production by diosgenin derivatives represented by Formula 1-4 at the RNA level. This is confirmed data.
  • Figure 4 shows data confirming (a) the degree of inhibition of TNF- ⁇ production and (b) cell survival rate according to the concentration of the diosgenin derivative (DG-N(CH 3 ) 2 ) represented by Formula 1-4.
  • Figure 5 shows data confirming the degree of inhibition of expression of HO-1 (Heme oxygenase-1), an anti-inflammatory gene, by the diosgenin derivative (DG-N(CH 3 ) 2 ) represented by Chemical Formula 1-4.
  • Figure 6 shows (a) IBA1 (ionized calcium-binding adapter molecule 1) to confirm the microglia inhibitory activity by the diosgenin derivative (DG-N(CH 3 ) 2 ) represented by Formula 1-4. ) Images showing the expression level observed using immunofluorescence and (b) data quantifying the expression level of IBA1.
  • Figure 7 shows the inhibitory activity of astrocytes and microglia in an animal model by the diosgenin derivative (DG-N(CH 3 ) 2 ) represented by Formula 1-4
  • DG-N(CH 3 ) 2 diosgenin derivative
  • FIG. 7 shows the inhibitory activity of astrocytes and microglia in an animal model by the diosgenin derivative (DG-N(CH 3 ) 2 ) represented by Formula 1-4
  • GFAP Gelial fibrillary acidic protein
  • IBA1 ionized calcium-binding adapter molecule 1
  • Figure 8 shows the number of nerve cells according to treatment with the diosgenin derivative (DG-N(CH 3 ) 2 ) represented by Formula 1-4 (a) to confirm the neuronal protective effect by flow cytometry. Data analyzed and (b) data showing the number of neurons compared to the control group.
  • DG-N(CH 3 ) 2 diosgenin derivative
  • Figure 9 shows data confirming the antidepressant effect in an animal model of the diosgenin derivative (DG-N(CH 3 ) 2 ) represented by Chemical Formula 1-4.
  • (a) is a schematic diagram showing the animal testing method
  • (b) is a sucrose solution intake test (SPT), forced swimming test (FST), and tail suspension according to diosgenin derivative treatment. This is data showing the results of the Suspension Test (TST).
  • SPT sucrose solution intake test
  • FST forced swimming test
  • TST Suspension Test
  • the present invention generally relates to a diosgenin derivative represented by the following formula (1).
  • R is -OH, -OCH 3 , -NH 2 , -N(CH 3 ) 2 , -N(CH 3 ) 3 , -NHCH 3 , -O-glucose, -Br, -SH or - N is 3 .
  • Formula 1 may preferably be a compound represented by Formula 1-4, a compound represented by Formula 1-9, or a compound represented by Formula 1-10.
  • NF- ⁇ B inhibition and NO production were suppressed in LPS-stimulated BV-2 microglial cells in a diocin concentration-dependent manner; It was confirmed that cytotoxicity increased.
  • diosgenin derivatives were synthesized to select diosgenin derivatives that have anti-inflammatory activity without cytotoxicity.
  • a diosgenin derivative represented by Formula 1-4 (Compound 4)
  • a diosgenin derivative represented by Formula 1-9 (Compound 9) were obtained.
  • the diosgenin derivative (Compound 10) represented by Formula 1-10 effectively inhibits NO production while maintaining cell viability ( Figure 2).
  • composition for preventing or treating neuroinflammatory diseases Composition for preventing or treating neuroinflammatory diseases
  • the present invention provides a pharmaceutical composition for the prevention or treatment of neuroinflammatory diseases comprising a diosgenin derivative represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient, or a pharmaceutical composition for the prevention or treatment of neuroinflammatory diseases. It relates to a composition for health functional food for improvement.
  • R is -OH, -OCH 3 , -NH 2 , -N(CH 3 ) 2 , -N(CH 3 ) 3 , -NHCH 3 , -O-glucose, -Br, -SH or - N is 3 .
  • the diosgenin derivative represented by Formula 1 may be represented by the following Formula 1-4, Formula 1-9, or Formula 1-10.
  • the neuroinflammatory disease includes multiple sclerosis, neuroblastoma, ischemic stroke, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, Creutzfeldt-Jakob disease, post-traumatic stress disorder, depression, schizophrenia, or amyotrophic lateral sclerosis. It may be selected from the group consisting of:
  • the diosgenin derivative (i) inhibits the production of inflammatory mediators including NO or iNOS; (ii) inhibiting the production of pro-inflammatory cytokines including IL-1 ⁇ , IL-6, and TNF- ⁇ ; (iii) promoting the expression of anti-inflammatory genes, including Heme oxygenase-1 (HO-1); Or (iv) astrocyte or microglia activity can be suppressed by suppressing the production of GFAP (Glial fibrillary acidic protein) or IBA1 (ionized calcium-binding adapter molecule 1).
  • GFAP Gaal fibrillary acidic protein
  • IBA1 ionized calcium-binding adapter molecule
  • the diosgenin derivative can protect nerve cells.
  • the diosgenin derivative represented by Formula 1-4 had a neuroprotective effect on nerve cells in BV2 cells and HT22 cells (FIG. 8).
  • the diosgenin derivative of the present invention was confirmed to effectively inhibit neuroinflammation without cytotoxicity and have a neuroprotective effect, so it can be used as a composition for preventing or treating neuroinflammatory diseases.
  • composition for preventing or treating depressive disorders Composition for preventing or treating depressive disorders
  • the present invention provides a pharmaceutical composition for preventing or treating depressive disorders, or a health care product for preventing or improving depressive disorders, comprising a diosgenin derivative represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient: It relates to compositions for functional foods.
  • R is -OH, -OCH 3 , -NH 2 , -N(CH 3 ) 2 , -N(CH 3 ) 3 , -NHCH 3 , -O-glucose, -Br, -SH or - N is 3 .
  • the diosgenin derivative represented by Formula 1 may be represented by the following Formula 1-4, Formula 1-9, or Formula 1-10.
  • sucrose preference test SPT
  • FST forced swim test
  • tail suspension tail suspension
  • TST Tail Suspension Test
  • the pharmaceutical composition of the present invention can be formulated and used in various forms according to conventional methods.
  • it can be formulated into oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, etc., and can be formulated and used in the form of external preparations, suppositories, and sterile injection solutions.
  • it may further include pharmaceutically acceptable carriers, excipients, and diluents.
  • it can be formulated and used in the form of external preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., and sterile injection solutions according to conventional methods.
  • the carriers, excipients and diluents include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, These include microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate, and mineral oil.
  • diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations contain at least one excipient, such as starch, calcium carbonate, or sucrose. It is prepared by mixing , lactose, and gelatin. In addition to simple excipients, lubricants such as magnesium styrate talc are also used.
  • Liquid preparations for oral use include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is.
  • Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, etc.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate.
  • injectable ester such as ethyl oleate.
  • As a base for suppositories witepsol, macrogol, tween 61, cacao, laurin, glycerogenatin, etc. can be used.
  • the term “administration” means providing the pharmaceutical composition of the present invention to an individual by any suitable method.
  • the present invention provides a pharmaceutical composition that provides an amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal or human as considered by a researcher, veterinarian, doctor or other clinician, that is, alleviation of symptoms of the disease or disorder being treated. It can be administered in a therapeutically effective amount that induces . It is obvious to those skilled in the art that the therapeutically effective dosage and frequency of administration of the pharmaceutical composition of the present invention will vary depending on the desired effect.
  • the optimal dosage to be administered can be easily determined by a person skilled in the art, depending on the type of disease, the severity of the disease, the content of the active ingredient and other ingredients contained in the composition, the type of dosage form, the patient's age, weight, and general health condition. , gender and diet, administration time, administration route and secretion rate of the composition, treatment period, and various factors including concurrently used drugs.
  • the pharmaceutical composition of the present invention can be administered to an individual through various routes. For example, it may be administered intravenously, intraperitoneally, intramuscularly, intraarterially, bucally, intracardiacally, intramedullary, intrathecally, transdermally, enterally, subcutaneously, sublingually, or topically, but is not limited thereto.
  • the pharmaceutical composition of the present invention can be administered in an amount of 1 to 10,000 mg/kg/day, and may be administered once a day or divided into several times.
  • the health functional food composition of the present invention can be used as a health functional food, food additive, or dietary supplement.
  • the diosgenin derivative of the present invention can be used appropriately according to conventional methods, such as adding it as is or mixing it with other foods or food ingredients.
  • the mixing amount of the health functional food composition may be appropriately changed depending on the purpose of use (prevention, health, or therapeutic treatment).
  • the diosgenin derivative of the present invention when manufacturing food or beverages, is added in an amount of 15% by weight or less, preferably 10% by weight or less, based on the raw materials.
  • the active ingredient when consumed for a long period of time for health and hygiene purposes or health control, it can be added in an amount below the above range. Since there is no problem in terms of safety, the active ingredient can be used in an amount above the above range. there is.
  • examples of food to which the diosgenin derivative of the present invention can be added include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, and ice cream. It includes dairy products, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, etc., and includes all health foods in the conventional sense.
  • the health functional food composition of the present invention When the health functional food composition of the present invention is manufactured into a beverage, it may contain additional ingredients such as various flavoring agents or natural carbohydrates, like ordinary beverages.
  • the natural carbohydrates include monosaccharides such as glucose and fructose; Disaccharides such as maltose and sucrose; Natural sweeteners such as dextrin and cyclodextrin; Synthetic sweeteners such as saccharin and aspartame may be used.
  • the natural carbohydrate is included in an amount of 0.01 to 10% by weight, preferably 0.01 to 0.1% by weight, based on the total weight of the food composition of the present invention.
  • the health functional food composition of the present invention includes various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH regulators, stabilizers, preservatives, glycerin, and alcohol. , carbonating agents used in carbonated beverages, etc., and may include pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks, but are not limited thereto. These ingredients can be used independently or in combination.
  • the ratio of the above additives is not greatly limited, but is preferably contained within the range of 0.01 to 0.1% by weight based on the total weight of the food composition of the present invention.
  • Example 1 Confirmation of neuroinflammation inhibitory activity and cytotoxicity of diocin compounds
  • BV-2 microglial cells stimulated with LPS were treated with diocin at various concentrations (0, 6.25, 12.5, 25, 50, and 100 ⁇ M). After this, NF- ⁇ B inhibitory activity and cell survival rate were confirmed.
  • BV2 cells were seeded in 384 well-plates (Grenier) at a density of 3.8 ⁇ 10 5 cells/ml and then treated with compounds for 24 hours. To measure the signal, 10 ⁇ l of supernatant was analyzed according to the manufacturer's protocol of the QUANTI-Blue assay (Invivogen). Relative luminescence units (RLU) were measured using a microplate reader (TECAN), and each value was normalized to that of DMSO-treated cells.
  • RLU Relative luminescence units
  • diocin As a result, as shown in Figures 1(a) to 1(c), diocin was found to inhibit NF- ⁇ B activity and NO production in a concentration-dependent manner, but showed a high level of cytotoxicity above 25 ⁇ M. confirmed. In other words, diocin has the effect of suppressing neuroinflammation, but its safety window is narrow due to its toxicity. To improve this, a new diosgenin derivative, a decomposition product of diocin, was synthesized.
  • the diosgenin derivative of the present invention was synthesized using diosgenin represented by the following formula (2).
  • the compound of Formula 1-1 was obtained by the following method. Diosgenin (1.1 g, 2.66 mmol) was dissolved in anhydrous dichloromethane (14 mL) in a 50 mL round flask under argon gas, and then dissolved in TsCl (4-Toluenesulfonyl chloride, 2.3 g, 5.85 mmol, 4.57 eq.) at 0°C. and anhydrous pyridine (2.1 mL, 25.85 mmol, 9.78 eq.) and a catalytic amount of DMAP (4-Dimethylaminopyridine) were added. The reaction mixture was stirred at 0°C for 1 hour and then at room temperature for 24 hours.
  • the organic layer was mixed with cold 5% HCl aqueous solution (20 ml x 2) and saturated NaHCO 3 aqueous solution (20 ml x 2). Washed with . The moisture in the organic layer was removed with anhydrous MgSO 4 and filtered, and the solvent was concentrated using a rotary evaporator, and this intermediate compound was used in the next reaction without additional purification.
  • the compound of Formula 1-2 was obtained by the following method. Diosgenin (100 mg, 0.241 mmol) was dissolved in anhydrous THF (2.5 ml) in a 50 ml circular flask under argon nitrogen, and then added with NaH (Sodium hydride, 19.29 mg, 0.482 mmol, 2 eq.) and MeI (Iodomethane, 30 ⁇ l, 0.482 mmol, 2 eq.) was added and stirred at 60°C for 12 hours. When the reaction was completed, it was concentrated under reduced pressure, the concentrate was dissolved again in EtOAc (5 ml), and the organic layer was washed with distilled water (5 ml x 2) and brine (5 ml x 2).
  • DCM: MeOH 50:1
  • the compound of Formula 1-4 was obtained by the following method. Dissolve the compound of formula 1-3 (11 mg, 0.027 mmol) in MeOH (3 ml) in a 10 ml round flask under argon gas, then add 37% aqueous formaldehyde (0.238 ml, 3.19 mmol, 120 eq.) and formic acid. (formic acid; 7.72 ⁇ l, 0.205 mmol, 7.7 eq.) was added and stirred at room temperature. NaBH 3 CN (Sodium cyanoborohydride, 10.03 mg, 0.160 mmol, 6 eq.) was added three times over 3 hours and stirred at room temperature for 4 hours.
  • the compound of Formula 1-6 was obtained by the following method. (a) Dissolve the compound of formula 1-3 (261 mg, 0.610 mmol) in dichloromethane (6 ml) in a 50 ml round flask under argon gas, and then add TEA (Triethylamine, 0.094 ml, 0.671 mmol, 1.1 eq.) Boc 2 O (Di-tert-butyl dicarbonate, 0.147 mg, 0.671 mmol, 1.1 eq.) was added. The reaction mixture was stirred at room temperature for 12 hours, and when the reaction was completed, it was concentrated under reduced pressure, and the concentrate was dissolved again in dichloromethane (10 ml).
  • TEA Triethylamine, 0.094 ml, 0.671 mmol, 1.1 eq.
  • Boc 2 O Di-tert-butyl dicarbonate, 0.147 mg, 0.671 mmol, 1.1 eq.
  • the compound of Formula 1-7 was obtained by the following method.
  • diosgenin 0.1 g, 0.241 mmol
  • Ag 2 CO 3 Silver carbonate, 0.532 g, 1.929 mmol, 8 eq.
  • a solution of acetobromo- ⁇ -D-glucose 0.397 g, 0.965 mmol, 4 eq. was added.
  • the reaction mixture was stirred at room temperature for 48 hours, and when the reaction was completed, undissolved Ag 2 CO 3 was filtered through celite and the solvent was removed using a rotary evaporator.
  • the compound of Formula 1-8 was obtained by the following method. Diosgenin (1 g, 2.412 mmol) was dissolved in anhydrous dichloromethane (20 ml) in a 100 ml circular flask under argon gas, and then CBr 4 (Carbon tetrabromide, 1.20 g, 3.62 mmol, 1.5 eq.) was added at 0°C. After adding it, it was stirred for 10 minutes. Under the same conditions, PPh 3 (Triphenylphosphine, 0.886 g, 3.38 mmol, 1.4 eq.) was added to the reaction mixture and stirred at room temperature for 4 hours.
  • CBr 4 Carbon tetrabromide, 1.20 g, 3.62 mmol, 1.5 eq.
  • the compound of Formula 1-9 was obtained by the following method.
  • the compound of Chemical Formula 1-10 was prepared by dissolving diosgenin (1.1 g, 2.66 mmol) in anhydrous dichloromethane (14 ml) in a 50 ml circular flask under argon gas and then dissolving TsCl (4-Toluenesulfonyl chloride, 2.3 g, 5.85 mmol, 4.57 eq.), anhydrous pyridine (2.1 ml, 25.85 mmol, 9.78 eq.), and a catalytic amount of DMAP (4-Dimethylaminopyridine) were added. The reaction mixture was stirred at 0°C for 1 hour and then at room temperature for 24 hours.
  • each diosgenin derivative was concentrated in BV-2 microglial cells stimulated with LPS. After treatment with star (0, 25, 50, 100, 150, 200, 250 ⁇ M), NO production and cell survival rate were confirmed.
  • the production of NO was analyzed by measuring nitrite concentration in the supernatant of BV-2 cells.
  • Cells were distributed in a 384 well-plate at a density of 3 x 10 5 cells/ml and cultured overnight. Cells were centrifuged after dispensing 200 ng/ml lipopolysaccharide (LPS; Sigma-Aldrich) in the absence or presence of compounds for 24 hours. The supernatant was mixed with an equal volume of Griess reagent, left at room temperature for 15 minutes, and the absorbance of the supernatant was measured at 560 nm to confirm the nitrite concentration.
  • LPS lipopolysaccharide
  • a standard curve was drawn using sodium nitrite (NaNO 2 ), and cell viability was measured by adding 20 ⁇ l of Cell Tighter Glo reagent (Promega) to the cells and incubating them at room temperature for 10 minutes and measuring luminescence. Luminescence signals were measured using a microplate reader (BioTek). Each value was normalized to that of DMSO-treated cells.
  • a diosgenin derivative (Compound 4) represented by Formula 1-4 As a result, as shown in FIGS. 2A to 2K, a diosgenin derivative (Compound 4) represented by Formula 1-4, a diosgenin derivative (Compound 9) represented by Formula 1-9, and a diosgenin derivative represented by Formula 1-10. It was confirmed that the diosgenin derivative (Compound 10) inhibits NO production without cytotoxicity, and among them, the diosgenin derivative (Compound 4) represented by Formula 1-4 was confirmed to have the best efficacy.
  • Example 4 Confirmation of neuroinflammation inhibition effect of diosgenin derivative (Compound 4) - in vitro ( in vitro )
  • the neuroinflammation inhibitory effect of the diosgenin derivative (Compound 4; DG-N(CH 3 ) 2 ), which was confirmed to have the best neuroinflammation inhibitory effect without cytotoxicity in Example 3, was confirmed.
  • RNA 1000 ng was reverse transcribed for 5 minutes at 25°C, 30 minutes at 42°C, and 5 minutes at 85°C.
  • cDNA products were mixed with IQ SYBR Green Supermix (Bio-Rad) and individual primers (Bioneer) specified in Table 1 below using a real-time thermocycler (Bio-Rad, CFX Connect).
  • GAPDH was used as a housekeeping gene to normalize mRNA levels.
  • primer sequence gene sequence (5’ -> 3’) sequence number iNOS forward GAGACAGGGAAGTCTGAAGCAC SEQ ID NO: 1 reverse CCAGCAGTAGTTGCTCCTCTTC SEQ ID NO: 2 TNF ⁇ forward GGTGCCTATGTCTCAGCCTCTT SEQ ID NO: 3 reverse GCCATAGAACTGATGAGAGGGAG SEQ ID NO: 4 IL-1b forward TGGACCTTCCAGGATGAGGACA SEQ ID NO: 5 reverse GTTCATCTCGGAGCCTGTAGTG SEQ ID NO: 6 IL-6 forward TACCACTTCACAAGTCGGAGGC SEQ ID NO: 7 reverse CTGCAAGTGCATCATCGTTGTTC SEQ ID NO: 8 GAPDH forward CATCACTGCCACCCAGAAGACTG SEQ ID NO: 9 reverse ATGCCAGTGAGCTTCCCGTTCAG SEQ ID NO: 10
  • TNF- ⁇ a pro-inflammatory cytokine
  • BV-2 microglial cells stimulated with LPS were treated with a diosgenin derivative (compound 4) at different concentrations (0, 12.5, 50, 200 ⁇ M). Then, the level of TNF- ⁇ production was measured using a TNF- ⁇ ELISA kit.
  • TNF- ⁇ tumor necrosis factor- ⁇
  • ELISA enzyme-linked immunosorbent assay
  • the detection antibody was diluted in reagent diluent and added to each well, incubated at room temperature for 2 hours, and then washed with washing buffer. Streptavidin-HRP was added to each well, incubated at room temperature for 20 minutes, and then washed with washing buffer. TMB solution (Biosesang) was added to each well and incubated for 20 minutes at room temperature. Then, 2 NH 2 SO 4 was added to each well, and the optical density of each well was measured using a microplate reader (BioTek) set to 450 nm.
  • BV-2 microglial cells stimulated with LPS were treated with a diosgenin derivative (compound 4), it was confirmed whether the expression of HO-1 (Heme oxygenase-1), an anti-inflammatory gene, increased.
  • HO-1 Heme oxygenase-1
  • RNA 1000 ng was reverse transcribed for 5 minutes at 25°C, 30 minutes at 42°C, and 5 minutes at 85°C.
  • cDNA products were mixed with IQ SYBR Green Supermix (Bio-Rad) and individual primers (Bioneer) specified in Table 2 below using a real-time thermocycler (Bio-Rad, CFX Connect).
  • GAPDH was used as a housekeeping gene to normalize mRNA levels.
  • primer sequence gene sequence (5’ -> 3’) sequence number HO-1 forward CACTCTGGAGATGACACCTGAG SEQ ID NO: 11 reverse GTTGTTCCTCTGTCAGCATCACC SEQ ID NO: 12 GAPDH forward CATCACTGCCACCCAGAAGACTG SEQ ID NO: 9 reverse ATGCCAGTGAGCTTCCCGTTCAG SEQ ID NO: 10
  • Cells were seeded in confocal dishes and maintained for one day. Cells were seeded with 200 ng/ml LPS (Sigma-Aldrich) in the absence or presence of the compound for 24 hours. After washing with PBS, 200 ⁇ l of 100% MeOH solution was added and the cells were incubated at -20°C for 5 minutes. The solution was then removed and the sample was washed three times with PBS. A PBS solution (0.1% Triton-X-100 in PBS) was added and incubated for 15 minutes at room temperature. Afterwards, the solution was removed and the sample was washed three times with PBS. Samples were blocked with 2% BSA in PBS for 1 hour at room temperature, and then treated with primary antibody solution at 4°C for 1 day.
  • LPS Long-Aldrich
  • Antibody concentrations were according to the manufacturer's instructions. The primary antibody solution was removed and the samples were washed three times with PBS. The secondary antibody solution was then incubated at room temperature for 1 hour. Next, the antibody solution was removed and the sample was washed three times with PBS. For nuclear staining, Hoechst 33342 was diluted in PBS, added to each well, and incubated for 5 minutes at room temperature. The solution was then removed, filled with PBS, and imaging was performed under a microscope (Nikon TS2-LS).
  • Example 5 Confirmation of neuroinflammation inhibitory effect of diosgenin derivative (Compound 4) - in vivo ( in vivo )
  • mice After obtaining 5-week-old male ICR mice from Daehan Biolink (DBL), they had an adaptation period of 1 week.
  • the animals underwent a handling process 3 days before the behavioral experiment, and the experiment was conducted with more than 10 animals in each experimental group.
  • the day before the experiment saline solution or compound 4 (50 mg/kg) was injected intraperitoneally (i.p.) to the experimental animals, and 1 hour later, saline solution or lipopolysaccharide (LPS; 1 mg/kg) was injected intravenously (i.v.) to the experimental animals. Injected.
  • mice Four hours later, for histological analysis, mice were anesthetized with urethane and perfused with 20 ml of saline followed by 20 ml of 4% paraformaldehyde (PFA). Brains were obtained, post-fixed in 4% PFA for 6 hours, and then refrigerated in 30% sucrose solution at 4°C for one day. Brains were sectioned at 30 ⁇ m in a cryostat microtome (Thermo Scientific, Waltham, United States).
  • PFA paraformaldehyde
  • BV2 and HT22 cells were seeded at a density of 5 x 10 5 cells/ml in a 12-well plate and 3 x 10 5 cells/ml in a 6-well plate, respectively, and incubated overnight.
  • BV2 cells were added with 200 ng/ml LPS (Sigma) in the absence or presence of compounds for 4 hours.
  • HT22 cells were incubated with 5 ⁇ M Green Cell Tracker Solution (Thermo fischer) diluted in serum-free medium for 45 minutes at room temperature. Afterwards, HT22 cells were harvested and seeded directly into BV2 cells at a density of 4 x 10 6 cells/ml for 20 hours.
  • the cells were centrifuged at 200 g for 5 minutes at room temperature, and the cell sediment was resuspended in 600 ⁇ l of PBS.
  • results were obtained using a 488 nm wavelength laser through a cell analyzer (BECKMAN COULTER, cytoFLEX), and each information was processed into at least 20,000 events.
  • the diosgenin derivative (Compound 4) inhibits LPS-stimulated BV2 cell and HT22 cell death.
  • the diosgenin derivative of the present invention has a protective effect on nerve cells.
  • the diosgenin derivative (Compound 4) and LPS were administered to mice as shown in the schematic diagram in FIG. 9(a).
  • TST Tail floatation test
  • the size of the box where the experimental animal's tail is hung is 44 cm high, 14 cm wide, and 14 cm deep.
  • each mouse was suspended within a three-walled rectangular compartment.
  • the fixing device used to tie the tail of each experimental animal was located in the upper center of the box, and the device was made by cutting a 17 cm piece of tape and attaching the tail to a marked position about 2 cm from one end. All procedures were performed before 4 PM to observe animal behavior. The video was recorded for a total of 8 minutes, and the 2 to 8 minute section was used for immobility analysis. Calculation of the immobility time of experimental animals was performed by the Noldus analysis program.
  • the tank used in the experiment was filled with water to a height of 20 cm, a diameter of 10 cm, and a depth of 15 cm.
  • the water in the tank was replaced after testing for each experimental animal.
  • the water temperature was 21 °C to 23 °C, and all procedures were performed before 3 PM to observe animal behavior.
  • the video was recorded for a total of 6 minutes, and the 2 to 6 minute section was used for immobility analysis. Calculation of the immobility time of experimental animals was performed by the Noldus analysis program.
  • mice performed TST and FST, and each tube was again filled with 14 ml of water and 1% sucrose solution and distributed. After 24 hours, the water and sucrose solution intake of each mouse was compared.
  • the novel diosgenin derivative synthesized in the present invention has been confirmed to suppress neuroinflammation without cytotoxicity, protect nerve cells, and have an antidepressant effect. Therefore, it can be used as a composition for preventing or treating neuroinflammatory diseases or depressive disorders. It can be utilized.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Neurology (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Psychiatry (AREA)
  • Pain & Pain Management (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 디오스게닌 유도체를 포함하는 신경염증질환의 예방 또는 치료용 조성물에 관한 것으로, 보다 상세하게는 디오스게닌 유도체를 포함하는 신경염증질환의 예방 또는 치료용 조성물, 또는 우울증 예방 또는 치료용 조성물에 관한 것이다. 본 발명에서 합성한 신규한 디오스게닌 유도체는 세포독성 없이 신경염증을 억제하고, 신경세포를 보호할 뿐만 아니라, 항우울증 효과가 있는 것을 확인하였다. 따라서, 본 발명의 디오스게닌 유도체는 신경염증질환 또는 우울증 장애의 예방 또는 치료용 조성물로 활용될 수 있다.

Description

디오스게닌 유도체를 포함하는 신경염증질환의 예방 또는 치료용 조성물
본 발명은 디오스게닌 유도체를 포함하는 신경염증질환의 예방 또는 치료용 조성물에 관한 것으로, 보다 상세하게는 디오스게닌 유도체를 포함하는 신경염증질환의 예방 또는 치료용 조성물, 또는 우울증 예방 또는 치료용 조성물에 관한 것이다.
뇌의 식세포(phagocyte)인 미세아교세포(Microglia)는 수퍼옥사이드(superoxide)와 신경독(neurotoxin)을 생성함으로써 만성 신경염증을 유발할 수 있으며, 미세아교세포에서 생산되는 활성화제 및 신경독성 물질은 파킨슨병등과 같은 신경염증에 의해 유발되는 질병의 병리학적 진행과 직접 관련이 있다.
특히, 미세아교세포 활성화는 파킨슨병(Parkinson's disease; PD), 알츠하이머(Alzheimer's disease; AD), 루게릭병(amyotrophic lateral sclerosis; ALS) 및 다발성 경화증(multiple sclerosis; MS)과 같은 다발성 신경 퇴행성 장애의 발병 기전과 연결되어 있다. 종양괴사인자(tumor necrosis factor-α; TNF-α), 인터루킨-1β(interleukin-1β; IL-1β), 인터루킨-12(interleukin-12; IL-12), 인터루킨-6(interleukin-6; IL-6), 프로스타글라딘(prostaglandin E2; PGE2) 및 사이클로옥시게나제(cyclooxygenase-2; COX-2) 등과 같은 전염증성 사이토카인과의 관련성도 입증되었다. 다른 독소는 지질다당류(Lipopolysaccharide), 6-OHDA 및 과산화수소(H2O2)와 같은 신경독으로 정립되어 있다. 이들 독소는 미소아교세포를 자극하여 NF-κB, p38, MAPK, JNK, ERK 및 IRF3과 같은 염증 경로를 활성화시키는 것으로 보고되었다 (Kim, D.-C., et al., Molecules, 22(12):2130, 2017; He, X., et al., Toxicology letters, 283: 58-68, 2018; Lim, H.-W., et al., Food and chemical toxicology, 72: 265-272, 2014; Cho, D.-Y., et al., Molecules, 21(12):1718, 2016). 그러므로, 미세아교세포 활성화 조절은 신경 염증을 약화시키는 중요한 치료 전략으로 작용할 수 있다.
한편, 디오스게닌(Diosgenine)은 디오신(dioscin)의 분해물질로, 식물성 스테로이드 사포닌의 일종으로 트리터펜(triterpene)에 속한다. 디오신 또는 디오스게닌은 신경염증 억제 효능에 대해 연구된 바 있으나(Bangrong Cai et. al., Oxid Med Cell Longev, 2020:3153082, 2020; Ze Zhang et al. Chem Pharm Bull (Tokyo), 68(8):717-725, 2020), 디오신 또는 디오스게닌은 세포독성을 보이는 단점이 있다.
이에, 본 발명에서는 신경염증 치료 효능을 가지는 디오신 또는 디오스게닌의 세포독성 문제를 해결하기 위해 디오스게닌 유도체를 합성한 결과, 화학식 1-4, 화학식 1-9 및 화학식 1-10으로 표시되는 디오스게닌 유도체가 세포독성 없이 신경염증을 억제하는 것을 확인하였다. 특히, 화학식 1-4로 표시되는 디오스게닌 유도체는 신경세포를 보호할 뿐만 아니라, 항우울증 효과가 있는 것을 확인하고, 본 발명을 완성하였다.
따라서, 본 발명의 목적은 신규한 디오스게닌 유도체를 제공하는 데 있다.
본 발명의 다른 목적은 디오스게닌 유도체를 포함하는 신경염증질환의 예방 또는 치료용 조성물을 제공하는 데 있다.
본 발명의 또 다른 목적은 디오스게닌 유도체를 포함하는 우울장애 예방 또는 치료용 조성물을 제공하는 데 있다.
상술한 목적을 달성하기 위해,
하기 화학식 1로 표시되는 디오스게닌 유도체를 제공한다.
[화학식 1]
Figure PCTKR2023017850-appb-img-000001
상기, R은 -OH, -OCH3, -NH2, -N(CH3)2, -N(CH3)3, -NHCH3, -O-글루코스(glucose), -Br, -SH 또는 -N3이다.
본 발명에 있어서, 상기 화학식 1은 바람직하게, 하기 화학식 1-4로 표시되는 화합물, 하기 화학식 1-9로 표시되는 화합물, 또는 하기 화학식 1-10으로 표시되는 화합물일 수 있다.
[화학식 1-4]
Figure PCTKR2023017850-appb-img-000002
[화학식 1-9]
Figure PCTKR2023017850-appb-img-000003
[화학식 1-10]
Figure PCTKR2023017850-appb-img-000004
다른 목적을 달성하기 위해,
본 발명은 상기 디오스게닌 유도체를 유효성분으로 포함하는 신경염증질환의 예방 또는 치료용 약학적조성물을 제공한다.
또한, 본 발명은 상기 디오스게닌 유도체를 유효성분으로 포함하는 신경염증질환의 예방 또는 개선용 건강기능식품용 조성물을 제공한다.
본 발명의 바람직한 일실시예에 있어서, 상기 신경염증질환은 다발성 경화증, 신경모세포종, 허혈성 뇌졸중, 알츠하이머 질환, 파킨슨 질환, 루게릭 질환, 헌팅턴 질환, 크로이츠펠트야콥병, 외상 후 스트레스 장애, 우울증, 정신분열증 또는 근위축성측색경화증으로 구성된 군으로부터 선택될 수 있다.
본 발명의 바람직한 다른 일실시예에 있어서, 상기 디오스게닌 유도체는 (ⅰ) NO 또는 iNOS를 포함하는 염증반응 매개인자(inflammatory mediators) 생성 억제; (ⅱ) IL-1β, IL-6 및 TNF-α를 포함하는 전염증성 사이토카인(cytokines) 생성 억제; (ⅲ) HO-1(Heme oxygenase-1)를 포함하는 항염증 유전자 발현 촉진; 또는 (ⅳ) GFAP(Glial fibrillary acidic protein) 또는 IBA1(ionized calcium-binding adapter molecule 1)를 생성 억제를 통해 성상교세포(astrocyte) 또는 미세아교세포(microglia) 활성을 억제 억제할 수 있다.
본 발명의 바람직한 또 다른 일실시예에 있어서, 상기 디오스게닌 유도체는 신경세포를 보호할 수 있다.
또 다른 목적을 달성하기 위해,
본 발명은 상기 디오스게닌 유도체를 유효성분으로 포함하는 우울장애 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 상기 디오스게닌 유도체를 유효성분으로 포함하는 우울장애 예방 또는 개선용 건강기능식품용 조성물을 제공한다.
본 발명에서 합성한 신규한 디오스게닌 유도체는 세포독성 없이 신경염증을 억제하고, 신경세포를 보호할 뿐만 아니라, 항우울증 효과가 있는 것을 확인하였다. 따라서, 본 발명의 디오스게닌 유도체는 신경염증질환 또는 우울증 장애의 예방 또는 치료용 조성물로 활용될 수 있다.
도 1은 디오신의 농도에 따른 (a) NF-κB 억제 활성, (b) 세포 생존율, (c) 대조군 대비 NF-κB 억제 활성 및 세포 생존율, 및 (c) 대조군 대비 NO 생성 정도 및 세포 생존율을 확인한 데이터이다. LPS 및 디오신 무처리군을 대조군으로 사용하였다.
도 2는 본 발명에서 합성한 디오스게닌 유도체의 NO 생성 억제 효능 및 세포 독성 정도를 확인한 데이터이다.
도 2a는 화학식 2로 표시되는 디오스게닌, 도 2b는 화학식 1-1로 표시되는 디오스게닌 유도체, 도 2c는 화학식 1-2로 표시되는 디오스게닌 유도체, 도 2d는 화학식 1-3으로 표시되는 디오스게닌 유도체, 도 2e는 화학식 1-4로 표시되는 디오스게닌 유도체, 도 2f는 화학식 1-5로 표시되는 디오스게닌 유도체, 도 2g는 화학식 1-6으로 표시되는 디오스게닌 유도체, 도 2h는 화학식 1-7로 표시되는 디오스게닌 유도체, 도 2i는 화학식 1-8로 표시되는 디오스게닌 유도체, 도 2j는 화학식 1-9로 표시되는 디오스게닌 유도체, 및 도 2k는 화학식 1-10으로 표시되는 디오스게닌 유도체에 대한 NO 생성 억제 효능 및 세포 생존율을 확인한 데이터이다.
도 3은 화학식 1-4로 표시되는 디오스게닌 유도체에 의한 (a) iNOS(NOS2), (b) IL-1β, (c) IL-6 및 (d) TNF-α 생성 억제 정도를 RNA 레벨에서 확인한 데이터이다.
도 4는 화학식 1-4로 표시되는 디오스게닌 유도체(DG-N(CH3)2)의 농도에 따른 (a) TNF-α 생성 억제 정도 및 (b) 세포 생존율을 확인한 데이터이다.
도 5는 화학식 1-4로 표시되는 디오스게닌 유도체(DG-N(CH3)2)에 의한 항염증 유전자인 HO-1(Heme oxygenase-1) 발현 억제 정도를 확인한 데이터이다.
도 6은 화학식 1-4로 표시되는 디오스게닌 유도체(DG-N(CH3)2)에 의한 미세아교세포(microglia) 억제 활성을 확인하게 위해, (a) IBA1(ionized calcium-binding adapter molecule 1) 발현정도를 면역형광법으로 관찰한 이미지 및 (b) IBA1 발현정도를 수치화한 데이터이다.
도 7은 화학식 1-4로 표시되는 디오스게닌 유도체(DG-N(CH3)2)에 의한 동물모델에서 성상교세포(astrocyte) 및 미세아교세포(microglia) 억제 활성을 확인하게 위해, (a) GFAP(Glial fibrillary acidic protein) 및 IBA1(ionized calcium-binding adapter molecule 1) 발현정도를 면역형광법으로 관찰한 이미지, (b) 성상교세포에서 GFAP 발현정도를 수치화한 데이터 및 (c) 미세아교세포에서 IBA1 발현정도를 수치화한 데이터이다.
도 8은 화학식 1-4로 표시되는 디오스게닌 유도체(DG-N(CH3)2)에 의한 신경세포 보호 효과를 확인하기 위해, (a) 디오스게닌 유도체 처리에 따른 신경세포의 수를 유세포 분석기로 분석한 데이터 및 (b) 대조군 대비 신경세포수를 나타낸 데이터이다.
도 9는 화학식 1-4로 표시되는 디오스게닌 유도체(DG-N(CH3)2)에 의한 동물모델에서 항우울증 효과를 확인한 데이터이다. (a)는 동물실험 방법을 나타낸 모식도이고, (b)는 디오스게닌 유도체 처리에 따른 자당용액 섭취 검사(Sucrose Preference Test, SPT), 강제수영 실험(Forced Swimming Test, FST) 및 꼬리 매달기(Tail Suspension Test, TST)를 결과를 나타낸 데이터이다.
이하, 본 발명을 상세하게 설명한다.
신규한 디오스게닌 유도체
본 발명은 일관점에서, 하기 화학식 1로 표시되는 디오스게닌 유도체에 관한 것이다.
[화학식 1]
Figure PCTKR2023017850-appb-img-000005
상기, R은 -OH, -OCH3, -NH2, -N(CH3)2, -N(CH3)3, -NHCH3, -O-글루코스(glucose), -Br, -SH 또는 -N3이다.
본 발명에 있어서, 상기 화학식 1은 바람직하게, 하기 화학식 1-4로 표시되는 화합물, 하기 화학식 1-9로 표시되는 화합물, 또는 하기 화학식 1-10으로 표시되는 화합물일 수 있다.
[화학식 1-4]
Figure PCTKR2023017850-appb-img-000006
[화학식 1-9]
Figure PCTKR2023017850-appb-img-000007
[화학식 1-10]
Figure PCTKR2023017850-appb-img-000008
본 발명의 구체적인 일실시예에서, 디오신의 항염증효과 및 세포독성 정도를 확인한 결과, 디오신 농도 의존적으로 LPS-자극된 BV-2 미세아교세포에서 NF-κB 억제 및 NO 생성은 억제되는 반면, 세포 독성이 증가하는 것을 확인하였다.
이에, 본 발명에서는 세포 독성 없이 항염증 활성을 가지고 있는 디오스게닌 유도체를 선별하고자 10종의 디오스게닌 유도체를 합성하였다. 신규한 디오스게닌 유도체를 LPS-자극된 BV-2 미세아교세포에 각각 처리한 결과, 화학식 1-4로 표시되는 디오스게닌 유도체(화합물 4), 화학식 1-9로 표시되는 디오스게닌 유도체(화합물 9), 화학식 1-10으로 표시되는 디오스게닌 유도체(화합물 10)가 세포 생존율을 유지하면서 NO 생성을 효과적으로 억제하는 것을 확인하였다 (도 2).
신경염증질환 예방 또는 치료용 조성물
본 발명은 다른 일관점에서, 하기 화학식 1로 표시되는 디오스게닌 유도체 또는 이의 약제학적으로 허용되는 염을 유효성분으로 포함하는 신경염증질환의 예방 또는 치료용 약학적 조성물, 또는 신경염증 질환의 예방 또는 개선용 건강기능식품용 조성물에 관한 것이다.
[화학식 1]
Figure PCTKR2023017850-appb-img-000009
상기, R은 -OH, -OCH3, -NH2, -N(CH3)2, -N(CH3)3, -NHCH3, -O-글루코스(glucose), -Br, -SH 또는 -N3이다.
본 발명에 있어서, 상기 화학식 1로 표시되는 디오스게닌 유도체는 하기 화학식 1-4, 화학식 1-9 또는 화학식 1-10으로 표시될 수 있다.
[화학식 1-4]
Figure PCTKR2023017850-appb-img-000010
[화학식 1-9]
Figure PCTKR2023017850-appb-img-000011
[화학식 1-10]
Figure PCTKR2023017850-appb-img-000012
본 발명에 있어서, 상기 신경염증질환은 다발성 경화증, 신경모세포종, 허혈성 뇌졸중, 알츠하이머 질환, 파킨슨 질환, 루게릭 질환, 헌팅턴 질환, 크로이츠펠트야콥병, 외상 후 스트레스 장애, 우울증, 정신분열증 또는 근위축성측색경화증으로 구성된 군으로부터 선택될 수 있다.
본 발명에 있어서, 상기 디오스게닌 유도체는 상기 디오스게닌 유도체는 (ⅰ) NO 또는 iNOS를 포함하는 염증반응 매개인자(inflammatory mediators) 생성 억제; (ⅱ) IL-1β, IL-6 및 TNF-α를 포함하는 전염증성 사이토카인(cytokines) 생성 억제; (ⅲ) HO-1(Heme oxygenase-1)를 포함하는 항염증 유전자 발현 촉진; 또는 (ⅳ) GFAP(Glial fibrillary acidic protein) 또는 IBA1(ionized calcium-binding adapter molecule 1)를 생성 억제를 통해 성상교세포(astrocyte) 또는 미세아교세포(microglia) 활성을 억제 억제할 수 있다.
본 발명에 있어서, 상기 디오스게닌 유도체는 신경세포를 보호할 수 있다.
본 발명의 구체적인 다른 일실시예에서, LPS-자극된 BV2 미세아교세포에 화학식 1-4로 표시되는 디오스게닌 유도체를 처리한 결과, 전염증성 사이토카인인 NOS2, IL-1β, IL-6 및 TNF-α의 생성을 억제하는 것을 확인하였으며(도 3), 세포 독성 없이 디오스게닌 유도체 농도 의존적으로 TNF-α 생성이 억제되는 것을 확인하였다 (도 4). 또한, 화학식 1-4로 표시되는 디오스게닌 유도체는 항염증 유전자인 HO-1(Heme oxygenase-1) 발현을 증가시키는 것을 확인하였다 (도 5).
본 발명의 구체적인 또 다른 일실시예에서, 화학식 1-4로 표시되는 디오스게닌 유도체에 의해 미세아교세포의 활성이 억제되는지 확인한 결과, BV2 미세아교세포에서 LPS로 인해 유도된 IBA1(ionized calcium-binding adapter molecule 1) 발현이 대조군과 유사한 수준으로 감소하는 것을 확인하였다 (도 6).
또한, 동물모델에 화학식 1-4로 표시되는 디오스게닌 유도체를 투여한 결과, 성상교세포(astrocyte) 및 미세아교세포(microglia) 모두에서 LPS로 인해 유도된 GFAP(Glial fibrillary acidic protein) 또는 IBA1(ionized calcium-binding adapter molecule 1) 발현이 대조군과 유사한 수준으로 감소하는 것을 확인하였다 (도 7).
나아가, BV2 세포 및 HT22세포에서 화학식 1-4로 표시되는 디오스게닌 유도체가 신경세포에 대한 신경보호효과가 있는 것을 확인하였다 (도 8).
즉, 본 발명의 디오스게닌 유도체는 세포 독성 없이 효과적으로 신경염증을 억제하고 신경보호효과를 가지고 있는 것을 확인하였으므로, 신경염증질환의 예방 또는 치료를 위한 조성물로 활용될 수 있다.
우울장애 예방 또는 치료용 조성물
본 발명은 또 다른 일관점에서, 하기 화학식 1로 표시되는 디오스게닌 유도체 또는 이의 약제학적으로 허용되는 염을 유효성분으로 포함하는 우울장애 예방 또는 치료용 약학적 조성물, 또는 우울장애 예방 또는 개선용 건강기능식품용 조성물에 관한 것이다.
[화학식 1]
Figure PCTKR2023017850-appb-img-000013
상기, R은 -OH, -OCH3, -NH2, -N(CH3)2, -N(CH3)3, -NHCH3, -O-글루코스(glucose), -Br, -SH 또는 -N3이다.
본 발명에 있어서, 상기 화학식 1로 표시되는 디오스게닌 유도체는 하기 화학식 1-4, 화학식 1-9 또는 화학식 1-10으로 표시될 수 있다.
[화학식 1-4]
Figure PCTKR2023017850-appb-img-000014
[화학식 1-9]
Figure PCTKR2023017850-appb-img-000015
[화학식 1-10]
Figure PCTKR2023017850-appb-img-000016
본 발명의 구체적인 일실시예에서, 디오스게닌 유도체에 의한 동물모델에서 항우울증 효과를 확인하기 위해, 자당 선호도(Sucrose Preference Test, SPT) 변화, 강제 수영법(Forced Swim Test, FST), 꼬리 매달기(Tail Suspension Test, TST) 등의 행동변화를 관찰한 결과, 화학식 1-4로 표시되는 디오스게닌 유도체에 의해 우울 행동이 개선되는 것을 확인하였다.
본 발명의 약학 조성물은 각각 통상의 방법에 따라 다양한 형태로 제형화하여 사용될 수 있다. 예컨대, 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽 등의 경구형 제형으로 제형화할 수 있고, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 각각의 제형에 따라 약학적으로 허용가능한 담체, 부형제 및 희석제를 더 포함할 수 있다. 또한 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 외용제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.
상기 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로오스, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시 벤조에이트, 프로필히드록시 벤조에이트, 탈크, 마그네슘 스테아레이트, 광물유 등이 있다. 상기 약학 조성물을 제제화나 제형화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.
경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 조성물에 적어도 하나 이상의 부형제, 예를 들면 전분, 칼슘 카보네이트(calcium carbonate), 수크로오스(sucrose), 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데, 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제 등이 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명에서 사용되는 용어 "투여"는 임의의 적절한 방법으로 개체에게 본 발명의 약학 조성물을 제공하는 것을의미한다. 본 발명은 약학 조성물은 연구자, 수의사, 의사 또는 기타 임상에 의해 생각되는 조직계, 동물 또는 인간에서 생물학적 또는 의학적 반응을 유도하는 유효 성분 또는 약학적 조성물의 양, 즉 치료되는 질환 또는 장애의 증상의 완화를 유도하는 양인 치료상 유효량으로 투여할 수 있다. 본 발명의 약학 조성물에 대한 치료상 유효 투여량 및 투여횟수는 원하는 효과에 따라 변화될 것임은 당업자에게 자명하다. 그러므로, 투여될 최적의 투여량은 당업자에 의해 쉽게 결정될 수 있으며, 질환의 종류, 질환의 중증도, 조성물에 함유된 유효성분 및 다른 성분의 함량, 제형의 종류, 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여시간, 투여 경로 및 조성물의분비율, 치료기간, 동시 사용되는 약물을 비롯한 다양한 인자 등에 따라 조절될 수 있다. 본 발명의 약학 조성물은 개체에게 다양한 경로로 투여될 수 있다. 예를 들어, 정맥내, 복강내, 근육내, 동맥내, 구강, 심장내, 골수내, 경막내, 경피, 장관, 피하, 설하 또는 국소 투여할 수 있으나, 이에 제한되지 않는다. 본 발명의 약학 조성물은 1 ~ 10,000㎎/㎏/일의 양으로 투여할 수 있으며, 하루에 한번 투여할 수도 있고, 수 회에 나누어 투여할 수도 있다.
본 발명의 건강기능식품 조성물은 건강기능식품, 식품 첨가제 또는 식이보조제로 사용될 수 있다. 본 발명의 디오스게닌 유도체를 식품 첨가제로 사용할 경우, 그대로 첨가하거나, 다른 식품 또는 식품 성분과 함께 혼합하여 사용되는 등 통상적인 방법에 따라 적절하게 사용될 수 있다.
또한 상기 건강기능식품 조성물의 혼합양은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 변경될 수 있다. 구체적인 예로, 식품 또는 음료의 제조 시에는 본 발명의 디오스게닌 유도체는 원료에 대하여 15중량% 이하, 바람직하게는 10중량% 이하의 양으로 첨가된다. 그러나 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하여 장기간 섭취할 경우에는 상기 범위 이하의 양으로 첨가될 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다.
상기 식품의 종류에는 특별한 제한은 없으나, 본 발명의 디오스게닌 유도체를 첨가할 수 있는 식품의 예로는 육류, 소시지, 빵, 초콜릿, 캔디류, 스낵류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 수프, 음료수, 차, 드링크제, 알코올 음료, 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강식품을 모두 포함한다.
본 발명의 건강기능식품 조성물이 음료로 제조될 경우 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등의 추가 성분을 포함할 수 있다. 상기 천연 탄수화물로는 포도당, 과당 등의 모노사카라이드; 말토오스, 수크로오스 등의 디사카라이드; 덱스트린, 사이클로덱스트린 등의 천연 감미제; 사카린, 아스파르탐 등의 합성 감미제 등이 사용될 수 있다. 상기 천연 탄수화물은 본 발명의 식품 조성물 총 중량에 대하여 0.01 ~ 10중량%, 바람직하 게는 0.01~0.1중량%로 포함된다.
본 발명의 건강기능식품 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 포함할 수 있으며, 천연 과일주스, 과일주스 음료 및 야채 음료의 제조를 위한 과육을 포함할 수 있으나 이에 제한되지 않는다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 상기의 첨가제 비율은 크게 제한되지는 않으나, 본 발명의 식품 조성물 총 중량에 대하여 0.01 ~ 0.1중량% 범위내로 포함되는 것이 바람직하다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다.
이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1: 디오신 화합물의 신경염증억제 활성 및 세포 독성 정도 확인
본 발명에서는 디오신의 신경염증억제 활성 및 세포 독성 정도를 확인하기 위해, LPS로 자극된 BV-2 미세아교세포에 디오신을 농도별(0, 6.25, 12.5, 25, 50, 100 μM)로 처리한 후, NF-κB 억제 활성 및 세포 생존율을 확인하였다
NF-kB 매개 면역 반응을 모니터링하기 위해 BV2 세포를 3.8 × 105 cells/㎖의 밀도로 384 웰-플레이트(Grenier)에 분주한 다음 화합물을 24시간 동안 처리했다. 신호를 측정하기 위해 10 ㎕의 상층액을 QUANTI-Blue assay(Invivogen) 제조업체의 프로토콜에 따라 분석했다. 상대 발광 단위(RLU)는 microplate 판독기(TECAN)를 사용하여 측정되었고, 각 값은 DMSO 처리된 세포의 값으로 정규화되었다.
그 결과, 도 1(a) 내지 도 1(c)에 나타난 바와 같이, 디오신은 농도 의존적으로 NF-κB 활성 및 NO 생성을 억제하는 것으로 나타났으나, 25 μM 이상에서 높은 수준의 세포 독성을 보이는 것을 확인하였다. 즉, 디오신은 신경염증 억제 효능을 가지고 있으나, 독성으로 인해 safety window가 좁으므로, 이를 개선하기 위해 디오신의 분해물질인 디오스게닌 유도체를 새로 합성하였다.
실시예 2: 신규한 디오스게닌 유사체 합성
본 발명의 디오스게닌 유도체는 하기 화학식 2로 표시되는 디오스게닌을 이용하여 합성하였다.
[화학식 2]
Figure PCTKR2023017850-appb-img-000017
화합물 1
화학식 1-1의 화합물은 다음과 같은 방법으로 확보하였다. 50 ㎖ 원형플라스크에 아르곤기체하에서 디오스게닌(1.1 g, 2.66 mmol)을 무수 다이클로로메테인(14 ㎖)에 녹인 후 0 ℃에서 TsCl(4-Toluenesulfonyl chloride, 2.3 g, 5.85 mmol, 4.57 eq.)와 무수 피리딘(pyridine; 2.1 ㎖, 25.85 mmol, 9.78 eq.) 및 촉매량의 DMAP(4-Dimethylaminopyridine)을 넣어주었다. 반응 혼합물을 0 ℃에서 1시간 동안 교반시킨 다음, 상온에서 24시간 동안 교반시킨 후, 반응이 완결되면 유기층을 차가운 5% HCl 수용액(20 ㎖ x 2)과 포화 NaHCO3 수용액(20 ㎖ x 2)으로 세척하였다. 무수 MgSO4로 유기층의 수분을 제거하고 여과한 다음, 회전농축기로 용매를 농축시켰으며, 이 중간체 화합물은 추가적인 정제 없이 다음 반응에 이용하였다.
100 ㎖ 원형플라스크에 아르곤기체하에서 앞서 얻은 중간체 화합물(1.021 g, 2.463 mmol)을 무수 DMF(40 ㎖)에 녹인 후 NaOH(Sodium hydroxide, 0.690 g, 17.24 mmol, 7.0 eq.)를 넣고 60 ℃에서 22시간 동안 교반하였다. 반응이 완결되면 용액을 EtOAc(20 ㎖)로 희석시킨 뒤 증류수(20 ㎖ x 4)와 브라인(brine; 20 ㎖ x 4)으로 세척하였다. 무수 MgSO4로 유기층의 수분을 제거하고 여과한 다음, 회전농축기로 용매를 제거하고 플래시 컬럼 크로마토그래피(flash column chromatography; hexanes : EtOAc = 4 : 1)로 분리하여 하기 화학식 1-1로 표시되는 흰색 고체인 화합물 1(0.345 g, 25.3% over two steps)을 수득하였다.
[화학식 1-1]
Figure PCTKR2023017850-appb-img-000018
1H NMR (600 MHz, CDCl3) δ 5.34 (d, J = 5.1 Hz, 1H), 4.40 (q, 1H), 3.56 - 3.44 (m, 2H), 3.37 (t, J = 11.0, 1H), 2.30 (dd, J = 13.0, 4.8 Hz, 1H), 2.23 (t, J = 12.5 Hz, 1H), 1.99 (tt, J = 12.9, 6.4 Hz, 2H), 1.90 - 1.04 (m, 25H), 1.02 (s, 3H), 0.97 (d, J = 7.1 Hz, 3H), 0.78 (d, J = 3.5 Hz, 6H). 13C NMR (150 MHz, CDCl3) δ 140.94, 121.57, 109.44, 80.96, 71.88, 66.99, 62.23, 56.66, 50.19, 42.42, 41.75, 40.41, 39.93, 37.36, 36.79, 32.20, 31.99, 31.77, 31.58, 31.53, 30.44, 28.94, 21.02, 19.56, 17.28, 16.43, 14.67.
화합물 2
화학식 1-2의 화합물은 다음과 같은 방법으로 확보하였다. 50 ㎖ 원형플라스크에 아르곤질소하에서 디오스게닌 (100 mg, 0.241 mmol)을 무수 THF(2.5 ㎖)에 녹인 후 0 ℃에서 NaH(Sodium hydride, 19.29 mg, 0.482 mmol, 2 eq.)와 MeI (Iodomethane, 30 ㎕, 0.482 mmol, 2 eq.)을 넣어준 뒤 60 ℃에서 12시간 동안 교반시켰다. 반응이 완결되면 감압하여 농축시키고, 농축물을 EtOAc(5 ㎖)에 다시 녹인 다음, 유기층을 증류수 (5 ㎖ x 2)와 브라인(brine; 5 ㎖ x 2)으로 세척하였다. 무수 Na2SO4로 수분을 제거하고 여과한 다음, 회전농축기로 용매를 제거하고 플래시 컬럼 크로마토그래피(flash column chromatography; hexanes : EtOAc = 16 : 1)로 분리하여 하기 화학식 1-2로 표시되는 흰색 고체인 화합물 2(97.4 mg, 94.5%)를 수득하였다.
[화학식 1-2]
Figure PCTKR2023017850-appb-img-000019
1H NMR (400 MHz, CDCl3) δ 5.35 (dt, J = 5.4, 2.0 Hz, 1H), 4.40 (ddd, J = 8.7, 7.5, 6.3 Hz, 1H), 3.47 (ddd, J = 10.9, 4.5, 2.0 Hz, 1H), 3.38 (d, J = 10.9 Hz, 1H), 3.35 (s, 3H), 3.05 (tt, J = 11.3, 4.5 Hz, 1H), 2.39 (ddd, J = 13.2, 4.7, 2.3 Hz, 1H), 2.15 (ddd, J = 15.4, 10.7, 2.7 Hz, 1H). 2.06 - 1.05 (m, 22H), 1.01 (s, 3H), 0.97 (d, J = 7.0 Hz, 3H), 0.78 (t, J = 3.2 Hz, 6H). 13C NMR (100 MHz, CDCl3) δ 141.07, 121.44, 109.42, 80.97, 80.43, 66.99, 62.26, 56.69, 55.75, 50.28, 41.75, 40.42, 39.95, 38.81, 37.30, 37.18, 32.24, 32.00, 31.59, 31.54, 30.45, 28.95, 28.16, 21.01, 19.54, 17.28, 16.43, 14.67. HRMS (ESI, positive) calcd. for C28H44O3 [M+H]+ 429.3363, found 429.3366.
화합물 3
화학식 1-3의 화합물은 다음과 같은 방법으로 확보하였다. 100 ㎖ 원형플라스크에 아르곤기체하에서 화학식 1-10 화합물(0.826 g, 1.879 mmol)을 THF / H2O(10 ㎖ / 1 ㎖)에 녹인 후 PPh3(Triphenylphosphine, 0.986 g, 3.76 mmol, 3 eq.)을 넣어준 뒤 60 ℃에서 환류하여 7시간 동안 교반시켰다. 반응이 완결되면 회전농축기로 용매를 제거하고 플래시 컬럼 크로마토그래피(flash column chromatography; DCM : MeOH = 50 : 1)로 분리하여 하기 화학식 1-3으로 표시되는 흰색 고체인 화합물 3(0.6619 g, 85%)을 수득하였다.
[화학식 1-3]
Figure PCTKR2023017850-appb-img-000020
1H NMR (600 MHz, CDCl3) δ 5.35 (s, 1H), 4.39 (q, J = 7.5, 7.1 Hz, 1H), 3.45 (d, J = 10.9 Hz, 1H), 3.36 (td, J = 11.0, 3.2 Hz, 1H), 3.17 (s, 1H), 2.56 (d, J = 14.0 Hz, 1H), 2.05 - 1.03 (m, 34H), 1.00 (d, J = 3.2 Hz, 3H), 0.97 - 0.93 (m, 3H), 0.77 (d, J = 4.1 Hz, 6H). 13C NMR (150 MHz, CDCl3) δ 138.45, 123.61, 109.31, 80.89, 66.89, 62.21, 56.51, 50.20, 47.19, 41.69, 40.31, 39.83, 39.37, 37.61, 33.03, 32.21, 31.92, 31.49, 30.38, 29.79, 28.90, 28.84, 20.65, 18.95, 17.23, 16.35, 14.63. HRMS (ESI, positive) calcd. for C27H43NO2 [M+H]+ 414.3367, found 414.3367.
화합물 4
화학식 1-4의 화합물은 다음과 같은 방법으로 확보하였다. 10 ㎖ 원형플라스크에 아르곤기체하에서 화학식 1-3 화합물(11 mg, 0.027 mmol)을 MeOH(3 ㎖)에 녹인 후 37% 수성 포름알데히드(aqueous formaldehyde; 0.238 ㎖, 3.19 mmol, 120 eq.)와 포름산(formic acid; 7.72 ㎕, 0.205 mmol, 7.7 eq.)를 넣어주고 상온에서 교반시켰다. NaBH3CN(Sodium cyanoborohydride, 10.03 mg, 0.160 mmol, 6 eq.)을 3시간에 걸쳐 세 번에 나눠 첨가하고 상온에서 4시간 동안 교반시킨 다음, 반응이 완결되면 포화 NaHCO3 용액(3 ㎖)을 첨가하여 반응성을 제거한다. EtOAc(5 ㎖), Et2O(5 ㎖)로 추출한 뒤, 유기층을 브라인(brine; 10 ㎖ x 2)으로 세척한 다음, 무수 Na2SO4로 수분을 제거하고 여과하였다. 회전농축기로 용매를 제거하고 플래시 컬럼 크로마토그래피(flash column chromatography; DCM : MeOH = 15 : 1, with 3% triethylamine)로 분리하여 하기 화학식 1-4로 표시되는 흰색 고체인 화합물 4(10.3 mg, 88%)를 수득하였다.
[화학식 1-4]
Figure PCTKR2023017850-appb-img-000021
1H NMR (400 MHz, CDCl3) δ 5.32 (d, J = 4.9 Hz, 1H), 4.36 (td, J = 8.0, 6.3 Hz, 1H), 3.43 (ddd, J = 10.9, 4.4, 2.0 Hz, 1H), 3.33 (t, J = 10.9 Hz, 1H), 2.44 - 2.39 (m, 1H), 2.36 (s, 6H), 2.32 (s, 1H), 2.03 - 1.07 (m, 26H), 1.01 (s, 3H), 0.93 (d, J = 6.9 Hz, 3H), 0.75 (t, J = 3.1 Hz, 6H). 13C NMR (100 MHz, CDCl3) δ 138.93, 122.41, 109.28, 80.91, 66.87, 63.02, 62.11, 56.40, 49.00, 43.23, 41.67, 40.32, 39.76, 37.23, 34.90, 33.37, 31.86, 31.83, 31.46, 31.42, 30.36, 29.77, 28.89, 24.53, 20.61, 19.86, 17.21, 16.34, 14.59. HRMS (ESI, positive) calcd. for C29H47NO2 [M+H]+ 442.3680, found 442.3682.
화합물 5
화학식 1-5의 화합물은 다음과 같은 방법으로 확보하였다. 10 ㎖ 원형플라스크에 아르곤 기체하에서 화학식 1-3 화합물(30 mg, 0.73 mmol)를 CH3CN / DCM (0.5 ㎖ / 0.5 ㎖)에 녹인 후 MeI(Iodomethane, 0.045 ㎖, 0.725 mmol, 10 eq.)과 K2CO3 (Potassium carbonate, 50.1 mg, 0.363 mmol, 5 eq.)를 넣어주었다. 반응 혼합물을 60 ℃에서 환류하여 12시간 동안 교반시킨 다음, 반응이 완결되면 반응 혼합물을 celite로 여과한 뒤 회전농축기로 용매를 제거하였다. 플래시 컬럼 크로마토그래피(flash column chromatography; DCM : MeOH = 9 : 1)로 분리하여 하기 화학식 1-5로 표시되는 노란색 고체인 화합물 5(32.2 mg, 97%)를 수득하였다.
[화학식 1-5]
Figure PCTKR2023017850-appb-img-000022
1H NMR (400 MHz, CD3OD) δ 5.71 (dt, J = 4.5, 2.1 Hz, 1H), 4.51 - 4.41 (m, 1H), 3.79 (tdd, J = 8.3, 5.7, 2.0 Hz, 1H), 3.50 (ddd, J = 10.9, 4.4, 2.0 Hz, 1H), 2.90 - 2.79 (m, 1H), 2.66 (d, J = 16.6 Hz, 1H), 2.21 - 1.20 (m, 25H), 1.11 (s, 3H), 1.03 (d, J = 7.0 Hz, 3H), 0.89 (s, 3H), 0.85 (d, J = 6.4 Hz, 3H). 13C (100 MHz, CD3OD) δ 139.45, 126.29, 110.52, 82.18, 72.93, 67.83, 63.68, 57.82, 52.35, 52.32, 52.27, 47.83, 42.86, 41.58, 40.82, 37.91, 32.74, 32.69, 32.59, 32.42, 31.41, 30.65, 29.87, 22.13, 22.09, 17.51, 16.91, 14.91. HRMS (ESI, positive) calcd. For C30H50NO2 [M]+ 456.3836, found 456.3838.
화합물 6
화학식 1-6의 화합물은 다음과 같은 방법으로 확보하였다. (a) 50 ㎖ 원형플라스크에 아르곤기체하에서 화학식 1-3 화합물(261 mg, 0.610 mmol)를 다이클로로메테인(6 ㎖)에 녹인 후 TEA(Triethylamine, 0.094 ㎖, 0.671 mmol, 1.1 eq.)과 Boc2O(Di-tert-butyl dicarbonate, 0.147 mg, 0.671 mmol, 1.1 eq.)를 넣어주었다. 반응 혼합물을 상온에서 12시간 동안 교반시킨 다음, 반응이 완결되면 감압하여 농축시키고, 농축물을 다이클로로메테인(10 ㎖)에 다시 녹였다. 유기층을 증류수(10 ㎖ x 2)와 브라인(brine; 10 ㎖ x 2)로 세척한 다음, 무수 Na2SO4로 수분을 제거하고 여과하였다. 회전 농축기로 용매를 제거하고 플래시 컬럼 크로마토그래피(flash column chromatography; hexanes : EtOAc = 16 : 1)로 분리하여 흰색 고체 성상의 반응 중간물 (312.9 mg, 99.8%)을 수득하였다.
1H NMR (400 MHz, CDCl3) δ 5.34 (d, J = 5.1 Hz, 1H), 4.60 (d, J = 7.9 Hz, 1H), 4.44 - 4.34 (m, 1H), 3.87 - 3.80 (m, 1H), 3.45 (ddd, J = 11.0, 4.5, 2.0 Hz, 1H), 3.35 (t, J = 10.9 Hz, 1H), 2.54 (d, J = 14.7 Hz, 1H), 2.04 - 1.46 (m, 18H), 1.42 (s, 9H), 1.35 - 1.03 (m, 6H), 1.00 (s, 3H), 0.95 (d, J = 6.9 Hz, 3H), 0.77 (t, J = 3.2 Hz, 6H). 13C NMR (100 MHz, CDCl3) δ 155.18, 139.05, 123.12, 109.37, 80.89, 79.06, 66.94, 62.21, 56.64, 50.36, 46.72, 41.71, 40.34, 39.88, 37.53, 37.43, 34.00, 32.16, 31.92, 31.49, 31.44, 30.40, 28.91, 28.57, 26.49, 20.65, 18.99, 17.25, 16.37, 14.63.
(b) 50 ㎖ 원형플라스크에 아르곤기체하에서 앞서 얻은 반응 중간물(285.4 mg, 0.556 mmol)을 THF(7 ㎖)에 녹인 후 0 ℃에서 LAH(Lithium aluminium hydride, 42.4 mg, 1.111 mmol, 2 eq.)를 넣어준 뒤 76 ℃에서 환류하여 4시간 동안 교반시킨다. 반응이 완결되면 피저 방법(Fieser method)에 따라 잔류 LAH의 반응성을 제거하였으며, EtOAc로 반응액을 희석시킨 후 셀라이트(celite)로 여과하였다. 무수 MgSO4로 수분을 제거하고 여과한 다음, 회전농축기로 용매를 제거한 뒤 플래시 컬럼 크로마토그래피(flash column chromatography; DCM : MeOH = 9 : 1)로 분리하여 하기 화학식 1-6으로 표시되는 흰색 고체인 화합물 6(199.7 mg, 83.9%)을 수득하였다.
[화학식 1-6]
Figure PCTKR2023017850-appb-img-000023
1H NMR (400 MHz, CDCl3) δ 5.34 (dd, J = 4.4, 2.6 Hz, 1H), 4.39 (td, J = 7.9, 6.4 Hz, 1H), 3.46 (ddd, J = 10.9, 4.4, 2.0 Hz, 1H), 3.36 (t, J = 10.9 Hz, 1H), 2.78 (t, J = 3.3 Hz, 1H), 2.47 (dq, J = 14.4, 3.0 Hz, 1H), 2.36 (s, 3H), 2.19 - 1.06 (m, 29H), 1.02 (s, 3H), 0.96 (d, J = 7.0 Hz, 3H), 0.77 (t, J = 3.2 Hz, 6H). 13C NMR (100 MHz, CDCl3) δ 139.30, 122.75, 109.38, 80.95, 66.96, 62.22, 56.63, 54.89, 50.23, 41.74, 40.37, 39.90, 37.55, 36.70, 33.49, 33.22, 32.15, 31.95, 31.53, 30.44, 29.83, 28.95, 25.19, 20.69, 19.26, 17.27, 16.40, 14.65. HRMS (ESI, positive) calcd. for C28H46NO2 [M+H]+ 428.3523, found 428.3525.
화합물 7
화학식 1-7의 화합물은 다음과 같은 방법으로 확보하였다. (a) 50 ㎖ 원형플라스크에 아르곤기체하에서 디오스게닌(0.1 g, 0.241 mmol)과 Ag2CO3(Silver carbonate, 0.532 g, 1.929 mmol, 8 eq.)을 무수 다이클로로메테인(5 ㎖)에 녹인 후 무수 다이클로로메테인(5 ㎖)에 녹인 아세토브로모-α-D-글루코스(acetobromo-α-D-glucose; 0.397 g, 0.965 mmol, 4 eq.) 용액을 넣어주었다. 반응 혼합물을 상온에서 48시간 동안 교반시킨 다음, 반응이 완결되면 녹지 않은 Ag2CO3을 셀라이트(celite)로 여과한 뒤 회전농축기로 용매를 제거하였다. 플래시 컬럼 크로마토그래피(flash column chromatography; hexanes : EtOAc = 3 : 1 to 2 : 1, v / v)로 분리하여 흰색 고체성상의 중간체 화합물(103.7 mg, 57.7%)을 수득하였다.
1H NMR (400 MHz, CDCl3) δ 5.34 (d, J = 5.1 Hz, 1H), 5.18 (t, J = 9.5 Hz, 1H), 5.05 (t, J = 9.7 Hz, 1H), 4.93 (dd, J = 8.8 Hz, 1H), 4.58 (d, J = 8.0 Hz, 1H), 4.39 (q, J = 7.4 Hz, 1H), 4.24 (dd, J = 12.2, 4.8 Hz, 1H), 4.09 (dd, J = 12.2, 2.5 Hz, 1H), 3.66 (ddd, J = 10.1, 4.8, 2.5 Hz, 1H), 3.47 (td, J = 11.5, 4.6 Hz, 2H), 3.35 (t, J = 10.9 Hz, 1H), 2.29 - 2.11 (m, 2H), 2.04 (d, J = 10.3 Hz, 6H), 1.99 (d, J = 7.0 Hz, 6H), 1.97 - 1.00 (m, 26H), 0.99 (s, 3H), 0.95 (d, J = 6.8 Hz, 3H), 0.77 (d, J = 5.1 Hz, 6H). 13C NMR (100 MHz, CDCl3) δ 170.77, 170.44, 169.50, 169.39, 140.48, 121.99, 109.39, 99.74, 80.90, 80.08, 73.02, 71.80, 71.61, 68.66, 66.95, 62.22, 56.60, 50.18, 41.72, 40.38, 39.85, 39.00, 37.26, 36.96, 32.19, 31.95, 31.52, 30.40, 29.80, 29.53, 28.91, 20.94, 20.86, 20.82, 20.74, 20.71, 19.48, 17.24, 16.38, 14.63.
(b) 50 ㎖ 원형플라스크에 아르곤기체하에서 앞서 얻은 중간체 화합물(51 mg, 0.068 mmol)을 THF(2 ㎖)에 녹인 후 NaOMe 용액(Sodium methoxide solution, 1.369 ㎖, 0.5 M, 10 eq.)을 천천히 넣어주었다. 반응 혼합물을 상온에서 12시간 동안 교반시킨 다음, 반응이 완결되면 감압하여 농축시키고, 농축물을 EtOAc (3 ㎖)에 다시 녹였다. 유기층을 증류수 (5 ㎖ x 2)와 브라인(brine; 5 ㎖ x 2)으로 세척한 다음, 무수 Na2SO4로 수분을 제거하고 여과하였다. 회전농축기로 용매를 제거하고 플래시 컬럼 크로마토그래피(flash column chromatography; DCM : MeOH = 9 : 1)로 분리하여 하기 화학식 1-7로 표시되는 흰색 고체인 화합물 7(19.5 mg, 49.4%)을 수득하였다.
[화학식 1-7]
Figure PCTKR2023017850-appb-img-000024
1H NMR (400 MHz, DMSO-d6) δ 5.33 (d, J = 5.0 Hz, 1H), 4.87 (t, J = 8.8 Hz, 3H), 4.42 (t, J = 5.8 Hz, 1H), 4.28 (q, J = 7.5 Hz, 1H), 4.22 (d, J = 7.7 Hz, 1H), 3.69 - 3.60 (m, 1H), 3.51 - 3.36 (m, 4H), 3.20 (t, J = 11.0 Hz, 1H), 3.16 - 2.97 (m, 3H), 2.89 (td, J = 8.4, 4.0 Hz, 1H), 2.42 - 2.33 (m, 1H), 2.12 (t, J = 13.8 Hz, 1H), 2.02 - 1.01 (m, 24H), 0.97 (s, 3H), 0.91 (d, J = 6.8 Hz, 3H), 0.74 (t, J = 3.1 Hz, 6H). 13C NMR (100 MHz, DMSO-d6) δ 140.48, 121.01, 108.39, 100.73, 80.17, 76.82, 76.75, 73.45, 70.10, 65.90, 62.78, 61.79, 61.09, 55.73, 49.53, 41.08, 38.28, 36.79, 36.38, 31.53, 31.45, 30.98, 30.91, 29.79, 29.23, 28.46, 20.37, 19.11, 17.06, 15.98, 14.64. HRMS (ESI, positive) calcd. for C33H52NaO8 [M+Na]+ 599.3554, found 599.3557.
화합물 8
화학식 1-8의 화합물은 다음과 같은 방법으로 확보하였다. 100 ㎖ 원형플라스크에 아르곤기체하에서 디오스게닌(1 g, 2.412 mmol)을 무수다이클로로메테인 (20 ㎖)에 녹인 후 0 ℃에서 CBr4(Carbon tetrabromide, 1.20 g, 3.62 mmol, 1.5 eq.)를 넣어준 뒤 10분 동안 교반시켰다. 같은 조건 하에 PPh3 (Triphenylphosphine, 0.886 g, 3.38 mmol, 1.4 eq.)을 반응 혼합물에 첨가한 뒤 상온에서 4시간 동안 교반시킨 다음, 반응이 완결되면 회전농축기로 용매를 제거하고 플래시 컬럼 크로마토그래피(flash column chromatography; hexanes : EtOAc = 8 : 1)로 분리하여 하기 화학식 1-8로 표시되는 흰색 고체인 화합물 8(1.038 g, 90%)을 수득하였다.
[화학식 1-8]
Figure PCTKR2023017850-appb-img-000025
1H NMR (600 MHz, CDCl3) δ5.36 (dt, J = 4.7, 2.0 Hz, 1H), 4.40 (q, J = 7.5 Hz, 1H), 3.91 (tt, J = 12.3, 4.4 Hz, 1H), 3.47 (ddd, J = 10.9, 4.4, 2.3 Hz, 1H), 3.37 (t, J = 11.0 Hz, 1H), 2.74 (tq, J = 12.8, 2.7 Hz, 1H), 2.59 (ddd, J = 13.6, 4.7, 2.3 Hz, 1H), 2.21 - 1.07 (m, 25H), 1.05 (s, 3H), 0.97 (d, J = 7.0 Hz, 3H), 0.79 (d, J = 6.3 Hz, 6H). 13C NMR (150 MHz, CDCl3) δ141.72, 122.19, 109.44, 80.91, 67.00, 62.21, 56.58, 52.56, 50.22, 44.38, 41.75, 40.43, 40.39, 39.83, 36.67, 34.45, 32.08, 31.96, 31.52, 31.40, 30.44, 28.94, 20.83, 19.41, 17.28, 16.42, 14.67.
화합물 9
화학식 1-9의 화합물은 다음과 같은 방법으로 확보하였다. (a) 50 ㎖ 원형플라스크에 아르곤기체하에서 화학식 1-8(0.3 g, 0.628 mmol)을 무수 DMF(6 ㎖)에 녹인 후 KSAc(Potassium thioacetate, 0.215 g, 1.885 mmol, 3 eq.)와 촉매량의 18-crown-6 을 넣어준 뒤 100 ℃에서 환류하여 24시간 동안 교반시켰다. 반응이 완결되면 반응 혼합물을 식히고 EtOAc(30 ㎖)를 넣어 희석시킨 후 증류수(30 ㎖)와 브라인(brine; 30 ㎖)으로 세척하였다. 무수 Na2SO4로 수분을 제거하고 여과한 다음, 회전 농축기로 용매를 제거하고 플래시 컬럼 크로마토그래피(flash column chromatography; hexanes : EtOAc = 30 : 1)로 분리하여 반응 중간체인 흰색 고체(199.5 mg, 67.2%)를 수득하였다.
1H NMR (600 MHz, CDCl3) δ5.29 (d, J = 5.1 Hz, 1H), 4.39 (q, J = 7.4 Hz, 1H), 3.97 (d, J = 4.3 Hz, 1H), 3.49 - 3.41 (m, 1H), 3.35 (t, J = 10.9 Hz, 1H), 2.74 (dq, J = 14.7, 2.5 Hz, 1H), 2.26 (s, 3H), 2.09 - 1.02 (m, 26H), 1.00 (s, 3H), 0.95 (d, J = 6.9 Hz, 3H), 0.77 (d, J = 5.4 Hz, 6H). 13C NMR (150 MHz, CDCl3) δ195.92, 139.25, 122.37, 109.35, 80.89, 66.92, 62.17, 56.59, 50.17, 43.24, 41.69, 40.31, 39.85, 37.74, 37.40, 35.60, 31.99, 31.90, 31.47, 31.33, 31.07, 30.39, 28.90, 27.62, 20.62, 19.28, 17.25, 16.38, 14.64.
(b) 50 ㎖ 원형플라스크에 아르곤기체하에서 앞서 얻은 중간체(0.35 g, 0.740 mmol)를 MeOH(7 ㎖)에 녹인 후 NaOMe 용액(Sodium methoxide, 1.481 ㎖, 1 M in MeOH, 2 eq.)을 넣어준 뒤 상온에서 12시간 동안 교반시켰다. 반응이 완결되면 0.1 M HCl 용액을 넣어준 뒤 다이클로로메테인(10 ㎖) 으로 추출한 다음, 회전농축기로 용매를 제거하고 플래시 컬럼 크로마토그래피(flash column chromatography; hexanes : EtOAc = 20 : 1)로 분리하여 하기 화학식 1-9로 표시되는 흰색 고체인 화합물 9(0.256 g, 80%)를 수득하였다.
[화학식 1-9]
Figure PCTKR2023017850-appb-img-000026
1H NMR (600 MHz, CDCl3) δ5.37 (dt, J = 5.8, 1.8 Hz, 1H), 4.42 (ddd, J = 8.6, 7.5, 6.3 Hz, 1H), 3.47 (ddd, J = 10.9, 4.4, 2.1 Hz, 1H), 3.44 - 3.33 (m, 2H), 2.81 (ddt, J = 12.4, 5.0, 2.5 Hz, 1H), 2.09 - 1.04 (m, 37H), 1.02 - 0.95 (m, 6H), 0.79 (t, J = 3.2 Hz, 6H). 13C NMR (150 MHz, CDCl3) δ138.17, 123.82, 109.43, 80.98, 67.00, 62.23, 56.65, 50.32, 41.77, 40.79, 40.40, 39.92, 37.97, 37.52, 33.17, 32.17, 31.97, 31.54, 31.43, 30.46, 30.30, 28.96, 20.70, 19.29, 17.29, 16.43, 14.68. HRMS (ESI, positive) calcd. for C27H42NaO2S [M+Na]+ 453.2798, found 453.2802.
화합물 10
화학식 1-10의 화합물은 50 ㎖ 원형플라스크에 아르곤기체하에서 디오스게닌(1.1 g, 2.66 mmol)을 무수 다이클로로메테인(14 ㎖)에 녹인 후 0 ℃에서 TsCl(4-Toluenesulfonyl chloride, 2.3 g, 5.85 mmol, 4.57 eq.)와 무수 피리딘(pyridine; 2.1 ㎖, 25.85 mmol, 9.78 eq.) 및 촉매량의 DMAP(4-Dimethylaminopyridine)을 넣어주었다. 반응 혼합물을 0 ℃에서 1시간 동안 교반시킨 뒤 상온에서 24시간 동안 교반시킨 다음, 반응이 완결되면 유기층을 차가운 5% HCl 수용액(20 ㎖ x 2)과 포화 NaHCO3 수용액(20 ㎖ x 2)으로 세척하였다. 무수 MgSO4로 유기층의 수분을 제거하고 여과한 다음, 회전농축기로 용매를 농축시켰으며, 이 중간체 화합물은 추가적인 정제 없이 다음 반응에 이용되었다.
100 ㎖ 원형플라스크에 아르곤질소하에서 중간체 화합물(1.236 g, 2.173 mmol)을 무수 DMF(40 ㎖)에 녹인 후 NaN3(Sodium azide, 0.946 g, 14.56 mmol, 6.7 eq.)를 넣어준 뒤 60 ℃에서 22시간 동안 교반시켰다. 반응이 완결되면 용액을 EtOAc(20 ㎖)로 희석시킨 뒤 증류수(20 ㎖ x 4)와 브라인(brine; 20 ㎖ x 4)로 세척하였다. 무수 MgSO4로 수분을 제거하고 여과한 다음, 회전농축기로 용매를 제거하고 플래시 컬럼 크로마토그래피(flash column chromatography; petroleum ether : EtOAc = 150 : 1)로 분리하여 하기 화학식 1-10으로 표시되는 흰색 고체인 화합물 10(0.345 g, 36.2%)을 수득하였다.
[화학식 1-10]
Figure PCTKR2023017850-appb-img-000027
1H NMR (600 MHz, CDCl3) δ 5.39 (d, J = 5.0 Hz, 1H), 4.41 (q, J = 7.5 Hz, 1H), 3.87 (p, J = 3.1 Hz, 1H), 3.47 (ddd, J = 11.1, 4.4, 2.1 Hz, 1H), 3.37 (t, J = 11.0 Hz, 1H), 2.51 (dt, J = 14.9, 2.9 Hz, 1H), 2.19 (dt, J = 15.0, 2.6 Hz, 1H), 2.05 - 1.05 (m, 25H), 1.02 (s, 3H), 0.97 (d, J = 7.0 Hz, 3H), 0.78 (t, J = 3.2 Hz, 6H). 13C NMR (150 MHz, CDCl3) δ 138.26, 123.03, 109.39, 80.95, 66.97, 62.21, 58.30, 56.60, 49.97, 41.75, 40.37, 39.87, 37.35, 36.19, 33.73, 32.11, 31.95, 31.53, 31.45, 30.45, 28.96, 26.23, 20.65, 19.16, 17.28, 16.42, 14.66.
실시예 3: 디오스게닌 유도체의 NO 생성 억제 효능 및 세포 독성 정도 확인
본 발명에서는 상기 실시예 2에서 합성한 10종의 디오스게닌 유도체와 디오스게닌의 NO 생성 억제 효능 및 세포 독성 정도를 확인하기 위해, LPS로 자극된 BV-2 미세아교세포에 각 디오스게닌 유도체를 농도별(0, 25, 50, 100, 150, 200, 250 μM)로 처리한 후, NO 생성 및 세포 생존율을 확인하였다
NO의 생성은 BV-2 세포의 상층액에서 아질산염 농도를 측정하여 분석되었다. 세포를 384 웰-플레이트에 3 x 105 cells/㎖의 밀도로 분주하고 밤새 배양하였다. 세포를 24시간 동안 화합물 부재 또는 존재 하에 200 ng/㎖의 지질다당류(LPS; Sigma-Aldrich) 분주 후 원심분리하였다. 상층액을 동일한 부피의 Griess 시약과 혼합하고 실온에서 15분 동안 둔 후 560 nm에서 상등액의 흡광도를 측정하여 아질산염 농도를 확인하였다. 아질산나트륨(NaNO2)을 사용하여 표준 곡선을 그렸고, 세포 생존율은 세포에 20 ㎕의 Cell Tighter Glo 시약(Promega)을 첨가하고 실온에서 10분 동안 배양 후 발광성을 측정하였다. 발광 신호는 microplate 판독기(BioTek)를 사용하여 측정하였다. 각 값은 DMSO 처리된 세포의 값으로 정규화되었다.
그 결과, 도 2a 내지 도 2k에 나타난 바와 같이, 화학식 1-4로 표시되는 디오스게닌 유도체(화합물 4), 화학식 1-9로 표시되는 디오스게닌 유도체(화합물 9), 화학식 1-10로 표시되는 디오스게닌 유도체(화합물 10)이 세포 독성 없이 NO 생성을 억제하는 것을 확인하였으며, 그 중에서도 화학식 1-4로 표시되는 디오스게닌 유도체(화합물 4)이 가장 우수한 효능을 가지는 것을 확인하였다.
실시예 4: 디오스게닌 유도체(화합물 4)의 신경염증 억제 효능 확인 - 생체외( in vitro )
본 발명에서는 상기 실시예 3에서 세포 독성 없이 가장 우수한 신경염증 억제 효능을 가지는 것으로 확인된 디오스게닌 유도체(화합물 4; DG-N(CH3)2)에 대한 신경염증억제 효능을 확인하였다.
4-1 : 전염증성 사이토카인 발현 억제 확인
LPS로 자극된 BV-2 미세아교세포에 디오스게닌 유도체(화합물 4)를 처리하였을 때, iNOS 및 전염증성 사이토카인인 IL-1β, IL-6 및 TNF-α의 발현을 억제하는지 확인하였다.
세포의 mRNA는 NucleoSpin RNA Plus(Macherey-Nagel)의 지침에 따라 준비되었다. 각 샘플의 RNA(1000 ng)를 25 ℃에서 5분, 42 ℃에서 30분, 85 ℃에서 5분 동안 역전사하였다. RT-PCR 분석을 위해 실시간 열순환기(Bio-Rad, CFX Connect)를 사용하여 cDNA 생성물을 IQ SYBR Green Supermix(Bio-Rad) 및 아래 표 1에 명시된 개별 프라이머(Bioneer)와 혼합하였다. GAPDH는 mRNA 수준을 정규화하기 위한 하우스키핑 유전자로 사용되었다.
프라이머 서열
gene sequence (5’ -> 3’) 서열번호
iNOS 정방향 GAGACAGGGAAGTCTGAAGCAC 서열번호 1
역방향 CCAGCAGTAGTTGCTCCTCTTC 서열번호 2
TNFα 정방향 GGTGCCTATGTCTCAGCCTCTT 서열번호 3
역방향 GCCATAGAACTGATGAGAGGGAG 서열번호 4
IL-1b 정방향 TGGACCTTCCAGGATGAGGACA 서열번호 5
역방향 GTTCATCTCGGAGCCTGTAGTG 서열번호 6
IL-6 정방향 TACCACTTCACAAGTCGGAGGC 서열번호 7
역방향 CTGCAAGTGCATCATCGTTGTTC 서열번호 8
GAPDH 정방향 CATCACTGCCACCCAGAAGACTG 서열번호 9
역방향 ATGCCAGTGAGCTTCCCGTTCAG 서열번호 10
그 결과, 도 3에 나타난 바와 같이, LPS로 인해 발현이 증가한 전염증성 사이토카인의 발현이 디오스게닌 유도체(화합물 4)에 의해 억제되는 것을 확인하였다.
4-2 : TNF-α 생성 억제 확인
전염증성 사이토카인 중에서 TNF-α 생성을 억제하느지 확인하기 위해, LPS로 자극된 BV-2 미세아교세포에 디오스게닌 유도체(화합물 4)를 농도별(0, 12.5, 50, 200 μM)로 처리한 다음, TNF-α ELISA 키트를 이용하여 TNF-α 생성정도를 측정하였다.
세포 배양 상층액을 수집하여 사이토카인에 대해 분석하였다. 종양 괴사 인자-α(TNF-α)의 수준은 효소 결합 면역흡착 분석(ELISA) 키트(R&D Systems)를 사용하여 정량화하였다. 96 웰-마이크로플레이트(96 well microplate)를 PBS(Phosphate Buffer Solution)에 희석한 항체로 실온에서 하루동안 코팅한 다음 마이크로플레이트 워셔기를 사용하여 세척 완충액(0.05% tween20 in PBS)으로 세척하였다. 시약 희석제(1% BSA in PBS)로 마이크로플레이트를 코팅하고 실온에서 1시간 동안 인큐베이션한 다음 세척 완충액으로 세척하였다. 샘플 또는 표준을 각 웰에 첨가하고 실온에서 2시간 동안 인큐베이션한 후 세척 완충액으로 세척하였다. 검출 항체를 시약 희석제에 희석한 후 각 웰에 첨가하고 실온에서 2시간 동안 인큐베이션한 후 세척 완충액으로 세척하였다. 스크렙타비딘(Streptavidin)-HRP를 각 웰에 첨가하고 실온에서 20분 동안 인큐베이션한 다음 세척 완충액으로 세척하였다. TMB 용액(Biosesang)을 각 웰에 첨가하고 실온에서 20분 동안 인큐베이션하였다. 이어서, 2 N H2SO4을 각 웰에 첨가하고 450 nm로 설정된 마이크로플레이트 판독기(BioTek)를 사용하여 각 웰의 광학 밀도를 측정하였다.
그 결과, 도 4에 나타난 바와 같이, 디오스게닌 유도체(화합물 4)에 의해 세포 독성 없이 디오스게닌 유도체 농도 의존적으로 TNF-α 생성이 억제되는 것을 확인하였다.
4-3 : 항염증 유전자 발현 증가 확인
LPS로 자극된 BV-2 미세아교세포에 디오스게닌 유도체(화합물 4)를 처리하였을 때, 항염증 유전자인 HO-1(Heme oxygenase-1) 발현이 증가하는지 확인하였다.
세포의 mRNA는 NucleoSpin RNA Plus (Macherey-Nagel)의 지침에 따라 준비되었다. 각 샘플의 RNA(1000 ng)를 25 ℃에서 5분, 42 ℃에서 30분, 85 ℃에서 5분 동안 역전사하였다. RT-PCR 분석을 위해 실시간 열순환기 (Bio-Rad, CFX Connect)를 사용하여 cDNA 생성물을 IQ SYBR Green Supermix (Bio-Rad) 및 아래 표 2에 명시된 개별 프라이머(Bioneer)와 혼합하였다. GAPDH는 mRNA 수준을 정규화하기 위한 하우스키핑 유전자로 사용되었다.
프라이머 서열
gene sequence (5’ -> 3’) 서열번호
HO-1 정방향 CACTCTGGAGATGACACCTGAG 서열번호 11
역방향 GTTGTTCCTCTGTCAGCATCACC 서열번호 12
GAPDH 정방향 CATCACTGCCACCCAGAAGACTG 서열번호 9
역방향 ATGCCAGTGAGCTTCCCGTTCAG 서열번호 10
그 결과, 도 5에 나타난 바와 같이, 디오스게닌 유도체(화합물 4)는 HO-1(Heme oxygenase-1) 발현을 증가시키는 것을 확인하였다.
4-4 : 미세아교세포 활성 억제 확인
디오스게닌 유도체(화합물 4)에 의해 실제 미세아교세포의 활성이 억제되는지 확인하였다.
세포를 공초점 접시에 파종하고 하루동안 유지하였다. 세포는 24시간 동안 화합물의 부재 또는 존재 하에 200 ng/㎖의 LPS(Sigma-Aldrich)를 분주하였다. 이후 PBS로 세척한 후, 100% MeOH 용액 200 ㎕를 첨가하고 세포를 -20 ℃에서 5분 동안 인큐베이션하였다. 그런 다음 용액을 제거하고 샘플을 PBS로 3회 세척하였다. PBS 용액(0.1% Triton-X-100 in PBS)을 첨가하고 실온에서 15분 동안 인큐베이션하였다. 그 후 용액을 제거하고 샘플을 PBS로 3회 세척하였다. 샘플을 실온에서 1시간 동안 PBS 용액 중 2% BSA로 블로킹(blocking)한 다음, 1차 항체 용액을 4 ℃에서 하루동안 처리하였다. 항체 농도는 제조업체의 지침에 따랐다. 1차 항체 용액을 제거하고 샘플을 PBS로 3회 세척하였다. 이후 2차 항체 용액을 실온에서 1시간 동안 인큐베이션하였다. 다음으로, 항체 용액을 제거하고 샘플을 PBS로 3회 세척하였다. 핵 염색을 위해 Hoechst 33342를 PBS에 희석한 후 각 웰에 첨가하고 실온에서 5분 동안 인큐베이션하였다. 그런 다음 용액을 제거하고 PBS로 채워 현미경 (Nikon TS2-LS)으로 이미징을 수행하였다.
그 결과, 도 6에 나타난 바와 같이, BV2 미세아교세포에서 LPS로 인해 유도된 IBA1(ionized calcium-binding adapter molecule 1) 발현이 디오스게닌 유도체(화합물 4)에 의해 대조군과 유사한 수준으로 감소하는 것을 확인하였다.
실시예 5: 디오스게닌 유도체(화합물 4)의 신경염증 억제 효능 확인 - 생체 내( in vivo )
본 발명에서는 동물모델에서 디오스게닌 유도체(화합물 4)의 신경염증 억제 효능을 확인하였다.
모든 동물 실험 절차는 한국과학기술연구원(KIST)의 기관동물관리사용위원회(IACUC)에서 승인한 지침에 따라 수행되었으며, 승인번호는 KIST-2021-03-033이다.
5주령 수컷 ICR 마우스를 대한바이오링크(DBL)에서 얻은 후, 1주일간 적응 시간을 가졌다. 동물은 행동 실험을 진행하기 3일전부터 핸들링 과정을 거쳤으며, 각 실험군마다 10마리 이상씩 실험이 진행되었다. 실험 전날, 실험동물에게 식염수 또는 화합물 4(50 mg/kg)를 복강 내(i.p) 주사하였고, 1시간 후, 실험동물에게 식염수 또는 지질다당류(LPS; 1 mg/kg)를 정맥내(i.v) 주사하였다.
4시간 후, 조직학적 분석을 위해, 마우스를 우레탄(Urethane)으로 마취시키고 20 ㎖의 식염수에 이어 20 ㎖의 4% 파라포름알데히드(PFA)로 관류하였다. 뇌를 획득하고 6시간동안 4% PFA에 후고정한 후, 30% 자당용액에서 4 ℃에서 하루 동안 냉장 보관하였다. 뇌는 저온 유지 미세절단기(Thermo Scientific, Waltham, United States)에서 30μm로 절단되었다.
면역 조직 분석을 위해, 절단면을 먼저 블로킹(Blocking) 용액(0.3% Triton-X, 2% 염소 혈청 및 2% 당나귀 혈청 in 0.1M PBS)에서 1.5시간 동안 배양한 다음 1차 항체로 하루동안 냉장 상태로 면역 염색하였다. 사용된 1차 항체는 다음과 같다: 닭 항-GFAP 항체(1:500, ab5541, Millipore), 염소 항-Iba1 항체(1:300; abcam, ab5076). 세척 후 절단조직을 2차 항체(모든 이차 항체는 1:500; Jackson, 703-545-155; Life Technologies, A21432; Jackson, 706-605-148)와 함께 실온에서 1시간 동안 인큐베이션 한 다음 PBS로 3회 세척하였다. 공초점 현미경(A1 Nikon)을 사용하여 형광 이미지를 얻었고 Imaris 9 소프트웨어(Bitplane, Switzerland)를 사용하여 3μm 단계의 Z 스택 이미지 정보를 처리하였다.
그 결과, 도 7에 나타난 바와 같이, 성상교세포(astrocyte) 및 미세아교세포(microglia) 모두에서 LPS로 인해 유도된 GFAP(Glial fibrillary acidic protein) 또는 IBA1(ionized calcium-binding adapter molecule 1) 발현이 디오스게닌 유도체(화합물 4)에 의해 대조군과 유사한 수준으로 감소하는 것을 확인하였다.
실시예 6: 디오스게닌 유도체(화합물 4)의 신경세포 보호 효과 확인
본 발명에서는 디오스게닌 유도체(화합물 4)에 의한 신경세포 보호 효과를 확인하였다.
BV2 및 HT22 세포를 각각에 대해 12 웰 플레이트에 5 x 105 cells/㎖ 및 6 웰 플레이트에 3 x 105 cells/㎖의 밀도로 분주하고 밤새 인큐베이션하였다. BV2 세포를 4시간 동안 화합물의 부재 또는 존재 하에 200 ng/㎖의 LPS(Sigma)를 첨가하였다. 공동 배양 직전에 HT22 세포를 실온에서 45분 동안 무혈청 배지로 희석한 5μM의 그린셀 트래커 솔루션(Green Cell Tracker Solution; Thermo fischer)과 함께 배양해주었다. 이후 HT22 세포를 수확하여 20시간 동안 4 x 106개 cells/㎖의 밀도로 BV2 세포에 직접 분주하였다. 세포 샘플을 얻기 위해 실온에서 5분 동안 200 g에서 원심분리한 후, PBS 600 ㎕에 세포 침전물을 재현탁하였다. 유세포 분석법으로 세포 분석기(BECKMAN COULTER, cytoFLEX)를 통해 488 nm 파장 레이저로 결과를 얻고 각 정보는 최소 20,000개의 이벤트로 처리되었다.
그 결과, 도 8에 나타난 바와 같이, 디오스게닌 유도체(화합물 4)는 LPS로 자극된 BV2 세포 및 HT22 세포 사멸을 억제하는 것을 확인하였다. 즉, 본 발명의 디오스게닌 유도체는 신경세포에 대한 보호 효과가 있는 것을 확인하였다.
실시예 7: 디오스게닌 유도체(화합물 4)의 항우울증 효과 확인
본 발명에서는 디오스게닌 유도체(화합물 4)에 의한 항우울증 효과를 확인하기 위해, 도 9(a)에 나타난 모식도와 같이 마우스에 디오스게닌 유도체(화합물 4) 및 LPS를 투여하였다.
모든 동물 실험 절차는 한국과학기술연구원(KIST)의 기관동물관리사용위원회 (IACUC)에서 승인한 지침에 따라 수행되었다.
5주령 수컷 ICR 마우스를 대한바이오링크(DBL)에서 얻은 후, 1주일간 적응 시간을 가졌다. 동물은 행동 실험을 진행하기 3일전부터 핸들링 과정을 거쳤으며, 각 실험군마다 10마리 이상씩 실험이 진행되었다. 실험 전날, 실험동물에게 식염수 또는 화합물 4(50 mg/kg)를 복강 내(i.p) 주사하였고, 1시간 후, 실험동물에게 식염수 또는 지질다당류(LPS; 1 mg/kg)를 정맥내(i.v) 주사하였다. 주사가 완료된 실험동물을 각각 폭 10 cm, 높이 27 cm, 깊이 13 cm 크기의 개별 케이지로 옮겼다. 이후 진행된 각 세가지 실험을 하단에 정리하였다. 각 실험에 대한 결과 값은 평균(Mean) + 표준오차(SEM)로 나타내었다.
꼬리 부유 실험(TST)
실험 동물의 꼬리를 매단 상자의 크기는 높이 44 cm, 너비 14 cm, 깊이 14 cm이다. 동물이 서로 관찰하거나 상호 작용하는 것을 방지하기 위해 각 마우스는 세 개의 벽으로 된 직사각형 구획 내에 매단 상태로 진행되었다. 각 실험동물의 꼬리를 매는 데 사용되는 고정 장치는 상자 상단 중앙 부분에 있고, 그 장치는 17 cm 조각의 테이프를 잘라 한쪽 끝에서 2 cm가량 표시된 위치에 꼬리를 부착한 형태로 진행되었다. 동물의 행동 관찰을 위해 모든 절차는 오후 4시 이전에 수행되었다. 비디오는 총 8분 동안 녹화되었으며, 부동성 분석에는 2분에서 8분 구간을 사용하였다. 실험동물의 부동 시간 계산은 Noldus 분석 프로그램에 의해 수행되었다.
강제수영 실험(FST)
실험에 사용된 탱크는 높이 20 cm, 지름 10 cm, 깊이 15 cm까지 물을 채운 채 사용되었다. 탱크 속 물은 실험 동물 개체별로 테스트 후에 교체되었다. 물의 온도는 21 ℃ ~ 23 ℃이고, 동물 행동 관찰을 위해 모든 절차는 오후 3시 이전에 수행되었다. 비디오는 총 6분 동안 녹화되었으며 부동성 분석에는 2분에서 6분 구간을 사용하였다. 실험동물의 부동 시간 계산은 Noldus 분석 프로그램에 의해 수행되었다.
자당용액 섭취 검사(SPT)
검사 시작 하루 전, 실험동물의 케이지 별로 14 ㎖의 물과 1% 자당용액을 채운 15 ㎖ 코니칼 튜브(conical tube)를 각각 배분하였다. 실험동물의 물과 자당용액은 사전에 무게를 측정하였고 다음날 섭취량을 계산하였다. 이후 마우스는 TST 및 FST를 수행하였고, 다시 각 튜브에 14 ㎖의 물과 1% 자당용액을 채워 배분하였다. 24시간 후, 각 마우스의 물 및 자당용액 섭취량을 비교하였다.
자당용액 섭취 검사(Sucrose Preference Test, SPT), 강제수영 실험(Forced Swimming Test, FST) 및 꼬리 매달기(Tail Suspension Test, TST)를 수행한 결과, 도 9(b)에 나타난 바와 같이, LPS 자극에 의해 증가한 마우스의 우울행동이 디오스게닌 유도체(화합물 4) 투여에 의해 개선되는 것을 확인하였다.
본 발명에서 합성한 신규한 디오스게닌 유도체는 세포독성 없이 신경염증을 억제하고, 신경세포를 보호할 뿐만 아니라, 항우울증 효과가 있는 것을 확인하였으므로, 신경염증질환 또는 우울증 장애의 예방 또는 치료용 조성물로 활용될 수 있다.

Claims (12)

  1. 하기 화학식 1로 표시되는, 디오스게닌 유도체:
    [화학식 1]
    Figure PCTKR2023017850-appb-img-000028
    상기, R은 -OH, -OCH3, -NH2, -N(CH3)2, -N(CH3)3, -NHCH3, -O-글루코스(glucose), -Br, -SH 또는 -N3이다.
  2. 제1항에 있어서,
    상기 화학식 1로 표시되는 디오스게닌 유도체는 하기 화학식 1-4로 표시되는 화합물, 하기 화학식 1-9로 표시되는 화합물, 또는 하기 화학식 1-10으로 표시되는 화물인 것을 특징으로 하는, 디오스게닌 유도체:
    [화학식 1-4]
    Figure PCTKR2023017850-appb-img-000029
    [화학식 1-9]
    Figure PCTKR2023017850-appb-img-000030
    [화학식 1-10]
    Figure PCTKR2023017850-appb-img-000031
  3. 하기 화학식 1로 표시되는 디오스게닌 유도체 또는 이의 약제학적으로 허용되는 염을 유효성분으로 포함하는, 신경염증질환 또는 우울장애의 예방 또는 치료용 약학적조성물:
    [화학식 1]
    Figure PCTKR2023017850-appb-img-000032
    상기, R은 -OH, -OCH3, -NH2, -N(CH3)2, -N(CH3)3, -NHCH3, -O-글루코스(glucose), -Br, -SH 또는 -N3이다.
  4. 제3항에 있어서,
    상기 화학식 1로 표시되는 디오스게닌 유도체는 하기 화학식 1-4로 표시되는 화합물, 하기 화학식 1-9로 표시되는 화합물, 또는 하기 화학식 1-10으로 표시되는 화물인 것을 특징으로 하는, 신경염증질환 또는 우울장애의 예방 또는 치료용 약학적조성물:
    [화학식 1-4]
    Figure PCTKR2023017850-appb-img-000033
    [화학식 1-9]
    Figure PCTKR2023017850-appb-img-000034
    [화학식 1-10]
    Figure PCTKR2023017850-appb-img-000035
  5. 제3항에 있어서,
    상기 디오스게닌 유도체는,
    (1) NO 또는 iNOS를 포함하는 염증반응 매개인자(inflammatory mediators) 생성 억제;
    (2) IL-1β, IL-6 및 TNF-α를 포함하는 전염증성 사이토카인(cytokines) 생성 억제;
    (3) HO-1(Heme oxygenase-1)를 포함하는 항염증 유전자 발현 촉진; 또는
    (4) GFAP(Glial fibrillary acidic protein) 또는 IBA1(ionized calcium-binding adapter molecule 1)를 생성 억제를 통해 성상교세포(astrocyte) 또는 미세아교세포(microglia) 활성을 억제하는 것을 특징으로 하는, 신경염증질환 또는 우울장애의 예방 또는 치료용 약학적조성물.
  6. 제3항에 있어서,
    상기 디오스게닌 유도체는 신경세포를 보호하는 것을 특징으로 하는, 신경염증질환 또는 우울장애의 예방 또는 치료용 약학적조성물.
  7. 제3항에 있어서,
    상기 신경염증질환은 다발성 경화증, 신경모세포종, 허혈성 뇌졸중, 알츠하이머 질환, 파킨슨 질환, 루게릭 질환, 헌팅턴 질환, 크로이츠펠트야콥병, 외상 후 스트레스 장애, 우울증, 정신분열증 또는 근위축성측색경화증으로 구성된 군으로부터 선택되는 어느 하나인 것을 특징으로 하는, 신경염증질환 또는 우울장애의 예방 또는 치료용 약학적조성물.
  8. 하기 화학식 1로 표시되는 디오스게닌 유도체 또는 이의 약제학적으로 허용되는 염을 유효성분으로 포함하는, 신경염증질환 또는 우울장애의 예방 또는 개선용 건강기능식품 조성물:
    [화학식 1]
    Figure PCTKR2023017850-appb-img-000036
    상기, R은 -OH, -OCH3, -NH2, -N(CH3)2, -N(CH3)3, -NHCH3, -O-글루코스(glucose), -Br, -SH 또는 -N3이다.
  9. 제8항에 있어서,
    상기 화학식 1로 표시되는 디오스게닌 유도체는 하기 화학식 1-4로 표시되는 화합물, 하기 화학식 1-9로 표시되는 화합물, 또는 하기 화학식 1-10으로 표시되는 화물인 것을 특징으로 하는, 신경염증질환 또는 우울장애의 예방 또는 개선용 건강기능식품 조성물:
    [화학식 1-4]
    Figure PCTKR2023017850-appb-img-000037
    [화학식 1-9]
    Figure PCTKR2023017850-appb-img-000038
    [화학식 1-10]
    Figure PCTKR2023017850-appb-img-000039
  10. 제8항에 있어서,
    상기 디오스게닌 유도체는,
    (1) NO 또는 iNOS를 포함하는 염증반응 매개인자(inflammatory mediators) 생성 억제;
    (2) IL-1β, IL-6 및 TNF-α를 포함하는 전염증성 사이토카인(cytokines) 생성 억제;
    (3) HO-1(Heme oxygenase-1)를 포함하는 항염증 유전자 발현 촉진; 또는
    (4) GFAP(Glial fibrillary acidic protein) 또는 IBA1(ionized calcium-binding adapter molecule 1)를 생성 억제를 통해 성상교세포(astrocyte) 또는 미세아교세포(microglia) 활성을 억제하는 것을 특징으로 하는, 신경염증질환 또는 우울장애의 예방 또는 개선용 건강기능식품 조성물.
  11. 제8항에 있어서,
    상기 디오스게닌 유도체는 신경세포를 보호하는 것을 특징으로 하는, 신경염증질환 또는 우울장애의 예방 또는 개선용 건강기능식품 조성물.
  12. 제8항에 있어서,
    상기 신경염증질환은 다발성 경화증, 신경모세포종, 허혈성 뇌졸중, 알츠하이머 질환, 파킨슨 질환, 루게릭 질환, 헌팅턴 질환, 크로이츠펠트야콥병, 외상 후 스트레스 장애, 우울증, 정신분열증 또는 근위축성측색경화증으로 구성된 군으로부터 선택되는 어느 하나인 것을 특징으로 하는, 신경염증질환 또는 우울장애의 예방 또는 개선용 건강기능식품 조성물.
PCT/KR2023/017850 2022-12-23 2023-11-08 디오스게닌 유도체를 포함하는 신경염증질환의 예방 또는 치료용 조성물 Ceased WO2024136117A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0183307 2022-12-23
KR1020220183307A KR102807568B1 (ko) 2022-12-23 2022-12-23 디오스게닌 유도체를 포함하는 신경염증질환의 예방 또는 치료용 조성물

Publications (1)

Publication Number Publication Date
WO2024136117A1 true WO2024136117A1 (ko) 2024-06-27

Family

ID=91589337

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/017850 Ceased WO2024136117A1 (ko) 2022-12-23 2023-11-08 디오스게닌 유도체를 포함하는 신경염증질환의 예방 또는 치료용 조성물

Country Status (2)

Country Link
KR (1) KR102807568B1 (ko)
WO (1) WO2024136117A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108383892A (zh) * 2018-03-12 2018-08-10 西南民族大学 一种薯蓣皂苷元季铵盐类衍生物及其制备方法及应用
US20220362341A1 (en) * 2021-05-17 2022-11-17 Therapeutic Solutions International, Inc. Treatment of major depressive disorder by low dose interleukin-2

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103880915A (zh) * 2014-04-14 2014-06-25 四川大学华西医院 一种环戊烷并多氢菲骨架化合物及其制备方法
CN115286676B (zh) * 2022-08-31 2023-07-07 沈阳化工研究院有限公司 薯蓣苷元制备胆固醇甲醚的合成方法

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108383892A (zh) * 2018-03-12 2018-08-10 西南民族大学 一种薯蓣皂苷元季铵盐类衍生物及其制备方法及应用
US20220362341A1 (en) * 2021-05-17 2022-11-17 Therapeutic Solutions International, Inc. Treatment of major depressive disorder by low dose interleukin-2

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
SHAL BUSHRA, DING WEI, ALI HUSSAIN, KIM YEONG S., KHAN SALMAN: "Anti-neuroinflammatory Potential of Natural Products in Attenuation of Alzheimer's Disease", FRONTIERS IN PHARMACOLOGY, FRONTIERS RESEARCH FOUNDATION, CH, vol. 9, CH , XP093187602, ISSN: 1663-9812, DOI: 10.3389/fphar.2018.00548 *
WANG SHAOXIA; WANG FUJIANG; YANG HONGYUN; LI RUILIN; GUO HONG; HU LIMIN: "Diosgenin glucoside provides neuroprotection by regulating microglial M1 polarization", INTERNATIONAL IMMUNOPHARMACOLOGY, ELSEVIER, AMSTERDAM, NL, vol. 50, 14 June 2017 (2017-06-14), NL , pages 22 - 29, XP085149755, ISSN: 1567-5769, DOI: 10.1016/j.intimp.2017.06.008 *
XIA XI; CHEN YU; WANG LIN; YANG ZHI-GANG; MA XIAO-DONG; ZHAO ZHI-GANG; YANG HONG-JUN: "Synthesis of diosgenyl quaternary ammonium derivatives and their antitumor activity", STEROIDS, ELSEVIER SCIENCE PUBLISHERS, NEW YORK, NY., US, vol. 166, 4 December 2020 (2020-12-04), US , XP086447768, ISSN: 0039-128X, DOI: 10.1016/j.steroids.2020.108774 *

Also Published As

Publication number Publication date
KR102807568B1 (ko) 2025-05-19
KR20240102080A (ko) 2024-07-03

Similar Documents

Publication Publication Date Title
WO2023043197A1 (ko) 신규한 카나비디올 유도체, 이의 제조방법 및 이를 포함하는 인지기능 개선용 조성물
WO2015023142A1 (ko) 플라본-6-c-글루코스 유도체를 유효성분으로 함유하는 신경정신질환의 치료 또는 예방용 약학적 조성물
WO2015037778A1 (ko) 리그난 화합물을 유효 성분으로 포함하는 암의 예방 또는 치료용 조성물
WO2012067316A1 (ko) 테로카판계 화합물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 대사성 질환 또는 이들의 합병증의 예방 또는 치료용, 또는 항산화용 조성물
WO2021225363A1 (ko) 해양 유래 진균 페니실리움 글라브룸 sf-7123의 대사체를 포함하는 항염증 또는 항당뇨용 조성물
WO2012033353A9 (ko) 세스터터핀 화합물 및 이들 물질의 용도
WO2024186175A1 (ko) 신규 플라본 유도체 및 그것의 폐섬유화증 개선 용도
WO2010090498A2 (ko) 이고들빼기 추출물, 이의 분획물 또는 이로부터 분리한 화합물을 유효성분으로 함유하는 간 기능 개선용 약학적 조성물 및 간 기능 개선용 건강기능 식품조성물
WO2010027221A2 (ko) 비목나무 유래 추출물, 분획물 또는 화합물을 함유하는 피부 미백용 조성물
WO2013012117A1 (en) Pharmaceutical compositions for preventing or treating inflammatory diseases, comprising phytosterol compound
WO2021034111A1 (ko) 신규 세스퀴테르펜 유도체 및 이의 용도
WO2019208980A1 (ko) 글리세롤 유도체, 이의 제조방법 및 이를 유효성분으로 함유하는 면역조절제
WO2015069086A1 (ko) 인삼 분획물 또는 이로부터 분리된 진세노사이드를 함유하는 시르투인 활성화로 치료되는 질환의 예방 또는 치료용 조성물
WO2011122805A2 (en) A composition comprising ajoene for preventing or treating a disease caused by overexpression of lxr-alpha
WO2022250322A1 (ko) 시금치로부터 분리된 신규 화합물 및 이를 포함하는 염증성 질환 예방 또는 치료용 조성물
WO2017052227A1 (ko) 말굽버섯 추출물, 이의 분획물 또는 이로부터 분리한 화합물을 유효성분으로 포함하는, 뇌신경질환의 예방 또는 치료용 조성물
WO2021256858A1 (ko) 비알코올성 지방간 질환의 개선, 예방 또는 치료용 조성물 및 그 제조방법
WO2016032127A2 (ko) Tlr4에 lps와의 경쟁적 결합을 통한 항산화 및 항염증 활성을 갖는 신규 화합물 및 이의 의학적 용도
WO2014014177A1 (ko) 황칠나무 추출물 또는 상기 추출물 유래의 화합물을 유효성분으로 포함하는 전립선 비대증의 예방 및 치료용 조성물
KR102807568B1 (ko) 디오스게닌 유도체를 포함하는 신경염증질환의 예방 또는 치료용 조성물
WO2024005506A1 (ko) Nadph 옥시다제 2 억제 활성을 갖는 신규 화합물 및 이의 용도
WO2024080768A1 (ko) 이소퀴놀린 유도체를 유효성분으로 포함하는 말초신경병증의 예방 또는 치료용 조성물
WO2024181780A1 (ko) 다이페닐 에터 유도체를 유효성분으로 포함하는, 말초신경병증의 예방 또는 치료용 조성물
WO2024117763A1 (ko) 산사나무 뿌리 추출물을 유효성분으로 포함하는 지방간 또는 비만의 예방 또는 치료용 약학적 조성물
WO2016108522A1 (ko) 허니부쉬 추출물의 분획물 및 이로부터 유래한 화합물을 함유하는 피부 개선용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23907403

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 23907403

Country of ref document: EP

Kind code of ref document: A1