WO2024133132A1 - Anticorps du récepteur 1 anti-tgfbêta et leurs utilisations - Google Patents

Anticorps du récepteur 1 anti-tgfbêta et leurs utilisations Download PDF

Info

Publication number
WO2024133132A1
WO2024133132A1 PCT/EP2023/086443 EP2023086443W WO2024133132A1 WO 2024133132 A1 WO2024133132 A1 WO 2024133132A1 EP 2023086443 W EP2023086443 W EP 2023086443W WO 2024133132 A1 WO2024133132 A1 WO 2024133132A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
antigen
sequence
seq
amino acid
Prior art date
Application number
PCT/EP2023/086443
Other languages
English (en)
Other versions
WO2024133132A9 (fr
Inventor
Marene Inga-Britt LANDSTRÖM
Alexej Schmidt
Original Assignee
Metacurum Biotech Ab
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Metacurum Biotech Ab filed Critical Metacurum Biotech Ab
Publication of WO2024133132A1 publication Critical patent/WO2024133132A1/fr
Publication of WO2024133132A9 publication Critical patent/WO2024133132A9/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52—Constant or Fc region; Isotype
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/94—Stability, e.g. half-life, pH, temperature or enzyme-resistance
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • TGF ⁇ signaling This activates an intracellular cascade of events that activate genes required for normal cell homeostasis [1].
  • dysregulated TGF ⁇ signaling has been implicated in many pathological processes such as tumor progression and fibrosis.
  • the inventors have previously found that in several common forms of cancer, this pathway is instead regulated by polyubiquitination of T ⁇ RI by the E3 ubiquitin ligase TRAF6 [4].
  • the activation of TRAF6 promotes the proteolytic cleavage of transmembrane TGF ⁇ type I receptor (T ⁇ RI), liberating its intracellular domain (T ⁇ RI-ICD).
  • T ⁇ RI-ICD transmembrane TGF ⁇ type I receptor
  • Nuclear T ⁇ RI-ICD promotes invasion by cancer cells and is recognized as acting distinctly and differently from the canonical TGF ⁇ -Smad signaling pathway occurring in normal cells.
  • TACE TNF ⁇ -converting enzyme
  • ADAM17 ADAM Metallopeptidase Domain 17
  • TGF ⁇ has during recent years become recognized as a potent regulator of cellular plasticity, which is a central event during embryogenesis and tumor progression, and therefore an interesting new target for drug development.
  • Inhibitors targeting TGF ⁇ have been considered by pharmaceutical companies for cancer therapy, and some of them are in clinical trial now. For example, antibodies that prevent a TGF- ⁇ ligand from binding to the receptors are currently being tested.
  • GC1008 (fresolimumab) is one such antibody which neutralizes all three isoforms of TGF ⁇ .
  • this lack of specificity means it is necessary to develop isoform- specific antagonists since TGF ⁇ isoforms express differently in distinct cancers.
  • long-term blockade of TGF ⁇ and the relative signaling pathways may develop adverse effects.
  • several T ⁇ RI inhibitors led to an increased incidence of haemorrhagic, degenerative, and inflammatory lesions in heart valves (Herbertz et al., Drug Des Devel Ther. 2015; 9: 4479–4499).
  • TGF ⁇ signaling can cause chronic inflammation of the skin and gut, which in turn can lead to precancerous conditions.
  • TGF ⁇ inhibits normal keratinocyte proliferation and enhances differentiation.
  • TGF ⁇ inhibitors including T ⁇ RI kinase inhibitors and fresolimumab, a TGF ⁇ - neutralizing antibody.
  • the present invention seeks to provide new agents for use in inhibiting dysregulated TGF ⁇ -signalling.
  • the cleavage of T ⁇ RI occurs only in malignant prostate cancer cells (PC-3U), but not in normal primary human prostate epithelial cells [4].
  • TGF ⁇ R1 comprises four portions, an N-terminal leader sequence that is cleaved upon secretion (1-33), a mature extracellular domain; amino acids (34-126), a transmembrane portion (amino acids 127-147) and an intracellular C-terminal portion (amino acids 148-503).
  • the invention provides an antibody or antigen-binding fragment thereof that specifically binds to transforming growth factor beta receptor I (TGF ⁇ R1), wherein the antibody or fragment binds to a region comprising amino acid residues 126 to 133 of TGF ⁇ R1.
  • TGF ⁇ R1 transforming growth factor beta receptor I
  • antibody herein is used in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, synthetic antibodies, polyclonal antibodies, monospecific and multispecific antibodies (e.g., bispecific antibodies), human antibodies, humanized antibodies, chimeric antibodies, and antibody fragments so long as they exhibit the desired antigen-binding activity.
  • antibody also includes antigen-binding fragments of the above antibody molecules.
  • antigen-binding portion of an antibody include any naturally occurring, enzymatically obtainable, synthetic, or genetically engineered polypeptide or glycoprotein that specifically binds an antigen to form a complex.
  • Antigen-binding fragments of an antibody may be derived, e.g., from full antibody molecules using any suitable standard techniques such as proteolytic digestion or recombinant genetic engineering techniques involving the manipulation and expression of DNA encoding antibody variable and optionally constant domains.
  • DNA is known and/or is readily available from, e.g., commercial sources, DNA libraries (including, e.g., phage-antibody libraries), or can be synthesized.
  • the DNA may be sequenced and manipulated chemically or by using molecular biology techniques, for example, to arrange one or more variable and/or constant domains into a suitable configuration, or to introduce codons, create cysteine residues, modify, add or delete amino acids, etc.
  • Non-limiting examples of antigen-binding fragments include: Fab fragments; Fab′ (an antibody fragment containing a single anti-binding domain comprising a Fab and an additional portion of the heavy chain through the hinge region); F(ab′)2 (two Fab′ molecules joined by interchain disulfide bonds in the hinge regions of the heavy chains; the Fab′ molecules may be directed toward the same or different epitopes); a bispecific Fab (a Fab molecule having two antigen binding domains, each of which may be directed to a different epitope); a single chain Fab chain comprising a variable region, also known as a sFv; a disulfide-linked Fv, or dsFv; a camelized VH (the variable, antigen-binding determinative region of a single heavy chain of an antibody in which some amino acids at the VH interface are those found in the heavy chain of naturally occurring camel antibodies); minimal recognition units consisting of the amino acid residues that mimic the hypervariable region of an antibody (
  • Typical immunoglobulin molecules comprise four polypeptide chains, two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds, as well as multimers thereof (e.g., IgM).
  • Each heavy chain comprises a heavy chain variable region (abbreviated herein as HCVR or VH) and a heavy chain constant region.
  • the heavy chain constant region comprises four domains, CH1, Hinge, CH2 and CH3.
  • Each light chain comprises a light chain variable region (abbreviated herein as LCVR or VL) and a light chain constant region.
  • the light chain constant region comprises one domain (CL1).
  • VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FR).
  • CDRs complementarity determining regions
  • FR framework regions
  • Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy- terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
  • the present invention also provides antibodies comprising variants of antibodies disclosed in the examples, wherein said antibodies specifically bind to TGF ⁇ R1.
  • variants we include antibodies or fragments that comprise one or more additions, deletions, or substitutions of amino acids when compared to a parent CDR, framework, VH and/or VL sequence, but exhibit biological activity that is essentially equivalent to that of the described antibody or fragment.
  • Standard techniques known to those of skill in the art can be used to introduce mutations in the nucleotide sequence encoding an antibody or fragment of the invention, including, for example, site-directed mutagenesis and PCR-mediated mutagenesis which results in amino acid substitutions.
  • the variants include less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid substitutions, less than 10 amino acid substitutions, less than 5 amino acid substitutions, less than 4 amino acid substitutions, less than 3 amino acid substitutions, or less than 2 amino acid substitutions relative to the original molecule.
  • the variants have conservative amino acid substitutions.
  • the variants may have conservative amino acid substitutions that are made at one or more predicted non-essential amino acid residues.
  • mutations can be introduced randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for biological activity to identify mutants that retain activity. Following mutagenesis, the encoded protein can be expressed and the activity of the protein can be determined.
  • Variants of the antibodies or fragments of the invention may be constructed by, for example, making one or more substitutions of residues or sequences or deleting terminal or internal residues or sequences not needed for biological activity.
  • cysteine residues not essential for biological activity can be deleted or replaced with other amino acids to prevent formation of unnecessary or incorrect intramolecular disulphide bridges upon renaturation.
  • Variants and derivatives of antibodies include antibody fragments that retain the ability to specifically bind to the target.
  • the antibodies provided herein can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule.
  • the antibodies of the invention may be from any animal origin including birds and mammals (e.g., human, murine, donkey, sheep, rabbit, goat, guinea pig, camel, horse, or chicken). In certain embodiments, the antibodies of the invention are human or humanized monoclonal antibodies.
  • human antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from mice that express antibodies from human genes.
  • the antibodies and fragments of the invention include antibodies and fragments that are chemically modified, i.e., by the covalent attachment of any type of molecule to the antibody.
  • the antibody derivatives include antibodies that have been chemically modified, e.g., by one or more of glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc.
  • transforming growth factor beta receptor I we include the meaning of receptor I of transforming growth factor beta (TGF ⁇ ).
  • TGF ⁇ receptor 1 The terms “transforming growth factor beta receptor I”, “TGF ⁇ receptor 1” may be abbreviated as “TGFbRI”, “TGF ⁇ R1”, “T ⁇ RI” and “T ⁇ R1”.
  • TGFbRI is also known as activin A receptor type II-like kinase (ALK5).
  • TGF- ⁇ receptor I T ⁇ RI
  • II T ⁇ RII
  • III T ⁇ RIII
  • T ⁇ RI and T ⁇ RII mediate signal transduction.
  • Both receptors are transmembrane serine/threonine kinases, which associate in a homo- or heteromeric complex and act as tetramers. They are organized sequentially into an N- terminal extracellular ligand-binding domain, a transmembrane region, and a C- terminal serine/threonine kinase domain.
  • the type II receptors range from 85 to 110 kDa, while the type I receptors are smaller and their size ranges around 55 to 56 kDa.
  • a TGF ⁇ R1 described herein may be a human TGF ⁇ R1, for example one comprising the amino acid sequence of human TGF ⁇ R1 disclosed herein (SEQ ID NO: 1), or a naturally occurring variant thereof, and/or TGF ⁇ R1 orthologous found in other species, such as in horse, dog, pig, cow, sheep, rat, mouse, guinea pig or a primate.
  • TGF ⁇ R1 comprises four portions, an N-terminal leader sequence that is cleaved upon secretion (1-33), a mature extracellular domain: amino acids (34-126), a transmembrane portion (amino acids 127-147) and an intracellular C-terminal portion (amino acids 148-503).
  • TGF ⁇ R1 By “specifically binds to TGF ⁇ R1” we include the meaning of the selective recognition of the antibody or fragment for TGF ⁇ R1, which may be used to determine the presence of TGF ⁇ R1 in a heterogeneous population of molecules, such as biological molecules.
  • an antibody that specifically binds a target is an antibody that binds that target with greater affinity, avidity, more readily, and/or with greater duration than it binds other, unrelated targets or molecules.
  • the antibodies or fragments will not substantially cross-react with another unrelated polypeptide.
  • the antibody or fragment has a binding affinity for a non-homologous protein which is less than 10%, more preferably less than 5%, and even more preferably less than 1%, of the binding affinity for TGF ⁇ R1.
  • the specificity of an antibody can be determined based on affinity measurements.
  • Affinity (KD) expressed by the equilibrium constant for association and dissociation between antigen and antigen binding protein, is a measure of the strength of binding between the epitope and the antigen binding site on the antigen binding protein: a smaller KD value indicates that the binding strength between antigen binding molecules is stronger (alternatively, affinity can also be expressed as an affinity constant (KA), which is 1 / KD).
  • affinity can be determined by any method known in the art and described herein. Any KD value greater than 1x10 -6 M is generally considered to indicate non-specific binding.
  • the antibody or fragment binds TGF ⁇ R1 with at least 5, or at least 10 or at least 50 times higher affinity than for another, irrelevant receptor, such as epidermal growth factor receptor (EGFR). More preferably, the antibody binds TGF ⁇ R1 with at least 100, or at least 500, or at least 1,000, or at least 5,000, or at least 10,000 times higher affinity than for the other, irrelevant receptor, such as (EGFR).
  • EGFR epidermal growth factor receptor
  • higher affinity refers to a binding affinity to TGF ⁇ R1, expressed as KD, in the low nanomolar range, i.e. of at least 1x10 -7 M; such as 1x10 -8 M, 1x10 -9 M; or 1x10 -10 M, as measured by techniques known in the art and described herein, such as Bio-layer interferometry (BLI), spectral shift technology (Nanotemper), surface plasmon resonance (SPR) or ELISA.
  • BBI Bio-layer interferometry
  • Nanotemper spectral shift technology
  • SPR surface plasmon resonance
  • surface plasmon resonance we include the meaning of an optical phenomenon that allows for the analysis of real-time interactions by detection of alterations in protein concentrations within a biosensor matrix, for example using the BIAcoreTM system (Biacore Life Sciences division of GE Healthcare, Piscataway, NJ) or kinetic exclusion assays.
  • Bio-layer interferometry we include the meaning of an optical technique that measures macromolecular interactions by analyzing interference patterns of white light reflected from the surface of a biosensor tip. BLI can be carried out, for example, using a BLItz instrument (ForteBio)).
  • the antibody or fragment specifically binds to human TGF ⁇ R1, including naturally occurring variants thereof, and/or TGF ⁇ R1 orthologues found in other species, such as in horse, dog, pig, cow, sheep, rat, mouse, guinea pig or a primate.
  • binds to a region comprising we include that the antibody or antigen binding fragment binds a region of the antigen that contains the defined amino acids.
  • the antibody or antigen binding fragment thereof may or may not bind all of the amino acid residues of that part of the sequence.
  • the antibody or antigen binding fragment may also bind other amino acids in the antigen.
  • the antibody or antigen binding fragment thereof may bind amino acids upstream of the defined sequence. As shown in Fig.
  • the antibody or fragment binds to a region comprising amino acid residues 126 to 133 of TGF ⁇ R1, such as a region which corresponds to amino acid residues 126 to 133 of human TGF ⁇ R1 (SEQ ID NO: 1). In an embodiment, the antibody or fragment binds to a region comprising amino acid residues 126 to 133 of TGF ⁇ R1 of human TGF ⁇ R1 (SEQ ID NO: 1). Amino acid residues 126 to 133 of TGF ⁇ R1 of human TGF ⁇ R1 are LAAVIAGP (SEQ ID NO: 230). As shown in Fig.
  • the antibody or fragment binds to a region consisting of amino acid residues 126 to 133 of TGF ⁇ R1 of human TGF ⁇ R1 (SEQ ID NO: 1). In some preferred embodiments, the antibody or fragment binds to a region comprising amino acid residues 118 to 133 of TGF ⁇ R1 of human TGF ⁇ R1 (SEQ ID NO: 1).
  • the antibody or fragment binds to a region comprising amino acid residues 118 to 133 of TGF ⁇ R1, such as a region which corresponds to amino acid residues 118 to 133 of human TGF ⁇ R1 (SEQ ID NO: 1).
  • Amino acid residues 118 to 133 of TGF ⁇ R1 of human TGF ⁇ R1 are SPGLGPVELAAVIAGP (SEQ ID NO: 229).
  • the following residues of human TGF ⁇ R1 (SEQ ID NO: 1) P119, L121, G122, V129, I130, and G132 are involved in mAb#19 binding.
  • the antibody or fragment binds to a region comprising amino acid residues 71 to 82 of TGF ⁇ R1 of human TGF ⁇ R1 (SEQ ID NO: 1). As shown in Example 17, the antibody or fragment binds to a region comprising amino acid residues 71 to 82 of TGF ⁇ R1, such as a region which corresponds to amino acid residues 71 to 82 of human TGF ⁇ R1 (SEQ ID NO: 1). Amino acid residues 71 to 82 of TGF ⁇ R1 of human TGF ⁇ R1 are CIAEIDLIPRDR (SEQ ID NO: 228).
  • the antibody or fragment binds to a region comprising amino acid residues 71 to 82 and 126 to 133 of TGF ⁇ R1 of human TGF ⁇ R1 (SEQ ID NO: 1). In some embodiments, the antibody or fragment binds to a region comprising amino acid residues 71 to 82 and 118 to 133 of TGF ⁇ R1 of human TGF ⁇ R1 (SEQ ID NO: 1).
  • the antibody or fragment binds to one or more of L77, I78, P119, L121, G122, V129, I130 and G132 of TGF ⁇ R1 (SEQ ID NO: 1). In an embodiment, the antibody or fragment binds to one or more of L126, V129, I130, G132 and P133 of TGF ⁇ R1 (SEQ ID NO: 1). In an embodiment, the epitope to which the antibody or fragment binds to comprises one or more of L77, I78, P119, L121, G122, V129, I130 and G132 of TGF ⁇ R1 (SEQ ID NO: 1).
  • the epitope to which the antibody or fragment binds to comprises one or more of L126, V129, I130, G132 and P133 of TGF ⁇ R1 (SEQ ID NO: 1). In an embodiment, the antibody or fragment binds to one or more of L77, I78, P119, L121, G122, L126, V129, I130, G132, and P133 of TGF ⁇ R1 (SEQ ID NO: 1). In an embodiment, the epitope to which the antibody or fragment binds to comprises one or more of L77, I78, P119, L121, G122, L126, V129, I130, G132, and P133 of TGF ⁇ R1 (SEQ ID NO: 1).
  • the antibody or antigen-binding fragment thereof reduces and/or inhibits proteolytic cleavage of TGF ⁇ R1.
  • reduced and/or inhibits proteolytic cleavage of TGF ⁇ R1 we include the meaning that the antibody or fragment reduces the level of proteolytic cleavage of TGF ⁇ R1, as compared to the level of proteolytic cleavage of TGF ⁇ R1 in the absence of the antibody or fragment.
  • the antibody or fragment is one that reduces the level of proteolytic cleavage of TGF ⁇ R1 by at least 10%, 20%, 30%, 40% or 50% as compared to the level of proteolytic cleavage of TGF ⁇ R1 in the absence of the antibody or fragment, or reduces the level of proteolytic cleavage of TGF ⁇ R1 by at least 70%, 80%, 90%, 95% or 99% as compared to the level of proteolytic cleavage of TGF ⁇ R1 in the absence of the antibody or fragment.
  • the antibody or fragment is one that reduces the level of proteolytic cleavage of TGF ⁇ R1 to an undetectable level, or eliminates proteolytic cleavage of TGF ⁇ R1 as compared to the level of proteolytic cleavage of TGF ⁇ R1 in the absence of the antibody or fragment.
  • Suitable methods for detecting and/or measuring (quantifying) proteolytic cleavage of TGF ⁇ R1 are well known to those skilled in the art. Examples of appropriate methods are disclosed herein and include observing reduced formation of cleaved TGF ⁇ R1; observing reduced formation of nuclear TERI-ICD as determined by, for example, immunohistochemistry, or immunoblotting.
  • proteolytic cleavage we include the meaning of the enzymatic hydrolysis of a peptide bond in a peptide or protein substrate by a family of specialized enzymes termed proteases.
  • the proteolytic cleavage of TGF ⁇ R1 may be mediated by one or more proteolytic enzymes selected from the group comprising: TACE, presenilin-1 (PS1), ADAM10, MMP2 and/or MMP9.
  • the proteolytic cleavage of TGF ⁇ R1 is mediated by TACE and/or presenilin-1 (PS1).
  • PS1 either functions as gamma-secretase itself or as a required cofactor within the gamma-secretase protein complex.
  • the antibody or antigen-binding fragment thereof reduces and/or inhibits TACE-mediated proteolytic cleavage of TGF ⁇ R1.
  • the antibody or fragment blocks cleavage of T ⁇ RI by TACE between A127/A128 and/or A128/V129 (as numbered in SEQ ID NO: 1).
  • the inventors surprisingly found that TACE cleaved T ⁇ RI in a region of amino acids found in the transmembrane region of T ⁇ RI (see Fig. 7, the transmembrane domain is indicated in a box).
  • the antibody or antigen-binding fragment thereof reduces and/or inhibits the translocation of the intracellular domain (ICD) of TGF ⁇ R1 to the nucleus of a cell.
  • ICD intracellular domain
  • the antibody or fragment reduces the level of the TGF ⁇ R1- ICD in the nucleus, as compared to the level of TGF ⁇ R1-ICD in the nucleus in the absence of the antibody or fragment.
  • the antibody or fragment is one that reduces the level of TGF ⁇ R1-ICD in the nucleus by at least 10%, 20%, 30%, 40% or 50% as compared to the level of TGF ⁇ R1-ICD in the nucleus in the absence of the antibody or fragment, or reduces the level of TGF ⁇ R1-ICD in the nucleus by at least 70%, 80%, 90%, 95% or 99% as compared to the level of TGF ⁇ R1-ICD in the nucleus in the absence of the antibody or fragment.
  • the antibody or fragment is one that reduces the level of TGF ⁇ R1-ICD in the nucleus to an undetectable level, or eliminates TGF ⁇ R1-ICD from the nucleus.
  • T ⁇ RI-ICD interacts with p300 and promotes tumor invasion indirectly or directly by inducing the transcription of target genes, such as SNAI1, MMP2, and T ⁇ RI. Accordingly, immunofluorescence and/or co-immunoprecipitation can be used to determine whether T ⁇ RI-ICD interacts with p300, and thus whether T ⁇ RI-ICD has translocated to the nucleus. As shown in the accompanying examples, an in situ PLA was performed to determine whether T ⁇ RI-ICD interacts with p300 using an anti-HA antibody and an anti-p300 antibody (R&D. Cat. AF3789).
  • a negative control in situ PLA assay was performed using a human PC3U cell line (A9) in which the TGF ⁇ RI/ALK5 expression had been silenced by CRISPR-Cas9.
  • A9 human PC3U cell line
  • T ⁇ RI-ICD co-localisation of p300 and T ⁇ RI-ICD re-occurred when expression had been reconstituted by transfection with a plasmid encoding for TGF ⁇ RI (C-terminal HA-tagged).
  • the antibody or fragment reduces and/or inhibits the translocation of the intracellular domain (ICD) of TGF ⁇ R1 to the nucleus of a cell with an IC50 of 100 nM or less.
  • the antibody or fragment reduces and/or inhibits the translocation of the intracellular domain (ICD) of TGF ⁇ R1 to the nucleus of a cell with an IC50 of 100 nM or less, such as 90 nM, 80 nM, 70 nM 60 nM or less. In an embodiment, the antibody or fragment reduces and/or inhibits the translocation of the intracellular domain (ICD) of TGF ⁇ R1 to the nucleus of a cell with an IC 50 of 50 nM or less, such as 40 nM, 30 nM, 20 nM 10 nM or less.
  • antibody 19 prevents TGF ⁇ -induced translocation of T ⁇ RI-ICD to the nucleus and exhibits an IC 50 of 39 nM.
  • the lead affinity matured antibody, F11 reduces and/or inhibits the translocation of the intracellular domain (ICD) of TGF ⁇ R1 to the nucleus of a cell with an IC50 of 26 nM.
  • the extent of translocation of the intracellular domain (ICD) of TGF ⁇ R1 to the nucleus of a cell this was determined by measuring the interaction between TERI-ICD and p300 in a Proximity ligation assay (PLA).
  • the antibody or antigen-binding fragment thereof reduces and/or inhibits cell migration.
  • the antibody or antigen-binding fragment thereof designated F11 reduces and/or inhibits cell migration.
  • the mAb F11 inhibited cell migration of human colorectal cancer cells.
  • This wound healing method is based on the observation that, upon creation of a new artificial gap, so called “scratch”, on a confluent cell monolayer, the cells on the edge of the newly created gap will move toward the opening to close the “scratch” until new cell–cell contacts are established again.
  • the basic steps involve creation of a “scratch” on monolayer cells, capture of images at the beginning and regular intervals during cell migration to close the scratch, and comparison of the images to determine the rate of cell migration.
  • the antibody or antigen-binding fragment thereof reduces and/or inhibits cell migration by at least 50%, such as at least 60%, 70%, 80% or 90% compared to an isotype control antibody.
  • the antibody or antigen- binding fragment thereof reduces and/or inhibits cell migration by at least 80% such as 90% compared to an isotype control antibody.
  • the equilibrium dissociation constant (Kd) between the antibody or antigen-binding fragment thereof and TGF ⁇ R1 is less than or equal to 1 x 10 -8 (M).
  • the antibody or fragment has a dissociation constant (K D ) of less than 1x10 -7 mol/liter (M), preferably less than 1x10 -8 , more preferably less than 1x10 -9 .
  • the antibody or fragment has a dissociation constant (KD) of less than 9x10 -8 , such as 8x10 -8 , 7x10 -8 , 6x10 -8 , 5x10 -8 , 4x10 -8 , 3x10 -8 , 2x10 -8 , such as 1x10 -8 .
  • the antibody or fragment has a dissociation constant (K D ) of less than 9x10 -9 , such as 8x10 -9 , 7x10 -9 , 6x10 -9 , 5x10 -9 , 4x10 -9 , 3x10- 9 , 2x10 -9 , such as 1x10 -9 .
  • Binding specificity can be determined experimentally by methods known in the art. Such methods comprise, but are not limited to Biophysical Biolayer interferometry (BLI), isothermal titration calorimetry (ITC), Western blots, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), electrochemiluminescence (ECL), immunoradiometric assay (IRMA), Enzyme immunoassay (EIA), and using surface plasmon resonance (SPR), such as by using Biacore TM .
  • KD is determined by Biophysical Biolayer interferometry (BLI).
  • KD is determined by SPR.
  • the concentration of antibody that gives half-maximal binding (EC 50 ) between the antibody or antigen-binding fragment thereof and TGF ⁇ R1 is less than or equal to 150 ng/ml.
  • the antibody or fragment has an EC50 of less than 150 ng/ml, such as less than 100 ng/ml, 90 ng/ml, 80 ng/ml, 70 ng/ml, 60 ng/ml, 50 ng/ml, 40 ng/ml, 30 ng/ml, 20 ng/ml, such as less than 20 ng/ml.
  • the antibody or fragment has an EC50 of less than 40 ng/ml, such as less than 39 ng/ml, 38 ng/ml, 37 ng/ml, 36 ng/ml, 35 ng/ml, 34 ng/ml, 33 ng/ml, 32 ng/ml, 31 ng/ml, such as less than 30 ng/ml.
  • the antibody or fragment has an EC50 of less than 30 ng/ml, such as less than 29 ng/ml, 28 ng/ml, 27 ng/ml, 26 ng/ml, 25 ng/ml, 24 ng/ml, 23 ng/ml, 22 ng/ml, 21 ng/ml, such as less than 20 ng/ml.
  • EC 50 is determined by ELISA.
  • the affinity measurements and EC50 values of antibody 19 and its variants are shown in Table 1. The antibody affinity was measured using huECD 133 myc(His) and EC50 determination was performed on the positive antigen containing a human Fc tag.
  • Antibody EC50 KD [ng/ml] YU772-G12 21,27 8,7E-09 YU771-A01 21,97 1,1E-08 YU772-D10 22,48 7,8E-09 YU771-E01 23,09 8,9E-09 YU771-B12 24,4 1,6E-08 YU772-F11 24,91 7,6E-09 YU772-G04_VH-YU771-A09-VL 25,73 8,8E-09 YU772-H05 30,01 1,2E-08 YU772-D10_VH-YU772-C01_VL 30,29 7,3E-09 YU772-A11 31,45 7,9E-09 Antibody 19 139,2 2,2E-08 Table 1: Affinity measurements and EC 50 of lead antibodies.
  • the antibody format did not influence the binding affinity of the parental antibody (antibody 19).
  • the chimeric murine IgG1 mAb #19 demonstrated an equivalent affinity as the fully human IgG1 version carrying the silencing amino acid mutations of PavilizumAb.
  • the EC50 value of the variants was decreased more than six times compared to the parental antibody, whereas the affinity was increased three times compared to the parental antibody, antibody 19.
  • the present invention includes antibodies or fragments having FW and/or CDR amino acid sequences of the VH domain (SEQ ID NO: 4) and/or VL domain (SEQ ID NO: 12) of antibody 19 with, e.g., 20 or fewer 15 or fewer, 10 or fewer, 8 or fewer, 6 or fewer, 4 or fewer amino acid substitutions relative to any of the FW and/or CDR amino acid sequences disclosed herein.
  • the present invention includes antibodies or fragments having the HCDR amino acid sequences of the VH domain of antibody 19 [SEQ ID NO: 4] with 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, 1 or fewer (i.e.
  • the antibody or fragment comprises: a) a heavy chain complementarity determining region 1 (HCDR1) sequence of the VH domain of SEQ ID NO: 4, or a variant of the HCDR1 sequence comprising up to 2 amino acid substitutions; and/or b) a heavy chain complementarity determining region 2 (HCDR2) sequence of the VH domain of SEQ ID NO: 4, or a variant of the HCDR2 sequence comprising up to 3 amino acid substitutions; and/or c) a heavy chain complementarity determining region 3 (HCDR3) sequence of the VH domain of SEQ ID NO: 4, or a variant of the HCDR3 sequence comprising up to 5 amino acid substitutions.
  • HCDR1 heavy chain complementarity determining region 1
  • HCDR2 heavy chain complementarity determining region 2
  • HCDR3 heavy chain complementarity determining region 3
  • antibody 19 allows the development of further advantageous antibodies or fragments by directed substitution of one or more CDR and/or framework (FW) regions or residues thereof.
  • Antibody 19, also termed “mAb#19” consists of a fully human Variable region fused to the constant part of a human IgG1.
  • Chimeric murine antibody 19 comprises a fully human variable region fused to the constant part of a murine IgG1.
  • Antibodies or fragments that contain one or more mutations relative to the CDRs described herein can be easily tested for one or more desired property such as those described herein, for example, improved binding specificity, increased binding affinity, improved or enhanced biological properties, etc. Antibodies or fragments obtained in this general manner are encompassed within the present invention.
  • the present invention encompasses antibodies or fragments having amino acid sequences that vary from those of the described antibodies or fragments, but that reduce and/or inhibit proteolytic cleavage of TGF ⁇ R1; and/or reduce and/or inhibit the translocation of the intracellular domain (ICD) of TGF ⁇ R1 to the nucleus of a cell to a similar extent to the exemplified antibodies or fragments.
  • ICD intracellular domain
  • CDRs within variable region amino acid sequences are well known in the art and can be used to identify CDRs within the specified antibodies or fragments amino acid sequences disclosed herein.
  • Exemplary conventions that can be used to identify the boundaries of CDRs include, e.g., the Kabat definition, the Chothia definition, the IMGT definition, and the AbM definition.
  • the Kabat definition is based on sequence variability
  • the Chothia definition is based on the location of the structural loop regions
  • the AbM definition is a hybrid of the Kabat and Chothia approaches (Kabat, "Sequences of Proteins of Immunological Interest," National Institutes of Health, Bethesda, Md. (1991); Chothia C, Lesk a M.
  • CDR sequences may be defined using any one of the AbM, IMGT, Chothia, and KABAT numbering schemes, or a combination of the numbering schemes. In an embodiment, the CDRs are defined using the IMGT numbering system. In an embodiment, the CDRs are defined using the Kabat numbering system.
  • the CDR sequences are defined using the Kabat numbering system.
  • the antibody or fragment comprises: i. a HCDR1 comprising the sequence of SEQ ID No: 6 or a variant thereof comprising up to 2 amino acid substitutions; and/or ii. a HCDR2 comprising the sequence of SEQ ID No: 8 or a variant thereof comprising up to 3 amino acid substitutions; and/or iii. a HCDR3 comprising the sequence of SEQ ID No: 10 or a variant thereof comprising up to 5 amino acid substitutions.
  • the antibody or fragment comprises: i.
  • the antibody or fragment includes at least one, two, or three complementarity determining regions (CDRs) (or collectively all of the CDRs) from a heavy chain variable region of an antibody described herein, e.g., an antibody selected from YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771- B12, YU772-G04-VH/YU771-A09VL, YU772-H05, YU772-D10VH/YU772-C01VL, YU772-A11, and antibody 19.
  • CDRs complementarity determining regions
  • the present invention includes antibodies or fragments having the LCDR amino acid sequences of the VL domain of antibody 19 [SEQ ID NO: 12] with 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, 1 or fewer (i.e. zero), amino acid substitutions relative to any of the LCDR amino acid sequences disclosed herein.
  • the antibody or fragment comprises: a) a light chain complementarity determining region 1 (LCDR1) sequence of the VL domain of SEQ ID NO: 12, or a variant of the LCDR1 sequence comprising up to 3 amino acid substitutions; and/or b) a light chain complementarity determining region 2 (LCDR2) sequence of the VL domain of SEQ ID NO: 12, or a variant of the LCDR2 sequence comprising up to 3 amino acid substitutions; and/or c) a light chain complementarity determining region 3 (LCDR3) sequence of the VL domain of SEQ ID NO: 12, or a variant of the LCDR3 sequence comprising up to 1 amino acid substitution.
  • the antibody or fragment comprises: i.
  • an LCDR1 comprising the sequence of SEQ ID No: 14 or a variant thereof comprising up to 3 amino acid substitutions
  • an LCDR2 comprising the sequence of SEQ ID No: 16 or a variant thereof comprising up to 3 amino acid substitutions
  • iii. an LCDR3 comprising the sequence of SEQ ID No: 18 or a variant thereof comprising up to 1 amino acid substitution.
  • Table 2 provides examples of amino acid substitutions within the CDR regions of both the VH domain (SEQ ID NO: 4) and VL domain (SEQ ID NO: 12) of antibody 19.
  • the variants of the CDR sequences mentioned herein comprise one or more amino acid substitutions at the positions described in Table 2.
  • the variants of the CDR sequences mentioned herein comprise one or more of the particular amino acid substitutions described in Table 2.
  • the antibody or fragment comprises a variant of the HCDR1 comprising the sequence of SEQ ID No: 6, comprising up to 2 amino acid substitutions
  • the two amino acid substitutions may be at positions S31 and/or A33.
  • the 2 amino acid substitutions may be selected from any of S31P, S31T, S31K, S31A, A33P, and A33G.
  • the numbering of the HCDR residues is relative to the numbering of the VH domain of antibody 19 (SEQ ID NO: 4), and the numbering of the LCDR residues is relative to the numbering of the VL domain of antibody 19 (SEQ ID NO: 12).
  • the nomination of the position (lettering) in the first column is according to Kabat CDR determination.
  • the antibody or antigen-binding fragment thereof described herein comprises: i.
  • the LCDR2 of any of antibodies YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771-B12, YU772-G04-VH/YU771-A09VL, YU772-H05, YU772-D10VH/YU772-C01VL, YU772-A11, and antibody 19 as indicated in Table 20; and/or iii.
  • the antibody or fragment includes at least one, two, or three complementarity determining regions (CDRs) (or collectively all of the CDRs) from a light chain variable region of an antibody described herein, e.g., an antibody selected from YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771- B12, YU772-G04-VH/YU771-A09VL, YU772-H05, YU772-D10VH/YU772-C01VL, YU772-A11, and antibody 19.
  • CDRs complementarity determining regions
  • the antibody or fragment includes at least one, two, three, four, five, or six CDRs according to Kabat numbering (e.g., at least one, two, three, four, five, or six CDRs according to the Kabat definition as set out in the sequence listing table) from the heavy and light chain variable regions of an antibody described herein, e.g., an antibody chosen from YU772-F11, or YU772- G12, or YU771-A01, or YU772-D10, or YU771-E01, or YU771-B12, or YU772-G04- VH/YU771-A09VL, or YU772-H05, or YU772-D10VH/YU772-C01VL, or YU772-A11, or antibody 19.
  • Kabat numbering e.g., at least one, two, three, four, five, or six CDRs according to the Kabat definition as set out in the sequence listing table
  • the antibody or fragment comprises an HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 of any of antibodies YU772-F11, or YU772- G12, or YU771-A01, or YU772-D10, or YU771-E01, or YU771-B12, or YU772-G04- VH/YU771-A09VL, or YU772-H05, or YU772-D10VH/YU772-C01VL, or YU772-A11, or antibody 19.
  • the antibody or antigen-binding fragment thereof comprises a VH domain which comprises i.
  • an HCDR1 comprising the sequence of SEQ ID No: 6; and/or ii. an HCDR2 comprising the sequence of SEQ ID No: 8; and/or iii. an HCDR3 comprising the sequence of SEQ ID No: 10; and a VL domain which comprises i. an LCDR1 comprising the sequence of SEQ ID No: 14; and/or ii. an LCDR2 comprising the sequence of SEQ ID No: 16; and/or iii. an LCDR3 comprising the sequence of SEQ ID No: 18.
  • the antibody or antigen-binding fragment thereof comprises a VH domain which comprises i. an HCDR1 comprising the sequence of SEQ ID No: 126; and/or ii.
  • an HCDR2 comprising the sequence of SEQ ID No: 128; and/or iii. an HCDR3 comprising the sequence of SEQ ID No: 130; and a VL domain which comprises i. an LCDR1 comprising the sequence of SEQ ID No: 134; and/or ii. an LCDR2 comprising the sequence of SEQ ID No: 136; and/or iii. an LCDR3 comprising the sequence of SEQ ID No: 138.
  • the antibody or antigen-binding fragment thereof comprises a VH domain which comprises i. an HCDR1 comprising the sequence of SEQ ID No: 26; and/or ii.
  • an HCDR2 comprising the sequence of SEQ ID No: 28; and/or iii. an HCDR3 comprising the sequence of SEQ ID No: 30; and a VL domain which comprises i. an LCDR1 comprising the sequence of SEQ ID No: 34; and/or ii. an LCDR2 comprising the sequence of SEQ ID No: 36; and/or iii. an LCDR3 comprising the sequence of SEQ ID No: 38.
  • the antibody or antigen-binding fragment thereof comprises a VH domain which comprises i. an HCDR1 comprising the sequence of SEQ ID No: 46; and/or ii. an HCDR2 comprising the sequence of SEQ ID No: 48; and/or iii.
  • an HCDR3 comprising the sequence of SEQ ID No: 50; and a VL domain which comprises i. an LCDR1 comprising the sequence of SEQ ID No: 54; and/or ii. an LCDR2 comprising the sequence of SEQ ID No: 56; and/or iii. an LCDR3 comprising the sequence of SEQ ID No: 58.
  • the antibody or antigen-binding fragment thereof comprises a VH domain which comprises i. an HCDR1 comprising the sequence of SEQ ID No: 66; and/or ii. an HCDR2 comprising the sequence of SEQ ID No: 68; and/or iii.
  • an HCDR3 comprising the sequence of SEQ ID No: 70; and a VL domain which comprises i. an LCDR1 comprising the sequence of SEQ ID No: 74; and/or ii. an LCDR2 comprising the sequence of SEQ ID No: 76; and/or iii. an LCDR3 comprising the sequence of SEQ ID No: 78.
  • the antibody or antigen-binding fragment thereof comprises a VH domain which comprises i. an HCDR1 comprising the sequence of SEQ ID No: 86; and/or ii. an HCDR2 comprising the sequence of SEQ ID No: 88; and/or iii.
  • an HCDR3 comprising the sequence of SEQ ID No: 90; and a VL domain which comprises i. an LCDR1 comprising the sequence of SEQ ID No: 94; and/or ii. an LCDR2 comprising the sequence of SEQ ID No: 96; and/or iii. an LCDR3 comprising the sequence of SEQ ID No: 98.
  • the antibody or antigen-binding fragment thereof comprises a VH domain which comprises i. an HCDR1 comprising the sequence of SEQ ID No: 106; and/or ii. an HCDR2 comprising the sequence of SEQ ID No: 108; and/or iii.
  • an HCDR3 comprising the sequence of SEQ ID No: 110; and a VL domain which comprises i. an LCDR1 comprising the sequence of SEQ ID No: 114; and/or ii. an LCDR2 comprising the sequence of SEQ ID No: 116; and/or iii. an LCDR3 comprising the sequence of SEQ ID No: 118.
  • the antibody or antigen-binding fragment thereof comprises a VH domain which comprises i. an HCDR1 comprising the sequence of SEQ ID No: 146; and/or ii. an HCDR2 comprising the sequence of SEQ ID No: 148; and/or iii.
  • an HCDR3 comprising the sequence of SEQ ID No: 150; and a VL domain which comprises i. an LCDR1 comprising the sequence of SEQ ID No: 154; and/or ii. an LCDR2 comprising the sequence of SEQ ID No: 156; and/or iii. an LCDR3 comprising the sequence of SEQ ID No: 158.
  • the antibody or antigen-binding fragment thereof comprises a VH domain which comprises i. an HCDR1 comprising the sequence of SEQ ID No: 166; and/or ii. an HCDR2 comprising the sequence of SEQ ID No: 168; and/or iii.
  • an HCDR3 comprising the sequence of SEQ ID No: 170; and a VL domain which comprises i. an LCDR1 comprising the sequence of SEQ ID No: 174; and/or ii. an LCDR2 comprising the sequence of SEQ ID No: 176; and/or iii. an LCDR3 comprising the sequence of SEQ ID No: 178.
  • the antibody or antigen-binding fragment thereof comprises a VH domain which comprises i. an HCDR1 comprising the sequence of SEQ ID No: 186; and/or ii. an HCDR2 comprising the sequence of SEQ ID No: 188; and/or iii.
  • an HCDR3 comprising the sequence of SEQ ID No: 190; and a VL domain which comprises i. an LCDR1 comprising the sequence of SEQ ID No: 194; and/or ii. an LCDR2 comprising the sequence of SEQ ID No: 196; and/or iii. an LCDR3 comprising the sequence of SEQ ID No: 198.
  • the antibody or antigen-binding fragment thereof comprises a VH domain which comprises i. an HCDR1 comprising the sequence of SEQ ID No: 206; and/or ii. an HCDR2 comprising the sequence of SEQ ID No: 208; and/or iii.
  • an HCDR3 comprising the sequence of SEQ ID No: 210; and a VL domain which comprises i. an LCDR1 comprising the sequence of SEQ ID No: 214; and/or ii. an LCDR2 comprising the sequence of SEQ ID No: 216; and/or iii. an LCDR3 comprising the sequence of SEQ ID No: 218.
  • the antibody or fragment comprises a heavy chain variable domain amino acid sequence which comprises the amino acid sequence of SEQ ID NO: 4, or a heavy chain variable domain amino acid sequence that is at least 80% identical to SEQ ID NO: 4; and/or wherein the antibody or fragment comprises a light chain variable domain amino acid sequence which comprises the amino acid sequence of SEQ ID NO: 12, or a light chain variable domain amino acid sequence that is at least 80% identical to SEQ ID NO: 12.
  • the antibody or fragment comprises a heavy chain variable (VH) domain amino acid sequence that is at least 80% identical to SEQ ID NO: 4, such as at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4.
  • the antibody or fragment comprises a heavy chain variable domain amino acid sequence that is at least 95% identical to SEQ ID NO: 4.
  • the antibody or fragment comprises a heavy chain variable domain amino acid sequence which comprises the amino acid sequence of SEQ ID NO: 4.
  • the antibody or fragment comprises a light chain variable domain amino acid sequence that is at least 80% identical to SEQ ID NO: 12, such as at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 12.
  • the antibody or fragment comprises a light chain variable domain amino acid sequence that is at least 96% identical to SEQ ID NO: 12.
  • the antibody or fragment comprises a light chain variable domain amino acid sequence which comprises the amino acid sequence of SEQ ID NO: 12.
  • the antibody or fragment comprises a heavy chain variable (VH) domain amino acid sequence that is at least 80% identical to SEQ ID NO: 124, such as at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 124.
  • the antibody or fragment comprises a heavy chain variable domain amino acid sequence that is at least 95% identical to SEQ ID NO: 124.
  • the antibody or fragment comprises a heavy chain variable (VH) domain amino acid sequence which comprises the amino acid sequence of SEQ ID NO: 124.
  • the antibody or fragment comprises a light chain variable domain (VL) amino acid sequence that is at least 80% identical to SEQ ID NO: 132, such as at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 132.
  • the antibody or fragment comprises a light chain variable domain amino acid sequence that is at least 96% identical to SEQ ID NO: 132.
  • the antibody or fragment comprises a light chain variable domain amino acid sequence which comprises the amino acid sequence of SEQ ID NO: 132.
  • the specified variation in sequence identity relative to a given SEQ ID NO of a VH or VL domain is outside of the CDR sequences.
  • the antibody or fragment comprises a heavy chain variable domain (VH) amino acid sequence of SEQ ID NO: 24; and/or a light chain variable domain (VL) amino acid sequence of SEQ ID NO: 32.
  • the antibody or fragment comprises a heavy chain variable domain (VH) amino acid sequence of SEQ ID NO: 44; and/or a light chain variable domain (VL) amino acid sequence of SEQ ID NO: 52.
  • the antibody or fragment comprises a heavy chain variable domain (VH) amino acid sequence of SEQ ID NO: 64; and/or a light chain variable domain (VL) amino acid sequence of SEQ ID NO: 72.
  • the antibody or fragment comprises a heavy chain variable domain (VH) amino acid sequence of SEQ ID NO: 84; and/or a light chain variable domain (VL) amino acid sequence of SEQ ID NO: 92.
  • the antibody or fragment comprises a heavy chain variable domain (VH) amino acid sequence of SEQ ID NO: 104; and/or a light chain variable domain (VL) amino acid sequence of SEQ ID NO: 112.
  • the antibody or fragment comprises a heavy chain variable domain (VH) amino acid sequence of SEQ ID NO: 144; and/or a light chain variable domain (VL) amino acid sequence of SEQ ID NO: 152.
  • the antibody or fragment comprises a heavy chain variable domain (VH) amino acid sequence of SEQ ID NO: 164; and/or a light chain variable domain (VL) amino acid sequence of SEQ ID NO: 172.
  • the antibody or fragment comprises a heavy chain variable domain (VH) amino acid sequence of SEQ ID NO: 184; and/or a light chain variable domain (VL) amino acid sequence of SEQ ID NO: 192.
  • the antibody or fragment comprises a heavy chain variable domain (VH) amino acid sequence of SEQ ID NO: 204; and/or a light chain variable domain (VL) amino acid sequence of SEQ ID NO: 212.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • Percent (%) amino acid sequence identity and “homology” with respect to a peptide, polypeptide or antibody sequence are defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific peptide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity.
  • the antibody or fragment has a heavy chain constant region chosen from, the heavy chain constant regions of IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE; particularly, chosen from, e.g., the heavy chain constant regions of IgG1, IgG2, IgG3, and IgG4, more particularly, the heavy chain constant region of IgG1 or IgG4 (e.g., human IgG1, IgG2 or IgG4).
  • a heavy chain constant region chosen from, the heavy chain constant regions of IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE; particularly, chosen from, e.g., the heavy chain constant regions of IgG1, IgG2, IgG3, and IgG4, more particularly, the heavy chain constant region of IgG1 or IgG4 (e.g., human IgG1, IgG2 or Ig
  • the antibody has a heavy chain constant region that is IgG. In an embodiment, the antibody has a heavy chain constant region that is IgG1. In one embodiment, the heavy chain constant region is human IgG1. For example, the IgG1 heavy chain may have the sequence of (SEQ ID NO: 223). In some embodiments, the heavy chain constant region is a murine IgG1. For example, the IgG1 heavy chain may have the sequence of (SEQ ID NO: 225). In another embodiment, the antibody or fragment has a light chain constant region chosen from, e.g., the light chain constant regions of kappa or lambda. In an embodiment, the antibody or fragment has a kappa light chain constant region.
  • the antibody or fragment has a human kappa light chain constant region.
  • the light chain constant region may comprise or consist of the sequences of SEQ ID Nos. 224 or 226 as shown in Table 20.
  • the constant region is altered, e.g., mutated, to modify the properties of the antibody or fragment (e.g., to increase or decrease one or more of: Fc receptor binding, antibody glycosylation, the number of cysteine residues, effector cell function, complement function, half-life, aggregation and stability).
  • the antibody or fragment comprises a mutated human IgG1.
  • the antibody or fragment comprises a mutated murine IgG1.
  • the antibody or antigen-binding fragment comprises a heavy chain constant region which has reduced binding to the IgG Fc receptors Fc ⁇ RI, Fc ⁇ RII and/or Fc ⁇ RIII as well as to complement component C1q.
  • the antibody or fragment has a heavy chain constant region which has increased binding to the neonatal Fc receptor (FcRn).
  • the antibody or antigen-binding fragment further comprises a LALA or LALA-PG mutation in its heavy chain constant region.
  • LALA LALA
  • One of the most widely used IgG1 variants is L234A/L235A (LALA) (J. Lund et al., J Immunol October 15, 1991, 147 (8) 2657-2662).
  • the antibody or antigen-binding fragment further comprises the STR mutations L234S, L235T, G236R in the heavy chain constant region of IgG1, described in Wilkinson et al (2021), Fc-engineered antibodies with immune effector functions completely abolished. PLOS ONE 16 (12).
  • the mutations in the heavy chain constant region IgG1 are selected from: E233P, L234V, L235A, deletion of G236, D265G, A327Q, and A330S and deleted C-terminal Lysin.
  • the antibody or fragment comprises a heavy chain amino acid sequence of any of antibodies YU772-F11, or YU772-G12, or YU771-A01, or YU772- D10, or YU771-E01, or YU771-B12, or YU772-G04-VH/YU771-A09VL, or YU772-H05, or YU772-D10VH/YU772-C01VL, or YU772-A11, or antibody 19, as set out in Table 20; and/or a light chain amino acid sequence of any of antibodies YU772-F11, or YU772- G12, or YU771-A01, or YU772-D10, or YU771-E01, or YU771-B12, or YU772-G04- VH/YU771-A09VL, or YU772-H05, or YU772-D10
  • the antibody or antigen-binding fragment thereof has a heavy chain amino acid sequence of SEQ ID No: 20 and/or a light chain amino acid sequence of SEQ ID No 22. In an embodiment, the antibody or antigen-binding fragment thereof has a heavy chain amino acid sequence of SEQ ID No: 140 and/or a light chain amino acid sequence of SEQ ID No 142. In an embodiment, the antibody or antigen-binding fragment thereof further comprises a detectable moiety.
  • a detectable moiety we include the meaning that the moiety is one which, when located at the target site following administration of the antibody or fragment of the invention into a patient, may be detected, typically non-invasively from outside the body, and the site of the target located.
  • the antibodies or fragments comprising detectable moieties may be useful in imaging and diagnosis, or in drug discovery.
  • the detectable moiety comprises a fluorophore, an enzyme, or a radioisotope.
  • the detectable moiety may be a radioactive atom which is useful in imaging. Suitable radioactive atoms include technetium-99m or iodine-123 for scintigraphic studies.
  • Others may be selected from the group consisting of: iodine- 124; iodine-125; iodine-126; iodine-131; iodine-133; indium-111; indium-113m, fluorine-18; fluorine-19; carbon-11; carbon-13; copper-64; nitrogen-13; nitrogen-15; oxygen-15; oxygen-17; arsenic-72; gadolinium; manganese; iron; deuterium; tritium; yttrium-86; zirconium-89; bromine-77, gallium-67; gallium-68, ruthenium-95, ruthenium-97, ruthenium-103, ruthenium-105, mercury-107, rhenium-99m, rhenium- 101, rhenium-105, scandium-47.
  • Other readily detectable moieties include, for example, spin labels for magnetic resonance imaging (MRI) such as iodine-123 again, iodine-131, indium-111, fluorine- 19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron.
  • MRI magnetic resonance imaging
  • the antibody or fragment of the invention must have sufficient of the appropriate atomic isotopes in order for the molecule to be detectable.
  • the radio- or other label may be incorporated in the compound in known ways.
  • the antibody may be biosynthesised or synthesised by chemical amino acid synthesis using suitable amino acid precursors involving, for example, fluorine-19 in place of hydrogen.
  • Labels such as 99m Tc, 123 I, 186 Rh, 188 Rh and 111 In can, for example, be attached via cysteine residues in the antibody.
  • Yttrium-90 can be attached via a lysine residue.
  • the IODOGEN method (Fraker et al (1978) Biochem. Biophys. Res. Comm. 80, 49-57) can be used to incorporate iodine-123.
  • the reference (“Monoclonal Antibodies in Immunoscintigraphy”, J.F.
  • the antibodies of the invention or their functional fragments can be prepared by methods known to the person skilled in the art.
  • the detectable moiety may comprise a detectable enzyme such as peroxidase, alkaline phosphatase, beta-D-galactosidase, glucose oxidase, glucose amylase, carbonic anhydrase, acetylcholinesterase, lysozyme, malate dehydrogenase or glucose 6- phosphate dehydrogenase.
  • the detectable moiety may comprise a molecule such as biotin, digoxygenin or 5- bromodeoxyuridine.
  • the detectable moiety may comprise a chemiluminescent label such as luminol and the dioxetanes, or a bioluminescent label such as luciferase and luciferin.
  • the antibody or antigen-binding fragment is conjugated to a therapeutic moiety, such as a cytotoxin, a chemotherapeutic drug, an immunosuppressant or a radioisotope.
  • a therapeutic moiety such as a cytotoxin, a chemotherapeutic drug, an immunosuppressant or a radioisotope.
  • the cytotoxic moiety is selected from a directly cytotoxic chemotherapeutic agent, a directly cytotoxic polypeptide, a moiety which is able to convert a prodrug into a cytotoxic drug, a radiosensitizer, a directly cytotoxic nucleic acid, a nucleic acid molecule that encodes a directly or indirectly cytotoxic polypeptide or a radioactive atom.
  • cytotoxic moieties as well as methods of making the conjugates comprising the antibody and the cytotoxic moiety, are provided in our earlier publications WO 02/36771, WO 2004/046191, and WO 2011/027132 incorporated herein by reference.
  • a cytotoxin or cytotoxic agent includes any agent that is detrimental to (e.g., kills) cells.
  • examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof.
  • the cytotoxic moiety is a cytotoxic chemotherapeutic agent.
  • Suitable chemotherapeutic agents for forming immunoconjugates include, but are not limited to, anti-metabolites (e.g., methotrexate, 6- mercaptopurine, 6-thioguanine, cytarabine, fludarabin, 5-fluorouracil, decarbazine, hydroxyurea, azathiprin, gemcitabin and cladribin), alkylating agents (e.g., mechlorethamine, thioepa, chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubic
  • Antibody-drug conjugates such as for cancer therapy are reviewed by Carter & Senter (2008), Cancer J. 14(3): 154-69, and Chari et al (2014) Angewandte Chemie International Edition 53: 3751, incorporated herein by reference, and it will be appreciated that the compounds of this aspect of the invention may considered such antibody drug conjugates (see also US 5,773,001; US 5,767,285; US 5,739,116; US 5,693,762; US 5,585,089; US 2006/0088522; US 2011/0008840; US 7,659,241; Hughes (2010) Nat Drug Discov 9: 665, Lash (2010); In vivo: The Business & Medicine Report 32-38; Mahato et al (2011) Adv Drug Deliv Rev 63: 659; Jeffrey et al (2006) BMCL 16: 358; Drugs R D 11(1): 85-95).
  • ADCs generally comprise a monoclonal antibody against a target present on a tumour cell, a cytotoxic drug, and a linker that attaches the antibody to the drug.
  • cytotoxic moieties such as cytotoxic chemotherapeutic agents
  • cytotoxic chemotherapeutic agents have previously been attached to antibodies and other targeting agents, and so compounds of the invention comprising these agents may readily be made by the person skilled in the art.
  • carbodiimide conjugation (Bauminger & Wilchek (1980) Methods Enzymol. 70, 151-159) may be used to conjugate a variety of agents, including doxorubicin, to antibodies.
  • Other methods for conjugating a cytotoxic moiety to an antibody can also be used.
  • the cytotoxic moiety may be a cytotoxic peptide or polypeptide moiety by which we include any moiety which leads to cell death.
  • Cytotoxic peptide and polypeptide moieties are well known in the art and include, for example, ricin, abrin, Pseudomonas exotoxin, tissue factor and the like. Methods for linking them to targeting moieties such as antibodies are also known in the art, and include, for example, conventional ways of crosslinking polypeptides and production of the compound as a fusion polypeptide using recombinant DNA techniques.
  • ricin as a cytotoxic agent is described in Burrows & Thorpe (1993) Proc. Natl. Acad. Sci.
  • Certain cytokines such as TNF ⁇ , INF ⁇ and IL-2, may also be useful as cytotoxic agents.
  • Certain radioactive atoms may also be cytotoxic if delivered in sufficient doses.
  • the cytotoxic moiety may comprise a radioactive atom which, in use, delivers a sufficient quantity of radioactivity to the target site so as to be cytotoxic.
  • Suitable radioactive atoms include phosphorus-32, iodine-125, iodine-131, indium-111, rhenium-186, rhenium-188 or yttrium-90, or any other isotope which emits enough energy to destroy neighbouring cells, organelles or nucleic acid.
  • the isotopes and density of radioactive atoms in the compound of the invention are such that a dose of more than 4000 cGy (preferably at least 6000, 8000 or 10000 cGy) is delivered to the target site and, preferably, to the cells at the target site.
  • the radioactive atom may be attached to the antibody in known ways.
  • EDTA or another chelating agent may be attached to the antibody and used to attach 111 In or 90 Y.
  • Tyrosine residues may be labelled with 125 I or 131 I.
  • the cytotoxic moiety may be a radiosensitizer.
  • Radiosensitizers include fluoropyrimidines, thymidine analogues, hydroxyurea, gemcitabine, fludarabine, nicotinamide, halogenated pyrimidines, 3-aminobenzamide, 3-aminobenzodiamide, etanixadole, pimonidazole and misonidazole (see, for example, McGinn et al (1996) J. Natl. Cancer Inst. 88, 1193-11203; Shewach & Lawrence (1996) Invest. New Drugs 14, 257-263; Horsman (1995) Acta Oncol. 34, 571-587; Shenoy & Singh (1992) Clin. Invest.
  • the cytotoxic moiety may be a procoagulant factor, such as the extracellular domain of tissue factor (Rippmann et al (2000) “Fusion of the tissue factor extracellular domain to a tumour stroma specific single-chain fragment variable antibody results in an antigen-specific coagulation-promoting molecule.” Biochem J.
  • the cytotoxic moiety may be an indirectly cytotoxic polypeptide.
  • the indirectly cytotoxic polypeptide is a polypeptide which has enzymatic activity and can convert a relatively non-toxic prodrug into a cytotoxic drug.
  • ADEPT Antibody-Directed Enzyme Prodrug Therapy
  • the system requires that the targeting moiety locates the enzymatic portion to the desired site in the body of the patient (e.g.
  • the object of the approach is to maximise the concentration of drug at the desired site and to minimise the concentration of drug in normal tissues (Senter et al (1988) “Anti- tumor effects of antibody-alkaline phosphatase conjugates in combination with etoposide phosphate” Proc. Natl. Acad. Sci. USA 85, 4842-4846; Bagshawe (1987) Br. J.
  • the prodrug is relatively non-toxic compared to the cytotoxic drug. Typically, it has less than 10% of the toxicity, preferably less than 1% of the toxicity as measured in a suitable in vitro cytotoxicity test.
  • the cytotoxic moiety may be one which becomes cytotoxic, or releases a cytotoxic moiety, upon irradiation.
  • the boron-10 isotope when appropriately irradiated, releases D particles which are cytotoxic (US 4,348,376; Primus et al (1996) Bioconjug. Chem. 7: 532-535).
  • the cytotoxic moiety may be one which is useful in photodynamic therapy such as photofrin (see, for example, Dougherty et al (1998) J. Natl. Cancer Inst. 90, 889-905).
  • the cytotoxic moiety is an antibody, such as one that specifically binds to an immune cell, such as a cytotoxic immune cell (eg T cell).
  • the compound of the invention may be an asymmetric IgG-like antibody (eg triomab/quadroma, Trion Pharma/Fresenius Biotech; knobs-into-holes, Genentech; Cross MAbs, Roche; electrostatically matched antibodies, AMGEN; LUZ-Y, Genentech; strand exchange engineered domain (SEED) body, EMD Serono; biolonic, erus; and Fab-exchanged antibodies, Genmab), symmetric IgG-like antibodies (eg dual targeting (DT)-lg, GSK/Domantis; two-in-one antibody, Genentech; crosslinked MAbs, karmanos cancer center; mAb ⁇ 2>, F-star; and Cov X-body, Cov X/Pfizer), IgG fusions (eg dual variable domain (DVD)-lg, Abbott; IgG-like bispecific antibodies, Eli Lilly; Ts2Ab, Medimmune/AZ
  • the cytotoxic moiety is a pyrrolobenzodiazepine dimer (PBD).
  • PBDs are potent anticancer agents which have been shown to have broad spectrum anti-tumour activity in vivo. These drugs exert their activity by binding the minor groove of DNA and linking the two DNA strands together in a way that cells find difficult to recognise and repair.
  • the compound of the invention may be an ADC comprising a PBD. Further information on PBDs can be found in Hartley et al, 2012 (Invest New Drugs 30: 950-958).
  • the invention provides an antibody or antigen-binding fragment thereof, optionally as defined in any of the embodiments herein, that specifically binds to transforming growth factor beta receptor I (TGF ⁇ R1), wherein the antibody or fragment binds to the region comprising amino acid residues 126 to 133 of TGF ⁇ R1, and wherein the antibody or fragment competes for binding to said region of TGF ⁇ R1 with any of the antibodies defined in any of the embodiments described herein.
  • Competition between antibodies may be assayed in vitro, for example using ELISA, FACS and/or by tagging a specific reporter molecule to one antibody which can be detected in the presence of other untagged antibody, to enable identification of specific binding members which bind the same epitope or an overlapping epitope.
  • Cross- competition between binding members may be readily assayed by running the reverse assay, e.g., by reversing the tagged and the untagged binding members to identify pairs that block binding in both directions.
  • Competition may be determined by surface plasmon resonance (SPR), such techniques being readily apparent to the skilled person.
  • SPR can be carried out using BiacoreTM, ProteonTM or another standard SPR technique.
  • Such competition may be due, for example, to the antibodies/fragments binding to identical or overlapping epitopes of TGF ⁇ R1.
  • the invention provides a pharmaceutical composition comprising an antibody or antigen-binding fragment thereof as defined in any of the embodiments herein, and a pharmaceutically acceptable carrier, excipient or diluent.
  • parenteral administration and “administered parenterally” we include the meaning of modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intra-peritoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection, inhalation and infusion.
  • the pharmaceutical composition is administered by intravenous or subcutaneous injection or infusion, or by inhalation.
  • the antibodies and fragments of the present invention which may be used in the form of a pharmaceutically acceptable salt or in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art.
  • pharmaceutically acceptable carrier we include the meaning of any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonicity agents, antioxidants and absorption delaying agents, and the like that are physiologically compatible.
  • Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • the use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the invention is contemplated.
  • the carrier is suitable for parenteral administration, e.g. intravenous or subcutaneous injection or infusion.
  • Pharmaceutical compositions typically must be sterile and stable under the conditions of manufacture and storage.
  • the composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration.
  • aqueous and nonaqueous carriers examples include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
  • polyols such as glycerol, propylene glycol, polyethylene glycol, and the like
  • vegetable oils such as olive oil
  • injectable organic esters such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • the pharmaceutical compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents.
  • Prevention of presence of microorganisms may be ensured both by sterilization procedures and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonicity agents, such as sugars, polyalcohols such as mannitol, sorbitol, glycerol or sodium chloride in the compositions.
  • antioxidants may also be included, for example (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
  • water soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like
  • oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (
  • Prolonged absorption of injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients e.g. as enumerated above, as required, followed by sterilization microfiltration.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients e.g. from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • the antibody may be used in a suitable hydrated form or in the form of a pharmaceutically acceptable salt.
  • pharmaceutically acceptable salt we include the meaning of a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects (see e.g., Berge, S.M., et al. (1977) J. Pharm. Sci. 66: 1-19). Examples of such salts include acid addition salts and base addition salts.
  • Acid addition salts include those derived from nontoxic inorganic acids, such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous and the like, as well as from nontoxic organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids and the like.
  • nontoxic inorganic acids such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous and the like
  • nontoxic organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids and the like.
  • Base addition salts include those derived from alkaline earth metals, such as sodium, potassium, magnesium, calcium and the like, as well as from nontoxic organic amines, such as N,N'-dibenzylethylenediamine, N-methyl- glucamine, chloroprocaine, choline, diethanolamine, ethylenediamine, procaine and the like.
  • the active compound i.e., antibody
  • the compound may be administered to a subject in an appropriate carrier, for example, liposomes.
  • Liposomes include water- in-oil-in-water CGF emulsions as well as conventional liposomes (Strejan et al. (1984) J. Neuroimmunol. 7: 27).
  • the active compounds can be prepared with carriers that will protect the compound against rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for the preparation of such formulations are generally known to those skilled in the art. See, e.g., Sustained and Controlled Release Drug Delivery Systems, J.R.
  • compositions can be administered with medical devices known in the art.
  • a therapeutic composition of the invention can be administered with a needleless hypodermic injection device, such as the devices disclosed in US 5,399,163; US 5,383,851; US 5,312,335; US 5,064,413; US 4,941,880; US 4,790,824; or US 4,596,556.
  • Examples of well-known implants and modules useful in the present invention include: US 4,487,603, which discloses an implantable micro-infusion pump for dispensing medication at a controlled rate; US 4,486,194, which discloses a therapeutic device for administering medicants through the skin; US 4,447,233, which discloses a medication infusion pump for delivering medication at a precise infusion rate; US 4,447,224, which discloses a variable flow implantable infusion apparatus for continuous drug delivery; US 4,439,196, which discloses an osmotic drug delivery system having multi-chamber compartments; and US 4,475,196, which discloses an osmotic drug delivery system. Many other such implants, delivery systems, and modules are known to those skilled in the art.
  • the human monoclonal antibodies of the invention can be formulated to ensure proper distribution in vivo.
  • the blood-brain barrier excludes many highly hydrophilic compounds.
  • the therapeutic compounds of the invention cross the BBB (if desired)
  • they can be formulated, for example, in liposomes.
  • liposomes For methods of manufacturing liposomes, see, e.g., US 4,522,811; US 5,374,548; and US 5,399,331.
  • the liposomes may comprise one or more moieties which are selectively transported into specific cells or organs, thus enhance targeted drug delivery (see, e.g., V.V. Ranade (1989) J. Clin. Pharmacol.
  • the invention provides a method of formulating the antibody or antigen- binding fragment thereof into a pharmaceutical composition
  • a pharmaceutical composition comprising mixing the antibody or antigen-binding fragment thereof as defined in any of the embodiments herein, with a pharmaceutically acceptable carrier, excipient or diluent.
  • the pharmaceutical compositions may be formulated with pharmaceutically acceptable carriers or diluents as well as any other known adjuvants and excipients in accordance with conventional techniques such as those disclosed in Remington: The Science and Practice of Pharmacy, 19th Edition, Gennaro, Ed., Mack Publishing Co., Easton, PA, 1995.
  • the invention provides an antibody or antigen-binding fragment thereof as defined in any of the embodiments herein, or a pharmaceutical composition as defined in any of the embodiments herein, for use in medicine.
  • the present antibodies or antigen-binding fragments thereof may be for use in a method of treatment or diagnosis of the human or animal body, such as a method of treatment (which may include prophylactic treatment) of a disease or disorder in a human or animal patient, which comprises administering an effective amount to the patient.
  • Administration for therapy is preferably in a "therapeutically effective amount" sufficient to show benefit to a patient.
  • Such benefit may be at least amelioration of at least one symptom of a particular disease or condition.
  • the actual amount administered, and rate and time-course of administration, will depend on the nature and severity of the disease or condition being treated.
  • the precise dose will depend upon a number of factors, including whether the antibody or antigen-binding fragment thereof is for diagnosis or for treatment, the size and location of the area to be treated, the precise nature of the antibody or antigen-binding fragment thereof, e.g., whole antibody, Fab, or scFv fragment, and the nature of any detectable label or other molecule attached to the antibody or antigen-binding fragment thereof.
  • a typical dose of a whole antibody for example, can be in the range 100 ⁇ g to 1 g/kg body weight for systemic applications.
  • the term "subject" or "patient” refers to any animal, including, but not limited to, mammals.
  • mammalian refers to any vertebrate animal that suckle their young and either give birth to living young (eutharian or placental mammals) or are egg-laying (metatharian or nonplacental mammals).
  • mammalian species include, but are not limited to, humans and other primates, including non-human primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats (including cotton rats) and guinea pigs; birds, including domestic, wild and game birds such as chickens, turkeys and other gallinaceous birds, ducks, geese, and the like.
  • the subject is a human.
  • the invention provides an antibody or antigen-binding fragment thereof as defined in any of the embodiments herein, or a pharmaceutical composition as defined in any of the embodiments herein, for use in treating and/or preventing a disease or disorder mediated by the proteolytic cleavage of TGF ⁇ R1.
  • the antibodies or fragments of the invention can reduce and/or inhibit proteolytic cleavage of TGF ⁇ R1 as indicated above.
  • such antibodies or fragments can be used to treat and/or prevent diseases or conditions wherein the reduction and/or inhibition of proteolytic cleavage of TGF ⁇ R1 in a subject is desired.
  • Treatable diseases or conditions include any in which proteolytic cleavage of TGF ⁇ R1 plays a role, e.g., fibrotic disease, cancer, an immune-mediated disease, and wound healing (such as keloid).
  • the present antibodies or antigen-binding fragments thereof are useful to treat and/or prevent a disease and condition resulting directly or indirectly from proteolytic cleavage of TGF ⁇ R1.
  • the terms “treat”, “treatment” and “treating” refer to the reduction or amelioration of the progression, severity, and/or duration of a disease or disorder mediated by the proteolytic cleavage of TGF ⁇ R1 (e.g.
  • the proteolytic cleavage of TGF ⁇ R1 is in a region comprising amino acid residues 126 to 133 of TGF ⁇ R1, such as a region which corresponds to amino acid residues 126 to 133 of human TGF ⁇ R1 (SEQ ID NO: 1), as described above.
  • the invention provides a method of treating and/or preventing a disease or disorder mediated by the proteolytic cleavage of TGF ⁇ R1 in a subject, the method comprising administering an antibody or antigen-binding fragment thereof as defined in any of the embodiments herein, or a pharmaceutical composition as defined in any of the embodiments herein to the subject.
  • the skilled person could determine whether a cancer was mediated by the cleavage of TGF ⁇ R1 by demonstrating the presence of nuclear TERI-ICD by immunohistochemistry performed on a sample to be tested, in situ PLA performed on a sample to be tested, or by detecting cleaved TERI-ICD by immunoblotting performed on a sample to be tested, such as from a cancer.
  • Methods of treatment comprise administering an antibody or antigen-binding fragment thereof, or pharmaceutical composition comprising the antibody or antigen-binding fragment thereof to a subject.
  • the dose for a single treatment of an adult patient may be adjusted proportionally for children and infants, and also adjusted for other antibody formats in proportion to molecular weight and activity.
  • Treatments may be repeated at daily, twice-weekly, weekly, monthly or other intervals, at the discretion of the physician. Treatment may be periodic, and the period between administrations is about two weeks or more, preferably about three weeks or more, more preferably about four weeks or more, or about once a month.
  • the invention provides the use of an antibody or antigen-binding fragment thereof as defined in any of the embodiments herein, or a pharmaceutical composition as defined in any of the embodiments herein, in the manufacture of a medicament for treating and/or preventing a disease or disorder mediated by the proteolytic cleavage of TGF ⁇ R1.
  • the disease or disorder is cancer.
  • cancer include prostate cancer, mouth cancer, renal cancer, kidney cancer, bladder cancer, breast cancer, lung cancer, endometrial cancer, stomach cancer, brain cancer, and colorectal cancer, and recurrences or metastases of such tumors.
  • Types of renal cancer include adrenocortical carcinoma.
  • Types of brain cancer include brain lower grade glioma.
  • Types of stomach cancer include gastric carcinoma.
  • Types of kidney cancer include clear cell renal cell carcinoma (ccRCC).
  • Types of breast cancer include triple negative breast cancer.
  • Types of prostate cancer include castration-resistant prostate cancer.
  • Types of mouth cancer include oral squamous cell carcinoma.
  • the cancer is prostate cancer, optionally castration-resistant prostate cancer.
  • the cancer is colorectal cancer.
  • the cancer is oral squamous cell carcinoma.
  • the disease is fibrosis.
  • Non-limiting examples of fibrotic diseases include glomerulonephritis, neural scarring, dermal scarring, pulmonary fibrosis, lung fibrosis, radiation induced fibrosis, hepatic fibrosis (such as NASH), myelofibrosis), burns, immune mediated diseases, inflammatory diseases (including rheumatoid arthritis), transplant rejection, cancer, Dupuytren's contracture, atherosclerosis and gastric ulcers.
  • at least one further therapeutic agent is administered to the subject.
  • the term “therapeutic agent” refers to any agent that can be used in the treatment, management or amelioration of a disease or disorder mediated by the proteolytic cleavage of TGF ⁇ R1 and/or a symptom related thereto.
  • the term “therapeutic agent” refers to any antibody of the invention.
  • the term “therapeutic agent” refers to an agent other than an antibody of the invention.
  • a therapeutic agent may be an agent which is known to be useful for, or has been, or is currently being used for the treatment, management or amelioration of a disease or disorder mediated by the proteolytic cleavage of TGF ⁇ R1 or one or more symptoms related thereto. Further therapeutic agents include chemotherapeutic agents such as those described herein.
  • the invention provides a method of identifying an agent for use in treating and/or preventing a disease or disorder mediated by the proteolytic cleavage of TGF ⁇ R1, the method comprising: providing TGF ⁇ R1 or a portion or variant thereof, said portion or variant comprising amino acid residues 126 to 133 of TGF ⁇ R1; providing a candidate agent; and determining whether the candidate agent reduces and/or inhibits proteolytic cleavage of TGF ⁇ R1, or said portion or variant thereof, wherein proteolytic cleavage of TGF ⁇ R1 is in a region comprising amino acid residues 126 to 133 of TGF ⁇ R1.
  • the method comprises selecting the candidate agent for further investigation.
  • the identified agent is one that reduces the level of proteolytic cleavage of TGF ⁇ R1 by at least 10%, 20%, 30%, 40% or 50% compared to the level of proteolytic cleavage of TGF ⁇ R1 in the absence of the agent, or the identified agent is one that reduces the level of proteolytic cleavage of TGF ⁇ R1 by at least 70%, 80%, 90%, 95% or 99% compared to the level of proteolytic cleavage of TGF ⁇ R1 in the absence of the agent.
  • the identified agent is one that reduces the level of proteolytic cleavage of TGF ⁇ R1 to an undetectable level, or eliminates proteolytic cleavage of TGF ⁇ R1 compared to the level of proteolytic cleavage of TGF ⁇ R1 in the absence of the agent.
  • the candidate agent may be any of an antibody, a peptide, a peptidomimetic, a natural product, a carbohydrate, an aptamer or a small organic molecule.
  • the TGF ⁇ R1 or a portion or variant thereof comprises a TACE and/or PS1 cleavage site.
  • the identification of an agent that reduces and/or inhibits proteolytic cleavage of TGF ⁇ R1, or said portion or variant thereof may be an initial step in a drug screening pathway, and the identified agents may be further selected e.g. for the ability to prevent translocation of the TGF ⁇ R1-ICD to the nucleus and/or to inhibit tumour growth.
  • the method may further comprise the step of testing the candidate agent in an assay as described herein and/or testing the candidate agent for efficacy in an animal model of cancer.
  • the antibody or fragment of the invention may be used as a positive control, i.e. used as positive control that does reduce and/or inhibit proteolytic cleavage of TGF ⁇ R1.
  • the candidate agent is tested for efficacy in an animal model of cancer.
  • the cancer is one which is mediated by the proteolytic cleavage of TGF ⁇ R1.
  • the invention may comprise the further step of synthesising and/or purifying the identified agent.
  • the invention may further comprise the step of formulating the agent into a pharmaceutically acceptable composition.
  • the invention provides the use of antibody or antigen-binding fragment thereof as defined in any of the embodiments herein to reduce and/or inhibit proteolytic cleavage of TGF ⁇ R1; and/or to reduce and/or inhibit the translocation of the intracellular domain (ICD) of TGF ⁇ R1 to the nucleus of a cell.
  • ICD intracellular domain
  • the invention provides a kit comprising an antibody or antigen- binding fragment thereof as defined in herein, or a pharmaceutical composition as defined herein.
  • a kit comprising an antibody or antigen-binding fragment thereof is provided.
  • the antibody or antigen-binding fragment thereof may be labelled to allow its reactivity in a sample to be determined.
  • Kits may be employed in diagnostic analysis.
  • a kit may contain instructions for use of the components.
  • kits contain a further therapeutic agent.
  • the kit contains components for detecting biomarkers that specifically determine the activation status of the non-canonical TGFER1 pathway in cells.
  • Protein biomarkers can be detected, for example, by ELISA or in situ PLA.
  • the detection of RNA biomarkers can be detected by qRT-PCR, digital PCR or droplet PCR.
  • An example of such an assay is in situ PLA for the detection of nuclear T ⁇ RI in complex with APPL as described in Song et al., Oncotarget, 2016 Jan 5;7(1):279-92.
  • the invention provides a nucleic acid molecule comprising a nucleotide sequence encoding the antibody or antigen-binding fragment thereof as defined herein.
  • the invention provides a nucleic acid molecule that comprises a nucleotide sequence encoding any of the antibodies or fragments as described herein.
  • the nucleic acid may be RNA, DNA or cDNA.
  • the nucleic acid may be in an essentially isolated, or purified form.
  • an “isolated” nucleic acid molecule we include the meaning of one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule.
  • nucleic acid molecule such as a cDNA molecule
  • a cDNA molecule can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • polynucleotide nucleotide
  • nucleic acid nucleic acid molecule
  • other similar terms are used interchangeably and include DNA, RNA, mRNA etc.
  • the invention provides a nucleic acid comprising a nucleotide sequence that encodes an antibody or antigen-binding fragment thereof that specifically binds to transforming growth factor beta receptor I (TGF ⁇ R1), wherein the nucleotide sequence comprises a HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and/or LCDR3 sequence that is at least 80, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical or is 100% identical to a HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 sequence in the sequence listing table (Table 20), such as the HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and/or LCDR3 sequence of any of antibodies YU772-F11, or YU772-G12, or YU771-A01, or YU772- D10, or YU771-E01, or YU771-B12, or YU772-G04-VH/
  • nucleic acid molecules comprising nucleotide substitutions wherein each substitution produces no amino acid change or produces a conservative amino acid change (i.e. the nucleotide substitution is a synonymous substitution) in the corresponding protein sequence.
  • the nucleic acid molecule comprises a nucleotide sequence that is at least 80% identical to the sequence of SEQ ID NO: 3 and/or a nucleotide sequence that is at least 80% identical to the sequence of SEQ ID NO: 11.
  • the nucleic acid comprising a nucleotide sequence that encodes an antibody or antigen-binding fragment thereof that specifically binds to transforming growth factor beta receptor I (TGF ⁇ R1), comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical or is 100% identical to a heavy chain variable region defined in the sequence listing, such as the heavy chain variable region of any of antibodies YU772-F11, or YU772-G12, or YU771-A01, or YU772-D10, or YU771-E01, or YU771-B12, or YU772-G04-VH/YU771-A09VL, or YU772-H05, or YU772-D10VH/YU772-C01VL, or YU772-A11, or antibody 19.
  • TGF ⁇ R1 transforming growth factor beta receptor I
  • the nucleic acid comprising a nucleotide sequence that encodes an antibody or antigen-binding fragment thereof that specifically binds to transforming growth factor beta receptor I (TGF ⁇ R1), comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical or is 100% identical to a light chain variable region defined in the sequence listing, such as the heavy chain variable region of any of antibodies YU772-F11, or YU772-G12, or YU771-A01, or YU772-D10, or YU771-E01, or YU771-B12, or YU772-G04-VH/YU771-A09VL, or YU772-H05, or YU772-D10VH/YU772-C01VL, or YU772-A11, or antibody 19.
  • TGF ⁇ R1 transforming growth factor beta receptor I
  • nucleic acid molecules wherein the first nucleic acid molecule comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical or is 100% identical to a heavy chain variable region (VH) defined in the sequence listing, such as the VH of any of antibodies YU772-F11, or YU772-G12, or YU771-A01, or YU772-D10, or YU771-E01, or YU771-B12, or YU772-G04- VH/YU771-A09VL, or YU772-H05, or YU772-D10VH/YU772-C01VL, or YU772-A11, or antibody 19, and the second nucleic acid molecule comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical or is 100% identical to a heavy chain
  • the nucleic acids of the invention are prepared or obtained in a manner known in the art (for example by automated DNA synthesis and/or recombinant DNA techniques) on the basis of the information relating to the amino acid sequences of the polypeptides of the invention provided herein and/or can be isolated from a suitable natural source.
  • the invention provides a vector comprising the nucleic acid molecule as defined herein.
  • the nucleic acids of the invention may be in the form of a vector, such as a plasmid, cosmid or YAC.
  • the vector can be of any type, for example a recombinant vector such as an expression vector.
  • Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator sequences, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate.
  • Vectors may be plasmids, viral e.g. ‘phage, or phagemid, or adenoviral, AAV, lentiviral, etc. as appropriate.
  • Many known techniques and protocols for manipulation of nucleic acid for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are known in the art.
  • the nucleic acid molecule and the expression vector may be used in the treatment aspects of the invention via a gene therapy approach using formulations and methods described below and known in the art.
  • the invention provides a host cell comprising the nucleic acid as defined herein or the vector as defined herein.
  • the invention relates to a host cell that expresses or is capable of expressing one or more antibodies or antigen-binding fragments thereof that specifically binds to transforming growth factor beta receptor I (TGF ⁇ R1); and/or contains a vector of the invention, and/or a nucleic acid of the invention.
  • TGF ⁇ R1 transforming growth factor beta receptor I
  • the host cell is a bacterial cell; other useful cells are yeast cells, fungal cells or mammalian cells.
  • Suitable bacterial cells include Gram-negative bacteria such as Escherichia coli (e.g. BL21), Proteus and Pseudomonas and Gram-positive bacteria such as Bacillus, Streptomyces, Staphylococcus and Lactococcus.
  • Suitable fungal cells include cells from species of the genus Trichoderma, Red-headed mould and Aspergillus.
  • Suitable yeast cells include Saccharomyces genus (e.g. Saccharomyces cerevisiae), Schizosaccharomyces genus (e.g.
  • Pichia genus e.g. Pichia pastoris, Pichia methanolica
  • Hansenula species Suitable mammalian cells include, for example, HEK293 cells, CHO cells, BHK cells, HeLa cells, COS cells and the like.
  • amphibian cells, avian cells, insect cells, plant cells and any other cells used by those skilled in the art for the expression of heterologous proteins can be used.
  • plant cells include Physcomitrium patens. Methods for introducing nucleic acid molecules into a host cell may employ any available technique.
  • suitable techniques may include calcium phosphate transfection, DEAE-Dextran, electroporation, liposome-mediated transfection and transduction using retrovirus or other virus, e.g. vaccinia or, for insect cells, baculovirus.
  • Introducing nucleic acid in the host cell, in particular a eukaryotic cell may use a viral or a plasmid-based system.
  • the invention provides a method of producing an antibody or antigen-binding fragment thereof as defined herein, the method comprising expressing a nucleic acid molecule as defined in any embodiment herein, optionally comprising culturing the host cell as defined herein, and further optionally comprising isolating the antibody or antigen-binding fragment thereof from the host cell.
  • the invention provides an antibody or antigen-binding fragment thereof, pharmaceutical composition, method, use, kit, nucleic acid molecule, vector or host cell substantially as described herein, with reference to the accompanying description, examples and drawings. The present invention will now be described with reference to the following non-limiting Figures and Examples. BRIEF DESCRIPTION OF THE DRAWINGS Fig.
  • Fig. 1 Shows the periplasmatically expressed scFvs from individual clones 11 to 20, screened for binding against the recombinant TGFbR1-ECD-133-myc(His)6 and TGFbR1-ECD-125-myc(His)6 as well as TGFbR1 derived peptides spanning from amino acid 106-120 and 106-125 of SEQ ID NO. 1.
  • Fig. 2. Shows a graph illustrating a concentration dependent inhibition of translocation of T ⁇ RI-ICD to the nucleus of human castration-resistant prostate cancer (PC-3U) cells.
  • Fig.3 Shows a graph illustrating the inhibition of TGF ⁇ -induced invasion of PC-3U cells by the chimeric mouse mAb#19.
  • Fig.4 Shows the determination of the dissociation constant (Kd) of the chimeric mouse antibody #19 against the recombinant human TGFbRI-ECD133-myc(His)6.
  • Chimeric murine mAb#19 was loaded at 200 nM (Run1), 100 nM (Run2), 50 nM (Run3), 20 nM, (Run4) and chimeric murine mAb#19 at 100 nM in absence of immobilized TGFbR1- ECD133-myc(His)6 (Run5) was used as a reference.
  • Fig. 5 Shows the determination of the equilibrium dissociation constant (Kd) of the chimeric mouse antibody #19 against human TGFbRI-133-huFc.
  • Murine control antibody (#4-4-20 with specificity for fluorescein) was loaded at 200 nM (Run1), chimeric murine mAb#19 at 200 nM (Run2), 100 nM (Run3), 50 nM (Run4), 25 nM, (Run5).
  • Run 1 had been used as a reference for the Kd analysis
  • Run 6 murine control antibody (#4-4-20 with specificity for fluorescein) at 400 nM (Run6) had not been included in the analysis.
  • Fig. 6 Shows a graph illustrating the concentration dependent inhibition (IC 50 ) of translocation of T ⁇ RI-ICD to the nucleus of PC-3U cells.
  • FIG. 7 Shows a table over the alignment of the c-terminal human and murine Alk5 sequences (aa 101 to 147) derived from the recombinant proteins that were tested for epitope mapping.
  • the single point amino acid mutation in each construct is depicted in bold.
  • Fig. 8A-D Shows binding of the murine chimeric mAb#19 against titrated amounts of recombinant TGFbRI mutants, wherein the Alanine was mutated at positions 127 (A), 128 (B) and 131 (C).
  • the results for the obtained affinities for the single mutations are summarized in the table in (D).
  • FIG. 10A-B Shows the amino acids that define the epitope of the murine chimeric mAb#19, as determined by binding to the recombinant ECD. (Fig. 8 and Fig. 9) mutations.
  • Figure 10B Epitope mapping for the mAb #19 and #F11 with alignment of the human ECD-TGFbR1 protein sequences from aa 1 to 147.
  • A represents the time scale from 0 to 72 hours post-dose, whereas (B) represent the full-time course of the study.
  • A represents the time scale from 0 to 72 hours post-dose, whereas (B) represent the full-time course of the study.
  • FIG. 12A-D Show graphs illustrating the effects on tumor growth (A, C), lymph nodes (B), and lymph node metastases (D) upon treatment with murine chimeric mAb#19 in a human PC3U orthotopic prostate cancer model.
  • FIG. 13A-B Show histology sections from tumor tissues and regional lymph nodes treated from mice treated with the murine chimeric mAb#19.
  • Fig. 14A-B In situ PLA to visualize nuclear complex formation of TGFbRI-ICD (by detection of C-terminal HA tag) and p300 (detected by anti-HA and goat polyclonal anti-p300 (R&D Cat.
  • Fig. 15 Shows the plasma concentrations of mouse mAb#19 in blood measured by Mass Spectroscopy at the end of treatment period which lasted 30 days. Blood sample was withdrawn from the mice 72 h after the last intraperitoneal injection.
  • Fig. 17A-B Show mAb#19 binding to its endogenous target in PC-3U (A) and RWPE (B) cells, respectively.
  • FIG. 18 Shows IC50 determination of the (A) murine chimeric mAb#19 and the (B) fully human mAb#19 (carrying the LALA mutation) against recombinant human TGFbRI ECD-133-myc-(His)6 protein.
  • Fig. 19A-B Shows concentration dependent inhibition of translocation of T ⁇ RI-ICD to the nucleus in PC3U cells treated with different concentrations of human mAb#19- IgG1-LALA or chimeric mAb#19-IgG1.
  • Fig. 19A-B Shows concentration dependent inhibition of translocation of T ⁇ RI-ICD to the nucleus in PC3U cells treated with different concentrations of human mAb#19- IgG1-LALA or chimeric mAb#19-IgG1.
  • A-B PC-3U cells were treated with different antibodies (#4, #16, #19) or Lily compound (Ly; Galunisertib) in the indicated concentrations, with or without TGF-beta stimulation for 6 hours.
  • Graphs are means+SEM from three independent experiments. The intensity of immunoblots was measured and the ratio of pSmad2/total Smad2 are regarded as normalized signal of pSmad2.
  • Student t test * between different sets of samples (TGF-beta-stimulated versus unstimulated cells) . ** P ⁇ 0.01, *** P ⁇ 0.001. ⁇ within one set of experiments (Lily compound treated versus untreated cells). ⁇ ⁇ 0.01, ⁇ P ⁇ 0.001.
  • Figure 21A and B Staining of TGFERI in PC3U cells. Selected antibody candidates were used for staining of TGFERI in PC3U cells. PE geometrical mean fluorescence intensity (MFI) (linear scale) is plotted against corresponding concentrations of antibody candidates (log scale).
  • Figure 22 Evaluation of the inhibitory effect of affinity matured antibodies on the generation of nuclear TERI-ICD in complex with p300.
  • MDA MB-231 cells were treated with mAb #F11 (200nM), mAb#A19 (200nM), ctrl mAb Pavilizumab (200nM) and Galunisertib (10 ⁇ M).
  • mAb#F11, A19 and Pavilizumab carry the same Fc silencing mutations as described.
  • TGF- ⁇ 1 After 1hr, cells were treated with TGF- ⁇ 1 for 24 h. Bar graphs represent optical density (OD) of invaded cells measured at 560nm. Error bars represent means ⁇ SEM from three independent experiments, ⁇ P ⁇ .005, *P ⁇ .05 (student t-test).
  • Figure 24 In situ PLA assay to show the number of nuclear T ⁇ RI-ICD in complex with p300 in human prostate cancer (PC3U) cells treated as indicated. mAb#19 was more effective than mAb#4 and antibody 82.18 to prevent generation of nuclear T ⁇ RI-ICD. Error bars represent means ⁇ SEM from three independent experiments, *** P ⁇ .001, (student t-test).
  • Figure 25 The amino acid sequence of human ALK5 with the transmembrane region depicted in bold. The arrows labelled as 1 and 2 show where recombinant ALK5 was cleaved by recombinant TACE. The first cleavage site (arrow 1) was between amino acid A and A.
  • FIG. 26 A: Schematic representation of the recombinant TGFbRI-ECD-133- myc(His) 6 protein with the point mutations depicted at amino acid position 128.
  • B SDS-PAGE (12% in MES buffer) of the recombinant TGFbRI-ECD-133-myc(His)6 proteins (wt, A128G-, A128I-mutations) in absence and presence of TACE.
  • the recombinant wt TGFbRI-ECD-133-myc(His) 6 protein is cleaved by TACE.
  • Lane 1 wt TGFbRI-ECD-133-myc(His)6 protein after overnight incubation at 24°C with the TACE enzyme. The apparent molecular weight corresponds to the calculated molecular weight of 10,981 Da after cleavage at amino acid position 128 (A).
  • Lane 2 the wild type TGFbRI-ECD-133-myc(His) 6 protein after overnight incubation at 24°C in absence of the TACE enzyme. The apparent molecular weight corresponds to the calculated molecular weight of 13,658 Da.
  • Lane 3 molecular mass ladder (Cat#26616, ThermoFisherScientific)
  • Lane 4 the TGFBRI-ECD-A128G-133-myc(His)6 protein after overnight incubation at 24°C with the TACE enzyme.
  • Lane 5 the TGFBRI-ECD-A128G-133-myc(His) 6 protein after overnight incubation at 24°C in absence of the TACE enzyme.
  • Lane 6 molecular mass ladder (Cat#26616, ThermoFisherScientific)
  • Lane 7 the TGFBRI-ECD-A128I-133-myc(His)6 protein after overnight incubation at 24°C with the TACE enzyme.
  • Lane 8 the TGFBRI-ECD-A128I-133-myc(His) 6 protein after overnight incubation at 24°C in absence of the TACE enzyme.
  • Lane 9 molecular mass ladder (Cat#26616, ThermoFisherScientific)
  • Figure 27 Prostate cancer tumors and lymph nodes in mice injected with prostate cancer cells after treatment with 50 mg/kg control (ctrl) mAb, 50 mg/kg mAb19, 50 mg/kg mAbF11 and 10 mg/kg mAbF11, respectively. Representative picture of prostate cancer tumors after treatments (figure a).
  • the different treatments didn’t affect the weight of mice compared to Ctrl mAb 50 mg/kg (figure g).
  • FIG. 28 TGF ⁇ R1 expression in mCRPC tumors after treatment with mAb 19 50 mg/kg, F11 mAb (10 or 50 mg/kg) or control mAb (50 mg/kg)
  • Treatment with 50 mg/kg mAb 19 or 50 mg/kg mAb F11 showed no difference in medium expression of Ki67.
  • FIG. 29 Size and volume of prostate tumors after treatments with F11 mAb (3/10/30 mg/kg I.P twice a week) or control mAb (30 mg/kg I.P twice a week). Representative figure, showing prostate tumors after treatments (figure a). Volume of prostate tumors were measured after these treatments.
  • FIG. 30 TGF ⁇ R1 expression in mCRPC tumours after treatment with F11 mAb (3/10/30 mg/kg) or control mAb (30 mg/kg)
  • Figure 33 Experimental phase schedule Figure 34: (a) Pictures of the wound healing assay at T0, T0+4h, T0+24h, T0+48h and T0+72h of Control, Galunisertib, CTL Ab at 50, 100 and 200 nM and CDD Ab at 50, 100 and 200 nM conditions (without TGF ⁇ 1 stimulation). (b) Pictures of the wound healing assay at T0, T0+4h, T0+24h, T0+48h and T0+72h of TGF ⁇ 1, Galunisertib, CTL Ab at 50, 100 and 200 nM and CDD Ab at 50, 100 and 200 nM conditions with TGF ⁇ 1 stimulation).
  • Figure 35 Mean normalized percentage of area compared to T0 area
  • Figure 36 HCT116 cells from ATCC were cultured on to the sterile coverslips in Mc Coy ⁇ s 5A medium. Cells were starved in media containing 1% FBS for 16 hrs and then stimulated with TGF ⁇ (10ng/ml) at indicated time points 0hr, 3hrs 6hrs and 24 hrs.
  • Figure 37 Immunohistochemical analysis of TbRI expression in tissue sections derived from OSCC. Expression of TbRI was analyzed by IHC using Capra C 1183 antibody. The indicated areas (within black boxes) are shown in higher magnifications in the lower panel. Scale bar is 50 micrometer.
  • Figure 38 Histological and immunohistochemical analysis of TbRI expression in OSCC.
  • the cells were seeded on Matrigel to form organoids, and then the organoids were treated in the following conditions for 48h: Ctr Ab (100 nM); Ctr Ab (100 nM + TGF ⁇ 1 (10ng/ml); F11 Ab (100 nM) + TGF ⁇ 1 (10ng/ml); LY2109761 (10ng/ml) + TGF ⁇ 1 (10ng/ml).
  • Black arrowheads show budding of tumor cells into Matrigel as a response to TGF ⁇ 1 stimulation in the presence of an isotype specific control antibody (control Ab 100 nM).
  • B. Tumour budding or satellite clones sprouting from the primary PDOs were counted as sprouting ratio.
  • the vector backbone was separated from the 215 insert by separation in a 1 % agarose gel and isolated by usage of the “Gel extraction and PCR clean up kit” from Machery- Nagel (Düren, Germany).
  • a reaction was composed consisting of 5 ⁇ l of 10 x buffer, 100 ng of the plasmid pcDNA3-TGFbRI-HA (encoding the entire TGFbRI gene (SEQ ID NO: 1)) and ⁇ l of 2 mM dNTPs mix and 1 ⁇ l of polymerase, 1.5 ⁇ l of the sense primer S-huTbRI-NcoI-QVQ9-pOPE (gaataggccatggcgcaggtgcaggcgttacagtgtttctgccac) (SEQ ID NO: 231) and 1.5 ⁇ l of the antis
  • the sense primer S-murineTbRI-NcoI-1-pOPE gaatagg gcc atg gcg acg ctg ctc ccg ggg gcg was combined with the human antisense primer AS-huTbRI- 133BamHI-pOPE in presence of a synthetic plasmid covering the murine ECD (R&D Systems, #RDC0709).
  • the PCR reaction were performed with 5 min denaturation at 96 °C, followed by 32 cycles of 15 seconds denaturation at 96 °C, 20 seconds annealing at 62 °C, 30 seconds extension at 72 °C and lastly one extension at 72 °C for 5 min.
  • the PCR product was purified by usage of a 1% agarose gel as described for the vector preparation. 2 ⁇ g of the gel-purified PCR fragment was cut with NcoI and BamHI for 2 hours at 37 °C. The cut PCR fragment was subjected to column purification according to the kit instructions.
  • 25 ng of the purified PCR fragments were ligated with 200 ng of the appropriate prepared pOPE101 plasmid and ligation occurred over-night at 4 °C in ligation buffer and 1 ⁇ l of ligase (T4 DNA ligase, ThermoFisher Scientific). 7 ⁇ l of the ligation mix was transformed into heat shock competent XL10 Gold bacteria (Stratagene, USA) and plated on selective LB-GAT plates (0.1 M glucose, 100 ⁇ g/ml ampicillin, 12 ⁇ g/ml tetracycline) and incubated over-night at 37 °C. A single colony was picked and an over-night culture was started in selective LB-GAT medium.
  • the pOPE101vector was isolated by usage of a plasmid isolation kit and the insert sequenced by usage of the sequencing primer (attaaagaggagaaattaacc) (SEQ ID NO: 235).
  • the plasmid pOPE101 encoding the myc and (His)6 tagged TGFERI gene was transformed into E. coli XL10 Gold (Stratagene, USA) and transformants were selected for on LB agar plates containing 100 ⁇ g/ml carbenicillin, 12.5 ⁇ g/ml tetracycline and 0.1 M glucose as a repressor.
  • the suspension was centrifuged at 30,000 g for 1 hour at 4 °C and the supernatant, representing the periplasmatic extract, was dialyzed twice overnight against 5 liters of PBS at 4 °C.
  • the solution was passed through a 0.45 ⁇ m filter and adjusted to 0.5 M NaCl and 20 mM imidazole for loading on a Ni-NTA FPLC- column (GE-Healthcare, USA).
  • the (His)6-tagged protein was eluted with elution buffer (PBS adjusted to 0.5 M NaCl and 0.5 M imidazole) and protein-containing fractions were dialyzed twice overnight against 2 liters of PBS at 4 °C. Aliquots were adjusted to 1 mg/ml with PBS and stored at – 80 °C. Purity and integrity of the protein was confirmed by Coomassie-gel staining and immunoblot using the c-Myc tag specific mAb 9E10.
  • the 81 nt oligonucleotides Avi-cassette-cs (GATCCGGAGGTAGTGGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAACA TCATCACCACCATCACTAAT) (SEQ ID NO: 236) and Avi-cassette-ncs (CTAGATTAGTGATGGTGGTGATGATGTTCGTGCCATTCGATTTTCTGAGCCTCGAAGATGTC GTTCAGACCACTACCTCCG) (SEQ ID NO: 237) were synthesized by Sigma-Aldrich.
  • the bacterial strains used were XL10-Gold Ultracompetent Cells and Stratagene 200314d- Biotin was from Supelco 4-7868100 mg (Sigma-Aldrich).
  • a plasmid construct for expression of ECD (amino acids 33-133 in TGFbR1) fused to an Avi-His tag in E. coli was constructed by inserting a codon optimized construct with a C-terminal Avi- 6xHis tag into the vector pOPE101. The two oligos were annealed and ligated into a BamHI + Nhe1 digested vector and the mixture used to transform XL 10 Gold bacteria, colonies were screened, and a correct clone was isolated. 1.4 Expression of a protein of the expected size was verified by Western blot.
  • Biotinylated ECD of TGFbR1 was obtained by co-expression of the biotin ligase, BirA, and purification using Ni-NTA affinity chromatography. The degree of biotinylation was determined using a biotin quantification kit.
  • 1.5 Peptides The peptide 4095-272 consisting of Biotin-SGSGPGLGPVELAAVIAGP-NH2 (SEQ ID NO: 238) which includes aa’s 119-133 of the TGFERI was synthesized by Bachem AG, Switzerland.
  • Phage display was performed to enable isolation of scFv fragments with specificity for the extracellular domain of human TGFER1.
  • 2.1 Phage display selection Biopanning was performed using four selection rounds of enrichment employing two human synthetic scFv phage libraries, SciLifeLib1 and SciLifeLib2 (SciLifeLab, Sweden). SciLifeLab 1 and 2 are naive human synthetic scFv libraries, similar in design and construction to previously reported libraries (Säll, et al., Protein Eng Des Sel (2016) 29: 427-437).
  • human germline genes IGHV3-23 and IGKV1-39 were used as library scaffold and Kunkel mutagenesis was used to introduce diversity into four of the six complementarity determining regions (CDR); namely CDR- H1, CDR-H2, CDR-H3 and CDR-L3.
  • CDR complementarity determining regions
  • the selection was performed using biotinylated ECD 33-133-Avi-(His)6 (aa 33-133, see Example 1 for details) and streptavidin-coated magnetic beads (Dynabeads M-280, ThermoFisher Scientific, #11206D).
  • the selection pressure was increased by gradually decreasing the antigen amount (33-177 nM) and by increasing the number of washes between the different rounds.
  • pre-selection was performed by incubation of the phage stocks against empty streptavidin coated magnetic beads prior to round 1 and 2. Also, 1 % bovine serum albumin (BSA) was included as blocking agent throughout the selection procedure. Elution of antigen-bound phages was performed using a trypsin-aprotonin approach. Recovered phages were propagated in XL1 Blue E. coli, either on agar plates at 37 °C overnight (Rounds 1 and 2) or in solution at 30 °C overnight (Rounds 3 and 4).
  • BSA bovine serum albumin
  • Phage stocks were made by infecting with an excess of M13K07 helper phage (New England Biolabs, # N0315S) and scFv display induced by the addition of IPTG. The overnight cultures were PEG/NaCl-precipitated, resuspended in selection buffer and used for the next round of selection. 2.2 Re-cloning and expression of scFv To allow production of soluble scFv, phagemid DNA from the third and fourth round of each selection track was isolated.
  • the genes encoding the scFv fragments were restriction enzyme digested and sub-cloned into screening vector pHAT-6, providing a signal for secretion of the scFv along with a triple-FLAG tag and a hexahistidine (His6) tag at the C-terminus.
  • the constructs were subsequently transformed into TOP10 E. coli. Single colonies were picked, cultivated and IPTG- induced for soluble scFv expression in 96-well format. In total, 278 scFv clones present in bacterial supernatant were prepared for a primary ELISA screen.
  • Example 3 Affinity characterization of selected scFv This example describes the experiments that allowed selection of 8 of the 17 clones to progress.
  • the 17 unique scFv clones from Example 2 were selected for further characterization by ELISA and biolayer interferometry (BLI) in a kinetic screen-based approach to enable ranking of the different clones.
  • 3.1 Expression and purification of scFv Expression of the 17 scFv were carried out in TOP10 E. coli cells. 50 ml cultures were started and protein expression induced at exponential phase by the addition of isopropyl thiogalactoside (IPTG) overnight at 30°C.
  • IPTG isopropyl thiogalactoside
  • Table 3 The binding signals of selected scFv were assayed by ELISA and biolayer interferometry (BLI); “+++” strong, “++” less strong, “+” minor “-“ no binding was detected.
  • Periplasmatic scFvs from individual clones here shown clone 11 to 20; Fig.
  • TGFbR1-ECD-133-myc(His)6 dark bars
  • TGFbR1-ECD-125-myc(His)6 grey bars
  • TGFbR1 derived peptides spanning from amino acid 106-120 (checked bar) and 106-125 (dashed bar).
  • Wells were coated with coating buffer only as negative control (empty bar).
  • ScFv clone 19 showed binding toward the recombinant TGFbR1 protein ending at amino acid 133 but lacks binding against the shorter version ending at amino acid 125. None of the control peptides were bound.
  • Example 4 IgG conversion of eight scFvs to IgG and validation of binding
  • eight of the most promising scFv clones from the phage selection (Example 2) and subsequent binding analyses (Example 3) were converted to the mouse IgG1 (mIgG1) subclass; namely B-ML012-4, B-ML012-5, B-ML012-14, B- ML012-15, B-ML012-16, B-ML012-17, B-ML012-19 and B-ML012-20.
  • mice mAb#4, mAb#5, mAb#14, mAb#15, mAb#16, mAb#17, mAb#19 and mAb#20 were given new names in order to better reflect the new format; mouse mAb#4, mAb#5, mAb#14, mAb#15, mAb#16, mAb#17, mAb#19 and mAb#20, respectively.
  • the control antibody had been cloned into the same murine IgG1 framework and is directed against Fluorescein.
  • scFv 8 scFv’s were selected for a first test in cell assays once converted into chimeric murine IgG1 (mIgG1) antibodies. These were: #4, 5, 14, 15, 16, 17, 19 and 20.
  • gene constructs containing the VL region of the scFv of interest were incorporated into the pFUSE-CLIg-mKappa plasmid (Invivogen) containing the constant region of the mouse Kappa chain, using enzymes AgeI/XhoI followed by ligation.
  • the media supernatant was mixed with 1 ml Protein G Sepharose Fast Flow (GE Healthcare, #17-0618-02) at 120 rpm for 1 hour at room temperature, collected on a gravity flow column and washed in 10 ml buffer (20 mM NaH2PO4, 50 mM NaCl, pH 7.4). Immediately following elution in 0.1 M Glycine, pH 2.7, neutralization was performed by addition of 1 M Tris-HCl, pH 8.8, and buffer was exchanged to PBS using spin filters.
  • 1 ml Protein G Sepharose Fast Flow GE Healthcare, #17-0618-02
  • Example 5 Selection of final candidate, B-ML012-19 (ab#19) To further discriminate between the candidates the functional assays described in Examples 5.1-5.3 were performed.
  • ICD intracellular domain of TGF ⁇
  • Materials Following cell lines had been used: (1) the wild type PC3U cell line (androgen independent human prostate carcinoma cell line); (2) A9, an isogenic PC3U cell line in which the TGFER1 expression (in exon2) had been silenced by usage of the CRISPR- Cas9 technique; (3) the A9 cell line in which the full length TGFER1 expression had been reconstituted by transformation with an expression plasmid encoding for a C-terminally, HA-tagged human TGFER1.
  • ICD intracellular domain of TGF ⁇
  • A9 TGF ⁇ RI (CRISPR-Cas9 gene edition) cell line was used to silence TGF ⁇ RI/ALK5 in human prostate cancer (PC3U) cells, thereafter cells were reconstituted with TGF ⁇ RI- HA tag (in C-terminal part of the protein).
  • the A9 cell line was generated by Anders Wallenius.
  • the primary antibodies used were anti-HA rabbit Abs (Cell Signaling Cat.3724) and anti-p300 goat antibody (R&D. Cat. AF3789).
  • the PLA kits used were Duo 92002, Duo92006 and Duo92007 (Sigma).
  • TGF- ⁇ 1 Catalogue number: 100-21, Peprotech Ltd. was applied at a concentration of 10 ng/ml.
  • RPMI1640 medium and FBS was from Sigma and ultrapure water from Sartorius AriumPro UV system.
  • Treatment Abs Murine chimeric #19 Ab: mAb#19; cAb1114-1.1 mouse antibody and control antibody; anti-fluorescein Ab00102-1.1 mIgG1.
  • Methods Step 1 Cell culture 1 st day, A9 (ALK5-HA) reconstituted cells were seeded in an 8-well chamber slide (5x10 4 cells per well) on sterile glass slides. 2 nd day, the cells were starved with medium supplemented with 1 % FBS for 16 h.
  • Step 2 Fixation and permeabilization slides 1. The slides were washed 4 times with PBS and then fixed in 4 % paraformaldehyde (pre-warmed at 37 ° C) for 30 min at room temperature. 2. After 4 times washing with PBS, the slides were permeabilized in 0.1 % Triton X-100 in PBS for 10 min. Step 3 PLA staining was performed according to PLA kits instruction of PLA kits as previously reported [4].
  • Step 4 Collection of images for PLA staining Digital images were taken by using a fluorescence microscope (Axioplan 2, Carl Zeiss) with a digital camera (C4742-95, Hamamatsu), with a X40 objective lens (Carl Zeiss Micro-Imaging). The setting for digital pictures, and PLA analysis were automatically saved as part of the raw data.
  • Step 5 Analysis PLA signaling Analysis of PLA signaling for nuclear T ⁇ RI-ICD in complex with p300 was performed by the use of Duolink Image Tool that was specially developed for quantification of PLA signaling. Positive control used in the experiment: TGF- ⁇ 1 treatment in absence of antibodies, presented as No #190 nM.
  • Negative control used in this experiment Staining without antibodies in presence of or absence of TGF beta (only the A9-cells). All the samples were examined as triplicates.
  • Statistics GraphPad Prism 7 was used for analysis of the half maximal inhibitory concentration value (IC 50 ). A concentration dependent inhibition of translocation of T ⁇ RI to the nucleus is shown in Fig. 2. Relative values for nuclear T ⁇ RI-ICD (as visualized by in situ PLA) in PC3U cells treated with TGF ⁇ 1 and different concentrations of murine chimeric mAb#19 are shown.
  • Antibodies were diluted in the media for the upper and lower chamber
  • Lower chamber Antibodies were diluted directly in 5 % FBS media at 400 nM, 200 nM, 100 nM, 75 nM, 50 nM, and 25 nM (0.75 ml in each well).
  • Upper chamber Abs were diluted in 1 % FBS media at 800 nM, 400 nM, 200 nM, 150 nM, 100 nM, and 50 nM (0.25 ml in each well).
  • Antibodies were added in twofold concentration in the upper chamber at the beginning, whereupon then the same amount of cell suspensions (0.25 ml) was added.
  • Final concentrations of antibodies were 400 nM, 200 nM, 100 nM, 75 nM, 50 nM and 25 nM. 4.
  • the Invasion Chamber was incubated for 1 hours at 37 °C at 5 % CO2. 6.
  • the cells were stimulated with TGF ⁇ 110 ng/ml (Peprotech).
  • Day 4 1. After 30h TGF ⁇ 1 stimulation, the non-invading cells in the upper wells were removed by scrubbing. 2.
  • the inserts were immediately stained with 400 ⁇ l Cell Stain Solution for imaging and quantification. Day 5 The stained cells were dissolved with 200 ⁇ l Extraction Solution, and the OD value at 560 nm was measured.
  • Galunisertib (LY2157299 at 10 ⁇ M). Data are calculated based on the ratio response for control antibody/candidate antibody.
  • AB 4 19 LY2157299 WT (Ctrl) WT TGF ⁇ Assay (6h/24h) ICD 5.5 ⁇ 0.5 6.7 ⁇ 1.4 12.1 ⁇ 2.1 4.5 ⁇ 2.1 23.7 ⁇ 7.1 translocation (in situ PLA (HAab- p300 complex dots/nuclei) Invasiveness* 7.4 ⁇ 0.5 7.7 ⁇ 1.5 - 7.4 ⁇ 0.5 13.7 ⁇ 0.2 (OD*100) Invasiveness** - - 53 ⁇ 13 37 ⁇ 7.6 165 ⁇ 10 (cell count) Table 6: Selected candidates and results of functional assays.
  • SEC Size exclusion chromatography
  • the running buffer was running buffer 150 mM NaxHyPO4, pH 6.8.
  • Samples antibodies were diluted to approximately 0.5 mg/ml in running buffer and 50 ⁇ L was applied to the column. Samples were analyzed on both systems.
  • Samples were 1 and 4 uL of undiluted antibodies with a concentration of 2.5 mg/ml Tm measurement by Differential Scanning Fluorimetry (DSF): For determination of protein melting curves a Prometheus NT.48 (Nanotemper) was used. The signal at wavelengths 350 and 330 nm were recorded, and the 350/330 quote was plotted against temperature. The scan rate was 1 degree/minute, and the protein concentration was 0.5 mg/ml. Chemical denaturation was done using guanidinium hydrochloride (Sigma (G405 Lot#SLBC7059V) and PBS was from Sigma (D8537-500ml Lot RFNB7745).
  • DSF Differential Scanning Fluorimetry
  • the 350 and 330 signals were measured in the Prometheus instrument by running a gradient between 20 and 21 degrees with a step of 0.2 degrees/minute. The average signal was calculated and plotted against the concentration of GmdCl. Samples were incubated with different concentrations of guanidinium hydrochloride, incubated for 1 hour and the A350/330 ratio was determined and plotted against the concentration of guanidinium hydrochloride in the sample to generate a chemical denaturation graph. Results The two candidates mAb#4 and mAb#19 were characterized by biophysical methods above with the aim to find distinguishing characteristics to enable the decision for choosing a preferred candidate.
  • Example 6 Detailed characterization of mAb#19 6.1 Affinity measurement Biacore (SPR) and Blitz 6.1.1 Biacore (Surface Plasmon Resonance, SPR) measurement Material and methods Biotinylation of the chimeric mAb#19 Biotinylation of the chimeric mAb#19 was performed by usage of the EZ-Link Sulfo- NHS-LC-LC-biotin reagent (Cat#21338, Thermo Fisher Scientific).
  • Covalent immobilization of mAB#19 on CM5 chip The immobilization of mAB#19 was carried out on a CM5 chip using a manual run.
  • Antibody was diluted to 25 ⁇ g/ml in 10 mM NaAc buffer, pH 5.0.
  • the surface was activated by an injection of a mixture of EDC/NHS for 7 min, at the flow rate 10 ⁇ l/min.
  • Antibody was injected over the activated surface at the flow rate 2 ⁇ l/min for 30 - 45 sec.
  • the surface was deactivated by the injection of 1M ethanolamine for 7 min at the flow rate 10 ⁇ l/min.
  • the typical immobilization level was around 800 RU.
  • Antigen preparation ECD 133-myc-His(6) was diluted to 100 nM starting concentration in the 1xHBS-P running buffer, followed by a 1:1 serial dilution in the same buffer, resulting in 5-points concentrations, ranging from 100 nM to 6.25 nM.
  • a single cycle kinetics experiment was used. The run parameters were: contact time - 60 sec, dissociation time - 600 sec, start-up cycles - 5, flow rate - 30 ⁇ l/min, blank injections - 2 and a temperature of 25 °C.
  • the surface was regenerated by a 30 sec injection of 146 mM H 3 PO 4 , at the flow rate 30 ⁇ L.
  • ECD 133-myc-His The binding of ECD 133-myc-His to immobilized biotinylated and covalently immobilized non-biotinylated antibodies was validated. A 1:1 binding model analysis was performed to obtain the dissociation constant (Kd) of the interactions. ECD 133- myc-His bound to covalently immobilized mAb#19 with affinities of 5.6 and 6.5 nM, determined by two independent experiments. ECD 133-myc-His was interacting with the immobilized biotinylated mAb #19 similarly as observed for covalently immobilized non-biotinylated antibody and the Kd was determined to be 2.5, 1.8 and 2.3 nM in three independent experiments.
  • Antibody was loaded with 4 ⁇ l at indicated concentrations. As control, measurements were performed at the second highest concentration in absence of the antigen. Immobilization of the antigen occurred with a Biosensor Ni- NTA tip (cat# 18-5101) for the human and murine TGFERI-ECD133-myc(His)6 and with the Biosensor AHC tip (cat#18-5060) for the human TGFERI-133-human Fc protein.
  • A9 cells CRISPR-Cas gene edition was used to silence TGF ⁇ RI/ALK5 in human PC3U cells.
  • A9-ALK5-HA cells HA-tagged C-terminal part of TGF ⁇ RI was reconstituted in A9 cells. Both cell lines were developed in Landström research lab by Anders Wallenius ((Wallenius A., Mu Y., Rudolfsson S., Schmidt A., Zang G. and Landström M. Manuscript in preparation). Both cell lines were used and grown in RPMI1640 medium and 10 % FBS (Sigma).
  • TGF- ⁇ 1 was purchased from Peprotech Ltd. (Cat.
  • Step 1 Cell culture 1 st day, A9-ALK5-HA reconstituted cells were seeded in an 8-well chamber slide (5x10 4 cell per well). 2 nd day, the cells were starved with the medium supplemented with 1 % FBS for 16 h. 3 rd day, the cells were pretreated with #control Fluorescein or mouse mAb#19 Abs for 1 hour, and then were cells stimulated with TGF- ⁇ 110 ng/ml for 6 h. Step 2 Fixation and permeabilization slides 1. The slides were washed 4 times with PBS and then fixed in 4% paraformaldehyde (pre-warmed at 37 o C) for 30 min at room temperature. 2.
  • Step 3 PLA staining followed by the instruction of PLA kits [4].
  • Step 4 Collect images for PLA staining Digital images were taken by using a fluorescence microscope (Axioplan 2, Carl Zeiss) with a digital camera (C4742-95, Hamamatsu), with X40 objective lens (Carl Zeiss MicroImaging).
  • Step 5 Analysis PLA signaling Analysis of in situ PLA signaling for nuclear T ⁇ RI-ICD (via detection of HA tag) in complex with p300, was performed using Duolink Image Tool that was specially developed for quantification of PLA signaling.
  • the two positive controls had the same level of in situ PLA signal. The value is presented as No mAb#19 0 nM.
  • Negative control used in this experiment A9-cells without treatment, but with all the staining Abs, to control the staining background. Concentration dependent inhibition of translocation of T ⁇ RI-ICD to the nucleus is shown in Fig. 6. Relative values for nuclear T ⁇ RI-ICD (as visualized by in situ PLA) in PC3U cell treated with TGF ⁇ 1 and different concentrations of mouse mAb#19 is shown.
  • TGF ⁇ treated cells TGF ⁇ 1 was purchased from Peprotech Ltd.
  • mice mAb#19 e.g., 12.5, 25, 50, 100, 200, 400 nM respectively.
  • Filled circles shows the average for three measurements, non-filled circles are the individual points from the actual concentration.
  • Invasion assay Invasion assays was performed by using the Matrigel Invasion Chamber (Corning, Cat. 354483). The basement membrane layer of the cell culture inserts was rehydrated in 500 ⁇ l serum-free RPMI-1640, and 1 ⁇ 10 5 cells in cell suspensions in 1 % FBS media were seeded into the upper chambers, with or without TGF ⁇ 1.
  • mice mAb#19 from Absolute Antibodies LN T1733A02 and an isotype specific mouse IgG1; catalogue number #MAB001, Clone 11711, Lot number: IX241811A from R&D was used as control).
  • Antibodies were diluted in the media for the upper and lower chamber as following; Lower chamber: Abs were diluted directly in 5 % FBS media at 400 nM, 200 nM, 100 nM, 75 nM, 50 nM, 25 nM, (0,75 ml each well) Upper chamber: dilute Abs in 1 % FBS media at 800 nM, 400 nM, 200 nM, 150 nM, 100 nM, 50 nM, (0,25 ml each well). Note: abs in twofold concentration in the upper chamber at the beginning, and then the same amount of cell suspensions (250 ml) was added.
  • the final concentrations were 400 nM, 200 nM, 100 nM, 75 nM, 50 nM, 25 nM.
  • the media was removed from the inserts. After incubation of the Invasion Chamber for 1 hours at 37 °C with 5 % CO 2 ; cells were the stimulated with TGF ⁇ 1 at 10 ng/ml (Peprotech). After 30h with TGF ⁇ stimulation, the non-invading cells was removed by scrubbing and then the inserts were immediately stained with 400 microliter Cell Stain Solution for image and quantification. The stained cells were solved with 200 ⁇ l Extraction Solution, and the optic density (OD) value was measured at 560 nM adapted from Mu et al., Nature Comms 2011 [4].
  • PC-3U cells were treated with different antibodies or Galunisertib (a small compound inhibitor of kinase activity of TERI/ALK5) in the indicated concentration, with or without TGF-E stimulation for 6 hours.
  • Graphs are means+SEM from three independent experiments. The intensity of immunoblots was measured and the ratio of pSmad2/total Smad2 are regarded as normalized signal of pSmad2.
  • Student t test * between different sets of samples (TGF-E-stimulated versus unstimulated cells). ** P ⁇ 0.01, *** P ⁇ 0.001. & within one set of experiments (lily compound treated versus untreated cells). ⁇ P ⁇ 0.01, ⁇ P ⁇ 0.001.
  • variable heavy chain shows three regions with predicted strong promiscuous T-cell epitopes (binding to several different alleles). In addition to this, the variable heavy chain shows a high number of T-cell epitopes with scores 4-5, i.e., weaker epitopes but still with a relevant score.
  • the mAb#19 variable light chain contains two regions with promiscuous T-cell epitopes. The pattern of many weak T-cell epitopes is not seen in the light chain. Conclusion Both the variable light and heavy chains of mAb#19 were assessed for immunogenicity.
  • mAb#19 has a signal for potentially inducing antidrug antibodies (ADAs). However, it is ranked similar as Avastin, which is known to have a low immunogenicity in the clinic.
  • the single amino acid substitution within the ECD of the recombinant TGFbRI was introduced by usage of the sense primer S-huTERI-NcoI-pOPE in combination with an antisense primer listed in Table 10.
  • the ECD was recombinantly produced as described in Example 1 and purified by usage of Ni-NTA coupled sepharose (GE Healthcare).
  • the concentration of the purified ECD-myc-(His)6 tagged proteins were determined by specific absorbance at 260 nm (Spectrophotometer) and analyzed for purity by a Coomassie stained 12% SDS PAGE gel.
  • Fig. 7 shows the alignment of the C-terminal human and murine Alk5 sequences (aa 101 to 147) derived from the recombinant proteins that were tested for epitope mapping. The single point amino acid mutation in each construct is depicted in bold. The predicted transmembrane region is shown in the box. 6.8. Assessment of the IC50 of the mAb#19 against the mutated TGFbRI-ECDs Concentrations of the recombinant proteins were normalized (5 ng/ ⁇ l) and titrated for coating on an ELISA-plate.
  • the mouse antibody was incubated over-night and detected with an HRP-conjugated polyclonal goat anti mouse antibody (DAKO, #P0447) and the IC50 determined by non-linear regression fit according to GraphPad Prism9 (inhibitor versus normalized response-variable slope).
  • the ELISA-assay of the mouse mAb#19 against titrated amounts of recombinant TGFbRI mutants are shown in Figs. 8A-C.
  • the amount of coated recombinant protein sufficient to obtain half maximum binding (IC50) was calculated by non-linear regression.
  • Alanine at position 127 (A) was mutated to three amino acids Glycine, Leucine, Valine.
  • the affinity was maintained (G) or two- fold deteriorated (L, V).
  • Alanine at position 128 (B) was mutated to the seven amino acids Glycine, Isoleucine, Leucine, Valine, Serine, Glutamic acid, Lysine.
  • the affinity was maintained (V), (E), improved (K), (L), (S), two-fold deteriorated (I) or abolished (G)-not shown.
  • Alanine at position 131 (C) was mutated to the amino acid Glycine which resulted in a twofold deterioration in affinity.
  • the table in Fig. 8D is a summary of the obtained affinities for the single mutations.
  • Lane 14 & 15 (A); Lane 11 & 12 (B)) and recombinant protein carrying the mutation A127G (Lane 2 A), A127L (Lane 3 A), A127V (Lane 4 A), A128L (Lane 5 A), A128V (Lane 6 A), A128S (Lane 7 A), A128E (Lane 9 A), A128K (Lane 10 A), A128G: (Lane 5 & 6-B), A128I (Lane 7 & 8 B) A131G (Lane 13 A).
  • Binding was abolished towards the mutations L126A (Lane 1 A), V129G (Lane 11 A), I130G (Lane 12 A) and strongly impaired against the mutations G132A (Lane 2 B) and P133A (Lane 3 B).
  • the binding pattern coincides with the results obtained from the IC50 determination. Binding of the mAb#19 could be detected against the ECD substitution A128G if loaded at a higher amount (5 ⁇ g) (Lane 5 & 6 B). Binding towards the A128G at normalized amount (2.5 ⁇ g) was nearly abolished (coinciding with the IC50 results).
  • Recombinant mutations (2.5 ⁇ g of each) were separated by SDS-PAGE and stained by Coomassie blue or blotted and immunoblotted with the chimeric mAb#19 followed by detection with HRP-conjugated polyclonal goat anti-mouse antibody as demonstrated in Fig. 9 A and B.
  • Recombinant ECD considered to be bound by the mAb#19 are depicted in bold.
  • the epitopes of the mAb #19 (chimeric murine) and the mAb #F11 (silenced Fc) were restricted using array screening libraries of human TGFbR1 with synthetic overlapping peptides (Geysen HM, Meloen RH, Barteling (1984). Use of peptide synthesis to probe viral antigens for epitopes to a resolution of a single amino acid. SJ. Proc Natl Acad Sci U S A. 1984 Jul;81(13):3998-4002). To target the linear epitope, the TGFbR1 sequence is converted into a library of overlapping linear peptides directly synthesized on a proprietary solid support called “mini-card”.
  • Chips were blocked and incorporated with the respective antibodies over-night at 4°C.
  • a murine antibody against fluorescein and Pavilizumab, an Fc-silenced, fully human antibody had been used for mAb19 and F11 respectively.
  • Binding of antibodies is quantified using an automated ELISA-type read-out. A binding event was only noted if multiple overlapping peaks were present within this binding region. Putative core epitopes were identified from adjacent peptides with similar or maximally 30% lower intensity as the top peak within a binding region.
  • Example 8 Pharmacokinetic data Material and Methods Analytical work Concentration of the mAb#19 was determined using surrogate peptide approach, where concentration of the protein is quantified based on LC/MS/MS quantitation of unique proteolytic peptides. Target protein was enriched from plasma sample using protein G and digested with trypsin.
  • Sample preparation IgG was purified from mouse plasma using protein G paramagnetic beads on KingFisher Flex purification system (Thermo Fisher Scientific, Vantaa, Finland).
  • a minor modification to protocol used in study ADM-18-1965b was an upgrade of the instrument magnetic head to more suitable for processing standard and deep well plates. Due to the magnetic head change, there was an increase in sample processing volume (incubation and washings) from 200 ⁇ l to 500 ⁇ l. Briefly, 20 ⁇ l of plasma samples and 20 ⁇ l of internal standard (trastuzumab, 20 ⁇ g/ml) were diluted with phosphate buffered saline to final volume of 500 ⁇ l.
  • Protein G beads (50 ⁇ l of 10 % slurry) were washed with 500 ⁇ l of PBS and incubated with diluted sample for 60 minutes. Beads were washed three times in 500 ⁇ l of PBS and IgG was eluted from the beads in 100 ⁇ l of 0.5 M acetic acid. Finally, 80 ⁇ l of the eluted fraction was dried on SPD111 vacuum concentrator (Thermo Fisher Scientific). Samples were processed as undiluted and diluted 5-fold (1+4) with commercial blank mouse plasma. For surrogate peptide analysis the purified IgG was digested with trypsin.
  • Sample was digested overnight at 37 °C and acidified with 10 ⁇ l of 10 % formic acid prior analysis with LC-MS. All incubations were done in a thermomixer with 500 rpm. Standard plasma samples were prepared by spiking the pure standard to blank CD1 mouse plasma to obtain concentrations from 0.122 to 250 ⁇ g/ml in plasma by using one volume of spiking solution and nine volumes of plasma. Similarly, quality control (QC) samples were prepared in plasma for concentrations at 1.6, 8.0, 40 and 200 ⁇ g/ml. Standards and controls were then prepared for analysis in the same way as the samples.
  • QC quality control
  • the pharmacokinetic parameters were calculated using Phoenix 64 (Build 6.4.0.768) WinNonlin (version 6.4) software, using non-compartmental methods (NCA). The doses reported by the sponsor were used for all animals.
  • the terminal phase half-life (T1/2) was calculated by least-squares regression analysis of the terminal linear part of the log concentration–time curve.
  • the area under the plasma concentration–time curve was determined with the linear trapezoidal rule for increasing values and log trapezoidal rule for decreasing values up to the last measurable concentration (AUC0-last), and extrapolation of the terminal elimination phase to infinity (to calculate AUC0-infinity) was used when possible; the following criteria were used: x Minimum of 3 points (not including Cmax) used to calculate lambda (with R2 adjusted >0.85) x T1/2 shorter than the time-span used to calculate lambda x AUClast-infinity ⁇ 20% of AUC0-infinity The maximum plasma concentration (Cmax) and the time to reach Cmax (tmax) were derived directly from the plasma concentration data. Results Analysis of plasma samples The analytical method performance during the sample analysis is shown in Appendix I.
  • the apparent Cmax of 94.3 ⁇ g/ml was achieved 8 hours post-dose and the value for AUC last was 21700 h* ⁇ g/ml.
  • Half-life of the apparent terminal phase was 354 h.
  • the apparent C max of 448 ⁇ g/ml was achieved 4 hours post-dose and the value for AUC last was 158 000 h* ⁇ g/ml.
  • Half-life of the apparent terminal phase was 315 h.
  • the values for Cmax/Dose were 9.43 and 8.96 ⁇ g/ml suggesting that the increase in exposure is proportional to the dose.
  • mice Male Hsd:Athymic Nude-foxn 1 nu mice, grafted with human PC3U cells to ventral prostate, 5-6 weeks old, weighing 25-30 g (purchased from Harlan Laboratories, inc.) mAb#19 and isotype specific control ab from Absolute Antibodies.
  • Vehicle Phosphate buffered saline (PBS) Isotype control: IgG1; Anti-Fluorescein [4-4-20 enhanced Ab 00102-10.16 mouse IgG1 LALA, kappa), 50 mg/kg x i.p. injections twice weekly for 30 days with 50 mg/kg and 10 mg/kg of mAb, volume: 10 ml/kg.
  • PBS Phosphate buffered saline
  • mice were sacrificed 72 hrs after the last dose on the 30th day after the start of administration.
  • x The tumour weight/size, invasion, metastasis, effects on nuclear T ⁇ RI-ICD by in situ PLA, as well as antibody concentration in plasma (determined by Admescope).
  • Gr. Compound Dose Route Days of Time of Number administration termination of animals No. (mg/kg) 1 Vehicle --- i.p. 30 days, i.p. 72 hrs after 15 last dose 2 Isotype 50 i.p. 30 days, i.p. 72 hrs after 15 control (IgG1) last dose 3 mAb#19 50 i.p. 30 days, i.p. 72 hrs after 17* last dose 4 mAb#19 10 i.p.
  • mice 64 male Hsd:Athymic Nude-foxn 1 nu mice 5-6 weeks old from Harlan are used in the study. The mice are injected with human PC3U cells to the ventral prostate 7 days prior to compound administration. The mice were randomized into different cages before study start and kept in conventional housing and fed standard rodent chew (CRM; 801730, from special diets services; SDS) and tap water ad libitum. During the study, observation of animal health is performed.
  • CCM standard rodent chew
  • SDS standard diets services
  • mice are weighed and a dose of vehicle (10 mL/kg, i.p.), isotype control (50 mg/kg, i.p.) or mAb#19 (50 or 10 mg/kg, 10 mL/kg, i.p.) was administered twice weekly for 30 days.
  • vehicle 10 mL/kg, i.p.
  • isotype control 50 mg/kg, i.p.
  • mAb#19 50 or 10 mg/kg, 10 mL/kg, i.p.
  • No loading dose was used.
  • Blood sampling Blood was sampled at 72 hours after the last dose. Blood was withdrawn from anaesthetized mice by heart puncture into pre-labelled and pre-chilled microtainer tubes containing EDTA.
  • Plasma samples are immediately put on ice prior to centrifugation. It is important that the exact sampling times are recorded.
  • Plasma is prepared by centrifugation for 10 minutes at approximately 3000 g at +4 °C within 20 minutes from sampling. The plasma was transferred to pre-chilled polypropylene tubes, 50 ⁇ L and then transferred to 1.4 ml Thermo Screenmate tubes. The tubes were immediately frozen on dry ice and stored frozen at -70 °C.
  • the 1.4 ml PK-sampling of satellite animals In order to get information about the PK-profile, there was two satellite animals per dosing groups. Blood samples was taken from tail vein 8 hours (or 4 hrs) after administration on the first day of dosing (two animals per dosing group).
  • Figs 12A-D Effects on tumor growth (A) and lymph node metastases (B) upon treatment with mouse-mAb#19 in a human PC3U orthotopic prostate cancer model [6]. 2 x 10 5 PC3U cells were injected into the ventral prostate of athymic nude mice.
  • mice were injected intraperitoneally (i.p.) with vehicle PBS, isotype-specific control mAb IgG (anti-Fluorescein 50 mg/kg), mouse- mAb#19 (10 mg/kg) or mouse-mAb#19 (50 mg/kg) twice a week for a period of 4 weeks (in total 8 times). Tumors were collected and weighed after 30 days and shows that the tumor-weights and areas of both treatment groups with mouse-mAb#19 at 10 mg/kg and 50 mg/kg are significantly lower when compared with vehicle group (P ⁇ 0.05 ⁇ ).
  • tumors derived from mice treated with mouse-mAb#19 at 50 mg/kg are significantly smaller than those treated with the same amount of isotype- specific control mAb IgG150 mg/kg. No significant difference of tumor weight is found between treatment with the mouse-mAb#19 at 10 mg/kg and the control mAb IgG1 group at 50 mg/kg.
  • Figures 12C and 12D shows that the tumor and lymph node areas of both treatment groups with mouse-mAb#19 at 10 mg/kg and 50 mg/kg are significantly lower when compared with vehicle group and isotype-specific control mAb IgG150 mg/kg (P ⁇ 0.02 ⁇ , P ⁇ 0.001 ⁇ ).
  • lymph derived from mice treated with mouse- mAb#19 at 50 mg/kg are significantly smaller than those treated with the same amount of isotype-specific control mAb IgG1 50 mg/kg.
  • No significant difference of tumor weights is found between treatment with the mouse-mAb#19 at 10 mg/kg and the control mAb IgG1 group at 50 mg/kg. Histology sections from tumor tissues and regional lymph nodes are shown in Fig. 13 A and B, respectively.
  • In situ PLA was used to visualize nuclear complex formation of endogenous TGF ⁇ RI- ICD (via detection of HA tag) and p300 (detected by anti-HA and p300 (R&D. Cat.
  • Fig. 14A shows representative in situ PLA data for endogenous nuclear TERI-ICD (via detection of HA tag) in complex with endogenous p300; and Fig. 14B shows numeric representation of analyses of tissue sections: Complex formation is statistically reduced upon treatment with the mouse-mAb#19 at 50 mg/kg, in comparison to vehicle control or treatment with isotype control IgG1 at 50 mg/kg. ** p ⁇ 0.01, *** p ⁇ 0.001 students T-test.
  • Example 10 Mouse mAb#19 binding to endogenous target analyzed by FACS Material and methods
  • Human PC3-U cells were incubated in a human Fc block/viability dye solution for 10 min on ice. After wash, cells were fixed and permeabilized for 20 min on ice after which they were stained with mouse mAb#19 or isotype-specific IgG1 control mouse #4-4- 20 antibodies at different concentrations (100, 30, 10, 3, 1, 0.3, 0.1, 0.03, 0.01 and 0.003 ⁇ g/ml) for 30 min on ice. After wash, cells were incubated with PE conjugated goat anti-mouse IgG secondary antibody solution for 30 min on ice. A CytoFlex (Beckman Coulter) was used for analyses.
  • Graphs show MFI (PE) signal from mouse mAb#19 antibody on live single cells minus the MFI (PE) signal from isotype-specific control antibodies (#4-4-20; #anti- Fluorescein) at different concentrations (nM) (Fig. 17A and B). Binding of mAb#19 on endogenous target in PC-3U and RWPE cells analyzed by FACS is shown in Fig. 17A and B, respectively.
  • PC-3U (A) and RWPE (B) cells were incubated in a human Fc block/viability dye solution for 10 min on ice.
  • mAb#19 binds to its target i.e., endogenous T ⁇ RI, in PC3U and RPWE cells with a Kd of 10.70 (A) and 7.81 nM (B), respectively ( Figure 17).
  • Example 11 – Determination of IC 50 Comparison human mAb#19 LALA-IgG1 versus mouse mAb#19 IgG1 Determination of IC 50 : The IC50, the concentration sufficient to achieve 50 % of maximum binding, was determined by ELISA.
  • Recombinant human TGFERI ECD 133-myc-(His)6 was coated on a Nunc ELISA plate (Maxisorp, #439454, ThermoScientific, USA) at 500 ng/well (over- night at 4 °C in 0.1 M Na 2 CO 3 buffer pH 9.6) and blocked with 2 % Milk-PBS (1 hour at RT). Serial dilution of the mouse or human mAb#19 were incubated over-night at 4 °C. Bound antibody was detected with an HRP-conjugated polyclonal goat anti mouse antibody (DAKO. #P0447) or HRP-conjugated polyclonal rabbit anti-human antibody (DAKO, #P0212) respectively.
  • HRP-conjugated polyclonal goat anti mouse antibody DAKO. #P0447
  • HRP-conjugated polyclonal rabbit anti-human antibody DAKO, #P0212
  • the TMB-color formation was blocked by addition of H2SO4 (after approximately 30 seconds), and absorbance measured at 450 nm.
  • the ELISA plate was washed three times with T-PBS after each incubation step.
  • the concentration sufficient to obtain 50% saturation, the maximum and minimal values were set to 100 and 0 % respectively and a non-linear regression was modelled (Prism 7, GraphPad, USA).
  • the option “inhibitor versus normalized response” with a variable slope was chosen for the IC50 calculation. Fig.
  • mAb#19 format Human TGFbR1-ECD-133-myc(His) 6 A: chimeric IgG1 0.104 nM B: human IgG1-LALA 0.139 nM Table 13 - IC50 determination of the mouse mAb#19 (A) and the fully human mAb#19 (B) against recombinant human TGFERI ECD-133-myc-(His) 6 protein. Material and Methods A9 PC3U cells described under section 6.3 which where reconstituted with TGF ⁇ RI-HA tag (in C-terminal part of the protein).hu-mAb#19 LALA-IgG1 and mouse-mAb#19 has been described above. In situ PLA technique and antibodies, imaging used as described above.
  • hu-mAb#19 and mouse-mAb#19 were investigated and compared in established cell- based assays (nuclear HA-tagged T ⁇ RI-ICD in complex with endogenous p300 in A9 cells) and as described under section 6.3 above. This method was used to investigate the effect of the drug on nuclear T ⁇ RI-ICD in complex with the transcriptional co- regulator p300 (this complex was initially described by the inventors in [4]. As shown in Fig. 19, the inventors observed that both antibodies function well with IC 50 45 nM for the hu-mAb#19 (A) and IC5042 nM for the mouse-mAb#19 (B).
  • Example 12 mouse-mAb #19 binding to endogenous target analyzed by FACS Material and methods Human PC3-U cells were incubated in a human Fc block/viability dye solution for 10 min on ice. After wash, cells were fixed and permeabilized for 20 min on ice after which they were stained with mouse mAb#19 or isotype-specific IgG1 control mouse #4-4- 20 antibodies at different concentrations (100, 30, 10, 3, 1, 0.3, 0.1, 0.03, 0.01 and 0.003 ⁇ g/ml) for 30 min on ice.
  • the parental mAb#19 was expressed as a soluble phage- and Fab- fragment in order to test the feasibility in the applied selection system.
  • the VH and VL genes of mAb#19 had been synthesized and cloned into the YUMAB phagemid- vector as a Fab format.
  • the Fab fragment was then packaged as a phage particle and as well as a soluble Fab antibody in E. coli for an antigen binding test in ELISA.
  • the antigen target antigen used was recombinant hu-extracellular domain (ECD)-133- huFc and hu-ECD 133-myc(His)6.
  • the parental antibody Fc regions were modelled in order to determine surface CDR residues possibly implicated in binding target. Thereby, the most similar template from databases had been screened and used for grafting the parental CDR’s, followed by a de novo modelling of the HCDR3.
  • the amino acids predicted to be most important for binding had been consequently selected for being mutated, resulting in the selection of 18 positions in the VH- (HCDR1, HCDR2 and HCDR3) and 12 positions in VK- domain (LCDR1, LCDR2 and LCDR3).
  • NGS library of 1-2 x 10 6 IgG sequences for each germline was investigated for amino acid usage at each position and degenerated codons for each position were selected under following considerations: (a) wt amino acids and amino acids with a higher or equal frequency of 0.1 % were included, (b) Usage of C, M, N and W was avoided/reduced, (c) in average, 12 amino acids at each position, and (d) 4 mutations in VH or VK were allowed. Primers were designed based on the selected degenerated codons and overlap extension PCR was used to introduce mutations in all CDRs.
  • VHmut/VLmut The mutated VH/VL genes were cloned into YUMAB’s phagemid vector and 3 libraries had been in total generated: VHmut/VLmut, VHwt/VLmut, VHmut/VLwt.
  • a quality control of each library was performed with 24 randomly picked colonies by analyzing the PCR-amplified insert for the expected size and Sanger-sequencing.
  • the size of the libraries showed in average 78 % functional clones with an overall size of 14 x 10 8 colony forming units (cfu).
  • VHmut/VLmut, VHwt/VLmut, VH mut /VL wt libraries were packaged in phages and revealed to have a size of 2.1x, 1.7x and 1.8 x 10 12 phage-particles/ml respectively.
  • Affinity driven in vitro selection was performed by using four variable strategies with increasing stringency by antigen limitation and competition in the second panning round.
  • the first panning round was performed in presence of Strept beads as well as human Fc, huAlk1-mFc, huAlk4-mFc and huAlk7-mFc for negative and biotinylated huTGFER1-huFc at 50 nM for positive selection.
  • the second panning round was performed in presence of biotinylated huTGFER1-huFc at 50 nM, 5 nM, 0.5 nM and 0.05 nM for strategy 1 to 4 respectively in presence of huTGFER1-huFc at 500 nM for binding competition.
  • 384 soluble Fab-antibodies from each strategy were expressed in soluble form and screened for ELISA binding against four different antigens: 1. huTGFER1-huFc (pos.); 2. human Fc (neg.); 3. huAlk1-mFc (neg.); 4. huAlk4-mFc (neg.).
  • a positive hit was defined if the ELISA binding signal to the positive antigen was larger than 0.1, whereas the signal to the negative antigen was smaller than 0.1. Furthermore, the S/N ratio between positive and negative antigen had to be larger than 3. On average, 514 binding clones had been identified, giving a positive hit of around 33 %.96 clones with the best S/N ratio from each strategy had been sequenced resulting in 253 unique mutated antibodies in total. 192 unique Fab fragments were expressed and their affinity was measured by BLI (Biolayer Interferometry) by immobilization of biotinylated huECD-133-huFc onto Streptavidin sensors.
  • BLI Biolayer Interferometry
  • Clones were ranked according to their lowest Koff-rate and the best 25 candidates were converted into fully IgG1 for mammalian expression.
  • Fully IgGs were purified by Protein A chromatography and quality controlled by reducing SDS-PAGE and UV/VIS. Ranking of the expressed IgGs was performed by (a) determination of the EC50 by ELISA using the ECD-huFc as coated antigen and (b) BLI affinity measurement by Protein A immobilization of the IgG candidate and using huECD-133-myc(His)6 as an analyte in concentration ranging from 500 to 0.5 nM. Compared to the parental antibody, the EC50 value was improved for 24 of the tested IgGs, with a maximum decrease of factor 6.
  • the top 10 antibodies show quite similar EC50 values with an approximate affinity increase of at least two times.
  • the best antibody showed an affinity increase of factor 3.
  • the best 5 IgG candidates were further tested in an ELISA for unspecific binding on representative biomolecules. Thereby, DNA, LPS, Lysozyme and mammalian cell lysate were coated on the ELISA plates and bound antibodies were detected with antibodies directed against human Fc. All candidates showed a binding ratio in the range of 0.9 to 1.7 compared to Palivizumab, a human IgG with silenced Fc that had been used as a negative control (data not shown).
  • Example 14 Flow cytometry evaluation of human affinity maturated antibody 19 variants
  • PC3-U adherent cells were stained for expression of TGFERI with affinity matured antibody candidates detected using a PE-conjugated anti-human IgG antibody.
  • Flow cytometry analysis of TGFERI staining in PC3U cells was used as a first evaluation method for antibody candidates.
  • Effective concentration 50% (EC50) and dissociation constant (Kd) were used to evaluate the antibodies affinities.
  • candidate antibodies were kept at 45qC for 48h and 168h, subsequently their biding efficiency to TGFERI in PC3U cells was evaluated by flow cytometry. Results 24 maturated antibodies were chosen for further selection of a top candidate.
  • Antibody stability test was performed over 7 days, when selected antibodies were kept either at 45qC or 4qC (controls). After 48h and 168h, flow cytometry staining of TGFbRI in PC3U cells was performed and antibodies were evaluated by their EC50- and Kd- values (see Table 16 and 17). YU772-F11 antibody was chosen as the best antibody candidate when considering both affinity and stability. Table 14. Kd and EC50-values of selected antibody candidates.
  • MFI of isotype control was subtracted from MFI of each sample and used for further analysis. Data were plotted in Graph Pad Prizm 7.0. EC50 values were generated using a non- linear regression fit model ( [Agonist] vs. response -- Variable slope (four parameters) with default Fitting method - Least squares regression. Kd values were generated using a non-linear regression fit model (One site – specific binding). To improve curve fitting in some of the samples specific constrains were applied.
  • Example 15 - Proximity ligation assay (PLA) for HA-TERI and p300 Affinity matured antibodies were used to treat cells to evaluate the inhibitory effect of the generation of nuclear TERI-ICD in complex with p300 (HA-TERI +p300).
  • TGF-E1 was purchased from Peprotech and used at 10 ng/ml. Equipment 1. Fluorescence microscope (Zeiss, Axioplan 2) 2. 37°C cell incubator 3. Orbital shaker 4. Heated humidity chamber 5. Hydrophobic pen for delimiting the reaction area 6. Freezer block (for enzymes) 7. Blob-Finder image analysis software 8.
  • Step 1 Cell culture 1 st day, A9(ALK5-HA) reconstituted cells were seeded in an 8-well chamber slide (5x10 4 cell per well). 2 nd day, the cells were starved with the medium supplemented with 1% FBS for 16 h. 3 rd day, the cells were pretreated with #control Fluorescein or #No.19 Abs for 1 hour, and then were stimulated with TGF-E110 ng/ml for 6 h. Step 2 Fixation and permeabilization slides 1. The slides were washed 4 times with PBS and then fixed in 4% paraformaldehyde (pre-warmed at 37 o C) for 30 min at room temperature. 2.
  • Step 3 PLA staining followed by the instruction of PLA kits.
  • Blocking a) Vortex the Duolink ® Blocking Solution.
  • Primary Antibody Incubation a) Vortex the Duolink® Antibody Diluent. b) Dilute your primary antibody or antibodies to suitable concentration in the Duolink ® Antibody Diluent.
  • g) Incubate the slides in a pre-heated humidity chamber for 30 minutes at 37°C. 5.
  • Amplification a) Dilute the 5x Amplification buffer 1:5 in high purity water and mix. b) Tap off the ligation solution from the slides. c) Wash the slides 2x 5 minutes in 1x Wash Buffer A at room temperature. d) During the wash, retrieve the Polymerase from the freezer using a freezer block (-20°C). e) Add Polymerase to the 1x Amplification buffer from step (a) at a 1:80 dilution and mix. f) Tap off excess wash buffer and apply the amplification solution. g) Incubate the slides in a pre-heated humidity chamber for 100 minutes at 37°C. 6.
  • Final Washes a) Tap off the amplification solution from the slides. b) Wash the slides 2x 10 minutes in 1x Wash Buffer B at room temperature. c) Wash the slides in 0.01x Wash Buffer B for 1 minute. 7. Preparation for Imaging a) Tap off excess wash buffer from the slides. b) Mount the slides with a coverslip using a minimal volume of Duolink ® In Situ Mounting Medium with DAPI. c) Wait for 15 minutes before analyzing in a fluorescence or confocal microscope, using at least a 20x objective. d) After imaging, store the slides in the dark at 4°C for up to 4 days or at - 20°C for up to 6 months.
  • Step 4 Collect images for PLA staining Digital images were taken by using a fluorescence microscope (Axioplan 2, Carl Zeiss) with a digital camera (C4742-95, Hamamatsu), with X40 objective lens (Carl Zeiss MicroImaging). Step 5 Analysis PLA signaling Analyze PLA signaling for nuclear TERI-ICD in complex with p300, was performed by the use of Duolink Image Tool that was specially developed for quantification of PLA signaling. Step 6 Statistics Prisma 7 was used for analysis of IC 50 Two positive controls were used in this experiment: TGF-E treatment with no antibody and TGF-E treatment plus #control Fluorescein 200 nM. The two positive controls had the same level of in situ proximity ligation signal.
  • Example 16 Invasion assays from prostate cancer and breast carcinoma cells The inventors observed a significant inhibition of TGFE-induced invasiveness in response to TGFE in human triple negative breast carcinoma cells (MDA MB231 cells) ( Figure 23) when treated with affinity maturated F11 and A19 used at 200 nM compared with control antibody Pavilizumab at 200 nM. Galunisertib (a TGFE Type I receptor kinase inhibitor) was used at 10 microM as control for experiment.
  • MDA MB-231 cells were seeded in 10 cm plates. Cells were grown in DMEM media containing 10% FBS, 1% PEST and 1% L- glutamine at 37°C in the presence of 5% CO2 until the cells attain 70-80% confluency. Then the cells were starved for 12 hours in DMEM media containing 1% FBS, 1% PEST and 1% L-glutamine. Next the cells were trypsinized, washed in 1X PBS and suspended in serum free media, to remove any traces of trypsin. Next the cells were counted. 2 X 10 5 /ml cells were used for the experiment.
  • Example 17 – Epitope mapping Summary The inventors hired Pepscan ⁇ ; a CRO for analyses of linear and conformational epitope mapping in human TERI to identify binding of mAb#19. Results from Pepscan ⁇ described in Table 19 below shows which amino acids mAb#19 was found to bind to. Materials and methods Epitope mapping was conducted as described in Example 7 above. Results Putative core epitopes were identified and are listed in Table 19. To investigate which residues within these epitopes may be important for interaction, linear 15-mer peptides bearing single alanine mutations at position 10 were made. Multiple mutations were found to decrease binding, these could be considered important for the binding.
  • Residues possibly involved in the interaction are underlined and marked in bold (Table 19).
  • Residue number Residue numbering Core epitope according to P36897 (according to SEQ ID (SEQ ID NO: 247) NO: 1) 47-58 71-82 CIAEIDLIPRDR (SEQ ID NO. 228) 94-109 118-133 SPGLGPVELAAVIAGP* (SEQ ID NO. 229)
  • Table 19 Core epitopes for mAb#19. Core epitopes are based on common sequences in overlapping peptides (overlapping sequences within 30% of the top peptide intensity in the peak).
  • Example 18 Comparative data Summary: The inventors investigated the functional activity of Capra antibody 82.18 with several antibodies generated in the collaboration with SciLifeLab DDDp, including mAb#19 using in situ PLA assay (as described above in Example 15), to measure nuclear TbRI-ICD in complex with p300.
  • the indicated antibodies in Figure 24 were used to treat cells to evaluate the inhibitory effect of the generation of nuclear TbRI- ICD in complex with p300 (HA-TbRI +p300).
  • Antibody 16 was used as an isotype- specific IgG antibody in this experiment.
  • the inventors have performed a comparison of an antibody raised against a peptide consisting of amino acids 114-124 of TGF ⁇ R1 (antibody 82.18) with antibody #19.
  • the inventors have shown than antibody 19 is better at preventing cleavage of T ⁇ RI and the subsequent release of T ⁇ RI-ICD in an in situ PLA assay, which is a functional assay to show the presence of nuclear T ⁇ RI-ICD, performed in wild type (WT) castration-resistant prostate cancer (PC3U) cells ( Figure 24).
  • Example 19 Results of MS analysis of TACE cleavage of TGFBR1 peptides Summary
  • MS mass spectrometry
  • TACE 300 ng
  • R&D Systems cat#930-ADB TACE-cleavage buffer
  • the gel was than (1) fixed in 46% MeOH, 7% HAc for 1 hour; (2) stained in 46% MeOH, 7% HAc, 0.1 % filtered Coomassie R-250 for 1 hour; (3) destained in 5% MeOH, 7.5% HAc for 36 hours; (4) and incubated for 5 hours in 1.5 % HAc.
  • the band was cut out, 20 ⁇ l of H2O was added and the sample was stored at minus 20°C.
  • the eluted protein samples were hydrolyzed my microwave exposure for 6 min at 8y0 % power, followed by reduction and alkylation to disrupt disulfide bonds.
  • TACE-cleavage therefore occurred after amino acid position 127 (alanine) and/or position 128 (alanine) of the human TGFbR1.
  • TACE cleavage of recombinant ECD-133-TGFbR1 myc(His) 6 is strongly inhibited by introduction of the A128G or A128I mutation.
  • ECD-133-TGFbR1 myc(His)6 proteins carrying a point mutation A128G or A128I had been produced as described for the wild-type production.
  • a TACE- assay was performed as described in chapter X. Samples were separated on an SDS- PAGE gel and visualized by PAGE blue (Fig. 26B). Exposure of the wt ECD-133-TGFbR1 myc(His)6 protein (13 658 Da) with TACE resulted in the appearance of a smaller fragment in the size that corresponds to the cleavage after the C-terminal end at amino acid 127 or 128 (10891 Da or 10981 Da respectively).
  • Example 20 Treatment with monoclonal antibodies against TGF ⁇ Type I receptor hinders growth and metastasis of castration-resistant prostate cancer in vivo Prostate cancer (PCa) is the second most common cancer from in men and the fifth deadliest cancer form in men. In 2018, about 1.3 million men were diagnosed with PCa with about 360 000 deaths (1). Growth of PCa is dependent of the androgen testosterone, which also therefore is a target of androgen deprivation therapy (ADT).
  • ADT androgen deprivation therapy
  • ADT is used in various stages of PCa, such as prevention of PCa metastasis, and in combination with radiotherapy against local and advanced local PCa, and also when radiotherapy is not the optimal treatment against PCa (2).
  • advanced PCa the tumor is no longer responsive to ADT and classified as castration resistant prostate cancer (CRPC) (3).
  • New anti-androgens Enzalutamide and Abiraterone acetate are used when chemotherapy is not an option for PCa patients and when CRPC has metastasized.
  • Chemotherapy with Docetaxel and Cabazitaxel are frequently used for metastatic CRPC (mCRPC). Together, this range of treatment will only increase the survival of PCa patients with a few months, ranging from 11-74 months (4).
  • TGF- ⁇ Transforming growth factor- ⁇
  • EMT epithelial mesenchymal transition
  • TGF- ⁇ signaling pathway Other associations of TGF- ⁇ are linked to PI3/AKT pathway, RAS/MAPK kinase pathway, angiogenesis, and metastasis (7).
  • TGF- ⁇ signaling pathway targets against the TGF- ⁇ signaling pathway.
  • Targets against TGF- ⁇ signaling pathway are exerted for instance by interference of activation of latent TGF- ⁇ , ligand receptor interactions and TGF- ⁇ receptor kinase inhibitor. A few of these treatments have shown to improve patient survival (8).
  • T ⁇ RI-ICD soluble intracellular domain
  • mice Athymic male nude mice (Envigo, 6-8 weeks old) were used for the orthoptic prostate xenograft model. A lower midline incision was performed on the mice.
  • 300 000 PC-3U cells in 10 microliter sterile PBS were injected into the right anterior prostate lobe of 18 mice. After one week of injection, mice were randomized into four treatment groups: 4 mice in 50 mg/kg Ctrl mAb, 5 mice at 50 mg/kg mAb19, 4 mice at 50 mg/kg mAb, 50 mg/kg mAbF11 and 5 mice at 10 mg/kg mAbF11.
  • mice were treated with 50 mg/kg control (ctrl) mAb, 50 mg/kg mAb19, 50 mg/kg mAbF11 or 10 mg/kg mAbF11 injected intraperitoneally twice per week for 4 weeks.
  • control (ctrl) mAb 50 mg/kg mAb19, 50 mg/kg mAbF11 or 10 mg/kg mAbF11 injected intraperitoneally twice per week for 4 weeks.
  • 300000 PC-3U cells in 10 ⁇ l sterile PBS were injected into the right anterior prostate lobe of 59 mice. After one week of injection, mice were randomized into six treatment groups: 13 mice in Ctrl mAb, 15 mice in 3 mg/kg mAbF11, 10 mice in 10 mg/kg mAbF11, 10 mice in 30 mg/kg mAbF11, 6 mice in Ctrl and 5 mice in 10 mg/kg Docetaxel.
  • mice were treated with 30 mg/kg control mAb, 3 mg/kg mAbF11, 10 mg/kg mAbF11, 30 mg/kg mAbF11, ctrl for Docetaxel and 10 mg/kg Docetaxel twice per week for 4 weeks. Treatments were administrated intraperitoneally. After four weeks of treatment, mice were sacrificed. Tumors and lymph nodes were weighed, and the volumes were measured with a caliper. Immunohistochemistry analysis of specified proteins was performed, sections were incubated for 1 hour at 60 degrees. Then they were rehydrated in xylene twice each for 15 min, 100 ethanol for 5 min, 95%, 70% ethanol and deionized H2O for 5 min.
  • the sections were treated with Antigen Retrieval Reagent at 95 °C for 15 min and rinsed thereafter with deionized H2O. Then the sections were kept in 0.75% H2O2/75% methanol for 15 min, rinsed with deionized H2O for 5 min and washed 3 times with PBS. Then sections were blocked with 5 % goat serum for 1 hour at room temperature. The sections were incubated with primary antibodies: TGF ⁇ R1 (1:500), Ki67 (1:250) and Vimentin (1:100), diluted in 5 % goat serum overnight at 4 °C. After overnight incubation with primary antibodies, sections were washed 3 times in PBS and then incubated with secondary antibody.
  • Both mAb candidates prevent proteolytic cleavage of TGF ⁇ R by steric hindrance.
  • Our results show that both mAb19 and mAbF11 decreased tumour weight.
  • TGF ⁇ R1 expression in mCRPC tumours was analyzed after treatment with mAb 19 50 mg/kg, F11 mAb (10 or 50 mg/kg) or control mAb (50 mg/kg).
  • Tumor Treatment Weight Volume mAb Difference (mg) P-value Difference P-value (mg/kg) (mm 3 ) 50 mg/kg mAb19 183 0,05, n.s. 0,07 50 mg/kg mAbF11 192 > 0,05, 185 > 0,05 10 mg/kg mAbF11 158 0,05 170 0,05 Lymph nodes
  • Treatment Weight Volume mAb Difference (mg) P-value Difference P-value (mg/kg) (mm 3 ) 50 mg/kg mAb19 9 > 0,05 13 0,05, 50 mg/kg mAbF11 9 > 0,05 17 > 0,05 10 mg/kg mAbF11 n.s. 0,16 15 > 0,05 Table 21.
  • TRAF6 ubiquitinates TGFbeta type I receptor to promote its cleavage and nuclear translocation in cancer. Nat Commun.2011;2:330. 10. Gudey SK, Sundar R, Mu Y, Wallenius A, Zang G, Bergh A, et al. TRAF6 stimulates the tumor-promoting effects of TGFbeta type I receptor through polyubiquitination and activation of presenilin 1. Sci Signal.2014;7(307):ra2. 11. Song J, Mu Y, Li C, Bergh A, Miaczynska M, Heldin CH, et al. APPL proteins promote TGFbeta-induced nuclear transport of the TGFbeta type I receptor intracellular domain.
  • Example 21 Evaluation of the effect of human mAb antibody F11 on cell migration in vitro
  • the effect on cell migration of the human monoclonal antibody F11 (from 50 nM to 200 nM) that targets the TGF- ⁇ signaling pathway was evaluated with a wound healing assay performed on HCT-116-RedFluc cells (human colorectal cancer cells) with or without TGF- ⁇ 1 stimulation (at 10ng/ml).
  • Cell migration was compared to non-treated cells and to reference items using a human isotype control antibody (from 50 nM to 200 nM) and a well-known inhibitor of TGF ⁇ RI kinase (Galunisertib at 10 ⁇ M) with or without TGF- ⁇ 1 stimulation.
  • a human isotype control antibody from 50 nM to 200 nM
  • a well-known inhibitor of TGF ⁇ RI kinase (Galunisertib at 10 ⁇ M) with or without TGF- ⁇ 1 stimulation.
  • Cell migration was evaluated by monitoring the recolonization of the scratched region (2 areas by well for 3 wells per condition) to quantify cell migration.
  • the mAb F11 inhibited cell migration of HCT-116-RedFluc cells. This cell migration inhibition was equivalent at all concentrations with TGF- ⁇ 1 stimulation or at 200 nM without TGF- ⁇ 1 stimulation with nearly a complete inhibition that ranged from 84.8% ⁇ 14.5% to 91.2% ⁇ 11.8% at T0+72h, whereas a migration occurred for non-treated cells with 6.2% ⁇ 4.2% of free cell area.
  • the inhibition of cell migration of the mAb F11 was lower at 50nM and 100nM without TGF- ⁇ 1 stimulation with 73.4% ⁇ 21.7% and 54.1% ⁇ 17.1% respectively.
  • the human monoclonal antibody F11 inhibited cell migration of HCT-116-RedFluc at all concentrations with or without TGF ⁇ 1 stimulation.
  • Introduction Cell migration is fundamental for physiological (morphogenesis, regeneration and inflammation) and pathological processes such cancer during invasion and metastasis.
  • Aberrant TGF ⁇ signaling has been implicated in several human diseases, including malignancies such as lung cancer, hepatocellular carcinoma, pancreatic cancer and Colorectal cancer (CRC). TGF- ⁇ have been shown to promote and maintain CRC metastasis via regulation of immunity and cell–cell contact mechanisms.
  • CRC is one of the leading causes of cancer deaths in the western world. Metastatic dissemination of primary tumors is directly related to patient’s survival and accounts for about 90% of all colon cancer deaths. Thus, more effective and less toxic therapies for CRC are required.
  • the effect on cell migration of the human mAb F11 antibody (designated by CDD Ab at 3 concentration: 50, 100 and 200 nM) that targets the oncogenic TGF- ⁇ signaling pathway was evaluated with a wound healing assay performed on HCT-116-RedFluc cells (human CRC cells).
  • Wound healing assay consists of an artificial gap made on a cell monolayer and follow 2-dimensional cell migration by capturing images at regular intervals until T0+72h post-scratch.
  • Cell migration was compared to non-treated cells and to reference items using a isotype control antibody (designated by CTL Ab at 3 concentration: 50, 100 and 200 nM) and a well-known inhibitor of TGF ⁇ R1 kinase (Galunisertib at 10 ⁇ M). These conditions were tested with and without TGF- ⁇ 1 stimulation. Cell migration was evaluated by monitoring the recolonization of the scratched region to quantify cell migration.
  • CDD Ab Materials Candidate antibody
  • mAb F11 Fully human Ab IgG1 (Immunoglobulin G1) with some mutations in the Fc (Fragment Crystallisable) region (to silence ADCC) Specificity for the human TGF- ⁇ R1 Formulated in Phosphate Buffered Saline (PBS), Protein A purified, >95%
  • Isotype control antibody (CTL Ab) Humanized mAb IgG1 with the same mutations in the Fc region (to silence ADCC) as the CDD Ab.
  • RSV respiratory syncytial virus
  • PBS Protein A purified
  • Galunisertib TGF- ⁇ inhibitor targets and binds to the kinase domain of TGF- ⁇ receptor 1 (TGF- ⁇ R1) C 22 H 19 N 5 O, CAS Number: 700874-72-2 in 1% of DMSO, purity 99.84%.
  • TGF- ⁇ 1 Transforming Growth Factor beta ligand 1 TGF- ⁇ 1: ligand of TGF ⁇ receptor Peprotech Ltd) ⁇ 98% by SDS-PAGE gel and HPLC analyses
  • Tumor cells HCT-116-RedFluc Human Colorectal Tumor-116-RedFluc
  • the HCT-116- RedFluc cell line is a human colorectal tumor expressing luciferase, allowing a set-up of CRC mouse model and the follow-up of tumor cell dissemination in the mouse body by bioluminescence imaging.
  • Tumor cell amplification Thawing and the amplification: a vial of HCT-116-RedFluc cells was resuspended in preheated complete culture medium, composed of McCoy 5a medium supplemented with 10% of Fetal Bovine Serum (FBS) and 1% of Penicillin-Streptomycin (P/S) (CM10%). Centrifugations were performed at 400 g for 5 minutes at room temperature. To determine cell number and viability at each cell passage, cells were mixed with Erythrosin B stain in the same volume, and 10 ⁇ l were loaded on a LUNA Cell Counting Slide. Images and counting were performed using the brightfield mode and the Defaults protocol of the LUNA-FX7.
  • HCT-116-RedFluc cells were plated with 2.5x10 5 cells per well with the preheated CM10% in 24 well plates.
  • Wound healing assay and serum starvation A confluent monolayer of HCT-116-RedFluc was scratched with a sterile 1000 ⁇ l tip to create a wound devoid of cells (a new tip was used for each well). The medium was removed and a preheated culture medium composed of McCoy 5a medium supplemented with 1% of FBS and 1% of P/S was added designated by CM1%.
  • Test and reference items preparation Test and reference items were prepared and added according to the experimental study design in Table 24. Table 24 .
  • mAb F11 and isotype control antibody (CTL Ab) solutions preparation Solutions with only the mAb F11 or only isotype CTL Ab were prepared at 50 nM, 100 nM and 200 nM in McCoy 5a medium CM1% supplemented with 1 % FBS and P/S.
  • Galunisertib solution preparation A Galunisertib solution at 10 ⁇ M Test and reference items treatment Culture medium was removed, and cells were washed twice with sterile PBS. 1 ml of test and reference items solutions were then distributed in the appropriate wells containing either media only CM1%, Galunisertib at 10 ⁇ M, or the mAb F11 or ctr antibody at indicated concentrations respectively.
  • TGF- ⁇ 1 stimulation According to the experimental phase schedule in Table 25, stimulation with TGF- ⁇ 1 occurred by addition of 100 ⁇ l of a TGF- ⁇ 1 solution (110 ng/ml in CM1%). 100 ⁇ l of a CM1% solution was added in wells of non-stimulated cells. Cells were then incubated between 35 and 40°C with 1-6 % CO 2 .
  • Time schedule Action Day -1 AM Tumor cell preparation for wound healing assay Preparation of test & reference items and TGF- ⁇ 1 T0-1h+/-30min solution Wound healing assay T0 Serum starvation Day 0 Just after T0 Picture (baseline) Just after picture Test & reference items treatment 1 h ⁇ 5min post treatment TGF- ⁇ 1 stimulation T0+4h ⁇ 33min Picture Day 1 T0+24h ⁇ 1 hour Picture Day 2 T0+48h ⁇ 1 hour Picture Day 3 T0+72h ⁇ 1 hour Picture Table 25 .
  • Extents of closure at T0+4h, T0+24h, T0+48h and T0+72h were calculated by subtracting area at T0. Change of area was determined by normalizing difference to area at T0. Cell migration was quantified and expressed as average percentage of closure of the scratch area on the 3 replicates or 2 replicates only for some condition detailed in DEV2. The normalized area to T0 area of each replicate of a condition and the mean normalized to T0 area ⁇ SD of each condition at each timepoint were calculated and represented in a graph.
  • CTL Ab 3C (CTL Ab at 50 nM), 3B (CTL Ab at 100 nM) and 3A (CTL Ab at 200 nM) to reach in average 4.8% ⁇ 3.7%, 3.7% ⁇ 1.0% and 13.0% ⁇ 9.1% respectively on T0+72h, signing a colonization of scratch in same proportion than control non-treated condition.
  • condition 7 CTL Ab stimulated with TGF- ⁇ 1
  • the doses 50 nM, 100 nM or 200 nM to reach in average 11.9% ⁇ 6.2%, 20.9% ⁇ 13.0% and 9.6% ⁇ 6.2% on T0+72h respectively, close to the control non-treated cells.
  • Cell migration was compared to non-treated cells and to reference items using a human isotype control antibody and a well-known inhibitor of TGF ⁇ RI kinase (Galunisertib) with or without TGF- ⁇ 1 stimulation. Cell migration was evaluated by monitoring the recolonization of the scratched region to quantify this cell migration.
  • the F11 antibody inhibited cell migration of HCT-116-RedFluc cells. This cell migration inhibition was equivalent at all concentrations with TGF- ⁇ 1 stimulation or at 200 nM without TGF- ⁇ 1 stimulation with nearly a complete inhibition that ranged from 84.8% ⁇ 14.5% to 91.2% ⁇ 11.8% at T0+72h whereas a migration occurred for non-treated cells with 6.2% ⁇ 4.2% of free cell area.
  • the inhibition of cell migration of the F11 antibody was lower at 50 nM and 100 nM without TGF- ⁇ 1 stimulation with 73.4% ⁇ 21.7% and 54.1% ⁇ 17.1% respectively.
  • Results presented herein illustrate that the F11 antibody inhibited cell migration of HCT116-RedFluc cells. This cell migration inhibition was equivalent at all concentrations with TGF- ⁇ 1 stimulation or at 200 nM without TGF- ⁇ 1 stimulation with nearly a complete inhibition that ranged from 84.8% ⁇ 14.5% to 91.2% ⁇ 11.8% at T0+72h whereas a migration occurred for non-treated cells with 6.2% ⁇ 4.2% of free cell area.
  • TGF ⁇ nuclear transforming growth factor ⁇
  • HCT116 cells from ATCC were cultured on to the sterile coverslips in Mc Coy’s 5A medium. Cells were starved in media containing 1% FBS for 16 hrs and then stimulated with TGF ⁇ 1 (10ng/ml) at indicated time points 0hr, 3hrs 6hrs and 24 hrs.
  • TGF ⁇ R1 results and conclusion Localization of TGF ⁇ R1 was seen when stained with primary antibody (TGF ⁇ R1 polyclonal rabbit antibody - Thermofischer PA598192) (157-244 aa) 1: 300 dilution. Alexa fluor 555 (red) anti-rabbit was used as secondary ab (1:600 dilution) and DAPI (blue) for nuclear staining. Colocalization of TGF ⁇ R1 in the nucleus was analyzed with confocal imaging and z stack imaging. Images were acquired using LSM 710 Confocal microscopy. From these data we conclude that we can observe nuclear TGF ⁇ R1 in human colorectal carcinoma HCT116 cells ( Figure 36).
  • Example 23 The role of TGF ⁇ signaling in human oral squamous cell carcinoma
  • TbRI transforming growth factor b Type I receptor
  • OSCC oral squamous cell carcinoma
  • Organoid cultures The process to generated human organoids derived from patient tissues with OSCC follows the protocol described earlier in Wang et al. 2022. An organoid library of salivary gland tumors reveals subtype-specific characteristics and biomarkers. J Exp Clin Cancer Res, 2022(41):350. Briefly, patient tissues (oral squamous cell carcinoma, OSCC) were collected and trimmed into 1-3 mm 3 pieces, then, tissue pieces were incubated with 1x Dispase at 37°C for a maximum of 60 minutes with gentle agitation. After dissociation, the cell suspension was centrifuged at 800 rpm/min for 3min. Pellets were passed through 100- ⁇ m cell strainers, and then centrifuged at 1000 rpm for 5min.
  • OSCC oral squamous cell carcinoma
  • TGF ⁇ 1 (10ng/ml)
  • isotype specific control antibody Palivizumab at 100 nM plus TGF ⁇ 1 (10ng/ml)
  • full human antibody F11 at 100 nM plus TGF ⁇ 1 (10ng/ml)
  • LY2157299 10ng/ml plus TGF ⁇ 1 (10 ng/ml)
  • TGF ⁇ 1 10 ng/ml
  • the Patient Derived Organoid (PDOs) derived from patient with OSCC were treated for 48 hours.
  • the tumor budding or satellite clone around the PDOs were counted in a microscope to evaluate the biological effect treatment with TGF ⁇ 1, and F11 antibody or LY2157299 in this model.
  • the antibody Palivizumab (control antibody) was purchased from Yumab.
  • LY2157299 (Galunisertib) was purchased from MedChemExpress NJ, USA.
  • TGF ⁇ 1 was purchased from Prospec, Ness-Ziona, Israel, and used as earlier described in Zang G, Mu Y*, Gao L, Bergh A, Landström M.
  • PKC ⁇ facilitates lymphatic metastatic spread of prostate cancer cells in a mice xenograft model.
  • Statistical analyses Tumor budding or satellite clones sprouting from the primary PDOs were counted as sprouting ratio.
  • Raw data were analyzed with Graphpad Prism 9 software, and statistical analysis was performed with one-way ANOVA, *p ⁇ 0 .05, ** p ⁇ 0.01, ***p ⁇ 0.001, ****p ⁇ 0.0001. Data are presented as mean ⁇ SD.
  • Results and Discussion We performed immunohistochemical staining’s of TbRI in tissue sections derived from patients with OSCC and the results were evaluated as grouped into three categories: weak, moderate, and strong as shown in Figure 37.
  • TbRI tumor grade and TbRI expression was examined as demonstrated in Figure 38. There was a significant increase of TbRI expression in tumors with higher grade as shown in the staple diagram in Figure 38 right part.
  • treatment with TGFb1 of OSCC patient derived organoids grown in Matrigel could respond with migration of tumor cells into Matrigel (budding) and observed as expected a significant response by budding when treated with TGFb1 for 48h in presence of isotype specific control antibody.
  • TbRI kinase inhibitor Galunisertib (LY2109761) inhibited TGFb1- induced budding in both cases as shown in Figure 39a and Figure 39b. From these data we conclude that the expression of TbRI in tissue sections derived from patients with OSCC is high and correlate with higher grade seen in more aggressive forms of cancer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

La présente invention concerne des anticorps ou des fragments de liaison à l'antigène de ceux-ci qui se lient spécifiquement à la région comprenant les résidus d'acides aminés 126 à 133 du récepteur de type I de facteur de croissance transformant bêta (TGFβR1), et des compositions pharmaceutiques, des kits, des méthodes, des utilisations et des applications médicales les comprenant.
PCT/EP2023/086443 2022-12-19 2023-12-18 Anticorps du récepteur 1 anti-tgfbêta et leurs utilisations WO2024133132A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB2219154.8 2022-12-19
GBGB2219154.8A GB202219154D0 (en) 2022-12-19 2022-12-19 Antibodies and uses thereof

Publications (2)

Publication Number Publication Date
WO2024133132A1 true WO2024133132A1 (fr) 2024-06-27
WO2024133132A9 WO2024133132A9 (fr) 2024-08-22

Family

ID=85035753

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2023/086443 WO2024133132A1 (fr) 2022-12-19 2023-12-18 Anticorps du récepteur 1 anti-tgfbêta et leurs utilisations

Country Status (2)

Country Link
GB (1) GB202219154D0 (fr)
WO (1) WO2024133132A1 (fr)

Citations (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4348376A (en) 1980-03-03 1982-09-07 Goldenberg Milton David Tumor localization and therapy with labeled anti-CEA antibody
US4439196A (en) 1982-03-18 1984-03-27 Merck & Co., Inc. Osmotic drug delivery system
US4447233A (en) 1981-04-10 1984-05-08 Parker-Hannifin Corporation Medication infusion pump
US4447224A (en) 1982-09-20 1984-05-08 Infusaid Corporation Variable flow implantable infusion apparatus
US4475196A (en) 1981-03-06 1984-10-02 Zor Clair G Instrument for locating faults in aircraft passenger reading light and attendant call control system
US4486194A (en) 1983-06-08 1984-12-04 James Ferrara Therapeutic device for administering medicaments through the skin
US4487603A (en) 1982-11-26 1984-12-11 Cordis Corporation Implantable microinfusion pump system
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
US4596556A (en) 1985-03-25 1986-06-24 Bioject, Inc. Hypodermic injection apparatus
US4790824A (en) 1987-06-19 1988-12-13 Bioject, Inc. Non-invasive hypodermic injection device
US4941880A (en) 1987-06-19 1990-07-17 Bioject, Inc. Pre-filled ampule and non-invasive hypodermic injection device assembly
US5064413A (en) 1989-11-09 1991-11-12 Bioject, Inc. Needleless hypodermic injection device
US5312335A (en) 1989-11-09 1994-05-17 Bioject Inc. Needleless hypodermic injection device
US5374548A (en) 1986-05-02 1994-12-20 Genentech, Inc. Methods and compositions for the attachment of proteins to liposomes using a glycophospholipid anchor
US5383851A (en) 1992-07-24 1995-01-24 Bioject Inc. Needleless hypodermic injection device
US5399331A (en) 1985-06-26 1995-03-21 The Liposome Company, Inc. Method for protein-liposome coupling
WO1996006641A1 (fr) 1994-08-29 1996-03-07 Prizm Pharmaceuticals, Inc. Conjugues du facteur de croissance endothelial vasculaire avec des agents cibles
US5585089A (en) 1988-12-28 1996-12-17 Protein Design Labs, Inc. Humanized immunoglobulins
US5739116A (en) 1994-06-03 1998-04-14 American Cyanamid Company Enediyne derivatives useful for the synthesis of conjugates of methyltrithio antitumor agents
WO2002036771A2 (fr) 2000-11-06 2002-05-10 Cancer Research Technology Limited Imagerie, diagnostic et traitement de maladie
WO2004046191A2 (fr) 2002-11-20 2004-06-03 Cancer Research Technology Limited Anticorps, polypeptides et utilisations de ceux-ci
US20060088522A1 (en) 2004-09-10 2006-04-27 Wyeth Humanized anti-5T4 antibodies and anti-5T4/calicheamicin conjugates
US7659241B2 (en) 2002-07-31 2010-02-09 Seattle Genetics, Inc. Drug conjugates and their use for treating cancer, an autoimmune disease or an infectious disease
US20110008840A1 (en) 2002-11-07 2011-01-13 Immunogen, Inc. Anti-cd33 antibodies and methods for treatment of acute myeloid leukemia using the same
WO2011027132A1 (fr) 2009-09-03 2011-03-10 Cancer Research Technology Limited Inhibiteurs de clec14a
WO2012125623A2 (fr) * 2011-03-14 2012-09-20 Ludwig Institute For Cancer Research Ltd. Inhibiteurs de clivage du récepteur de type i du facteur de croissance transformant bêta et ses utilisations en thérapie anticancéreuse
WO2017156500A1 (fr) * 2016-03-11 2017-09-14 Scholar Rock, Inc. Immunoglobulines se liant à tgfb1 et leur utilisation

Patent Citations (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4348376A (en) 1980-03-03 1982-09-07 Goldenberg Milton David Tumor localization and therapy with labeled anti-CEA antibody
US4475196A (en) 1981-03-06 1984-10-02 Zor Clair G Instrument for locating faults in aircraft passenger reading light and attendant call control system
US4447233A (en) 1981-04-10 1984-05-08 Parker-Hannifin Corporation Medication infusion pump
US4439196A (en) 1982-03-18 1984-03-27 Merck & Co., Inc. Osmotic drug delivery system
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
US4447224A (en) 1982-09-20 1984-05-08 Infusaid Corporation Variable flow implantable infusion apparatus
US4487603A (en) 1982-11-26 1984-12-11 Cordis Corporation Implantable microinfusion pump system
US4486194A (en) 1983-06-08 1984-12-04 James Ferrara Therapeutic device for administering medicaments through the skin
US4596556A (en) 1985-03-25 1986-06-24 Bioject, Inc. Hypodermic injection apparatus
US5399331A (en) 1985-06-26 1995-03-21 The Liposome Company, Inc. Method for protein-liposome coupling
US5374548A (en) 1986-05-02 1994-12-20 Genentech, Inc. Methods and compositions for the attachment of proteins to liposomes using a glycophospholipid anchor
US4790824A (en) 1987-06-19 1988-12-13 Bioject, Inc. Non-invasive hypodermic injection device
US4941880A (en) 1987-06-19 1990-07-17 Bioject, Inc. Pre-filled ampule and non-invasive hypodermic injection device assembly
US5585089A (en) 1988-12-28 1996-12-17 Protein Design Labs, Inc. Humanized immunoglobulins
US5693762A (en) 1988-12-28 1997-12-02 Protein Design Labs, Inc. Humanized immunoglobulins
US5064413A (en) 1989-11-09 1991-11-12 Bioject, Inc. Needleless hypodermic injection device
US5312335A (en) 1989-11-09 1994-05-17 Bioject Inc. Needleless hypodermic injection device
US5383851A (en) 1992-07-24 1995-01-24 Bioject Inc. Needleless hypodermic injection device
US5399163A (en) 1992-07-24 1995-03-21 Bioject Inc. Needleless hypodermic injection methods and device
US5739116A (en) 1994-06-03 1998-04-14 American Cyanamid Company Enediyne derivatives useful for the synthesis of conjugates of methyltrithio antitumor agents
US5767285A (en) 1994-06-03 1998-06-16 American Cyanamid Company Linkers useful for the synthesis of conjugates of methyltrithio antitumor agents
US5773001A (en) 1994-06-03 1998-06-30 American Cyanamid Company Conjugates of methyltrithio antitumor agents and intermediates for their synthesis
WO1996006641A1 (fr) 1994-08-29 1996-03-07 Prizm Pharmaceuticals, Inc. Conjugues du facteur de croissance endothelial vasculaire avec des agents cibles
WO2002036771A2 (fr) 2000-11-06 2002-05-10 Cancer Research Technology Limited Imagerie, diagnostic et traitement de maladie
US7659241B2 (en) 2002-07-31 2010-02-09 Seattle Genetics, Inc. Drug conjugates and their use for treating cancer, an autoimmune disease or an infectious disease
US20110008840A1 (en) 2002-11-07 2011-01-13 Immunogen, Inc. Anti-cd33 antibodies and methods for treatment of acute myeloid leukemia using the same
WO2004046191A2 (fr) 2002-11-20 2004-06-03 Cancer Research Technology Limited Anticorps, polypeptides et utilisations de ceux-ci
US20060088522A1 (en) 2004-09-10 2006-04-27 Wyeth Humanized anti-5T4 antibodies and anti-5T4/calicheamicin conjugates
WO2011027132A1 (fr) 2009-09-03 2011-03-10 Cancer Research Technology Limited Inhibiteurs de clec14a
WO2012125623A2 (fr) * 2011-03-14 2012-09-20 Ludwig Institute For Cancer Research Ltd. Inhibiteurs de clivage du récepteur de type i du facteur de croissance transformant bêta et ses utilisations en thérapie anticancéreuse
WO2017156500A1 (fr) * 2016-03-11 2017-09-14 Scholar Rock, Inc. Immunoglobulines se liant à tgfb1 et leur utilisation

Non-Patent Citations (77)

* Cited by examiner, † Cited by third party
Title
"Remington: The Science and Practice of Pharmacy", 1995, MACK PUBLISHING CO.
"Sec. Cell Adhesion and Migration", FRONT. CELL DEV. BIOL., vol. 7, 14 June 2019 (2019-06-14)
"Sustained and Controlled Release Drug Delivery Systems", 1978, MARCEL DEKKER, INC.
AIELLO ET AL., PROC. NATL. ACAD. SCI. USA, vol. 92, 1995, pages 10457 - 10461
AKHURSTHATA, NATURE REVIEWS DRUG DISCOVERY, vol. 11, 2012, pages 790
AL-LAZIKANI ET AL., J. MOL. BIOL., vol. 273, 1997, pages 927 - 948
ALTMOG LU ET AL.: "Near-Infrared Emitting Fluorophore-Doped Calcium Phosphate Nanoparticles for In Vivo Imaging of Human Breast Cancer", ACS NANO, vol. 2, no. 10, 2008, pages 2075 - 84, XP002581639, DOI: 10.1021/nn800448r
BAGSHAWE ET AL.: "A cytotoxic agent can be generated selectively at cancersites", BR. J. CANCER., vol. 58, 1988, pages 700 - 703, XP000121545
BAGSHAWE, DRUG DEV. RES., vol. 34, 1995, pages 220 - 230
BAGSHAWE, J. CANCER, vol. 56, 1987, pages 531 - 2
BATTLE EMASSAGUE J: "Transforming Growth Factor-(3 Signaling in Immunity and Cancer", IMMUNITY, vol. 50, no. 4, 16 April 2019 (2019-04-16), pages 924 - 940, XP055942435, DOI: 10.1016/j.immuni.2019.03.024
BAUMINGERWILCHEK, METHODS ENZYMOL, vol. 70, 1980, pages 151 - 159
BERGE, S.M., J. PHARM. SCI., vol. 66, 1977, pages 1 - 19
BODY APRANAVAN GTAN THSLOBODIAN P: "Medical management of metastatic prostate cancer", AUST PRESCR, vol. 41, no. 5, 2018, pages 154 - 9
BROWN, CANCER, vol. 55, 1985, pages 2222 - 2228
BURROWSTHORPE, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 8996 - 9000
CAO ZKYPRIANOU N: "Mechanisms navigating the TGF-beta pathway in prostate cancer", ASIAN J UROL, vol. 2, no. 1, 2015, pages 11 - 8
CARTERSENTER, CANCER J, vol. 14, no. 3, 2008, pages 154 - 69
CHARI ET AL., ANGEWANDTE CHEMIE INTERNATIONAL EDITION, vol. 53, 2014, pages 3751
CHEN PEI-YU ET AL: "TGF[beta] signaling pathways in human health and disease", FRONTIERS IN MOLECULAR BIOSCIENCES, vol. 10, 1 June 2023 (2023-06-01), XP093141380, ISSN: 2296-889X, DOI: 10.3389/fmolb.2023.1113061 *
CHIN ET AL.: "In-vivo optical detection of cancer using chlorin e6 - polyvinylpyrrolidone induced fluorescence imaging and spectroscopy", BMC MEDICAL IMAGING, vol. 9, 2009, pages 1, XP021048787, DOI: 10.1186/1471-2342-9-1
CHOTHIA CLESK A M: "Canonical structures for the hypervariable regions of immunoglobulins", J MOL BIOL, vol. 196, 1987, pages 901 - 17, XP024010426, DOI: 10.1016/0022-2836(87)90412-8
COFFEY, R. J. JR. ET AL.: "Growth modulation of mouse keratinocytes by transforming growth factors", CANCER RES, vol. 48, 1988, pages 1596 - 1602
COLAK STEN DIJKE P: "Targeting TGF-β Signaling in Cancer", TRENDS IN CANCER, vol. 3, no. 1, January 2017 (2017-01-01)
DERYNCK RTURLEY SJAKHURST RJ, NAT REV CLIN ONCOL, vol. 18, no. 1, January 2021 (2021-01-01), pages 9 - 34
DOUGHERTY ET AL., J. NATL. CANCER INST., vol. 90, 1998, pages 889 - 905
DRUGS R D, vol. 11, no. 1, pages 85 - 95
FRAKER ET AL., BIOCHEM. BIOPHYS. RES. COMM., vol. 80, 1978, pages 49 - 57
GEYSEN HMMELOEN RHBARTELING: "Use of peptide synthesis to probe viral antigens for epitopes to a resolution of a single amino acid. SJ", PROC NATL ACAD SCI USA., vol. 81, no. 13, July 1984 (1984-07-01), pages 3998 - 4002, XP002621028, DOI: 10.1073/pnas.81.13.3998
GUDEY ET AL., SCIENCE SIGNALLING, vol. 7, 7 January 2014 (2014-01-07), pages ra2
GUDEY SKSUNDAR RMU YWALLENIUS AZANG GBERGH A ET AL.: "TRAF6 stimulates the tumor-promoting effects of TGFbeta type I receptor through polyubiquitination and activation of presenilin 1", SCI SIGNAL, vol. 7, no. 307, 2014, pages ra2
HARTLEY ET AL., INVEST NEW DRUGS, vol. 30, 2012, pages 950 - 958
HERBERTZ ET AL., DRUG DES DEVEL THER, vol. 9, 2015, pages 4479 - 4499
HORSMAN, ACTA ONCOL, vol. 34, 1995, pages 571 - 587
HOY SM: "Abiraterone acetate: a review of its use in patients with metastatic castration-resistant prostate cancer", DRUGS, vol. 73, no. 18, 2013, pages 2077 - 91
HUANG ET AL.: "Tumor infarction in mice by antibody-directed targeting of tissue factor to tumor vasculature", SCIENCE, vol. 275, no. 5299, 1997, pages 547 - 550, XP002071588, DOI: 10.1126/science.275.5299.547
HUGHES, NAT DRUG DISCOV, vol. 9, 2010, pages 665
ILIAKISKURTZMAN, INT. J. RADIAT. ONCOL. BIOL. PHYS., vol. 16, 1989, pages 1235 - 1241
J. LUND ET AL., J IMMUNOL, vol. 147, no. 8, 15 October 1991 (1991-10-15), pages 2657 - 2662
JEFFREY ET AL., BMCL, vol. 16, 2006, pages 358
KABAT: "Sequences of Proteins of Immunological Interest", 1991, NATIONAL INSTITUTES OF HEALTH
LASH, IN VIVO: THE BUSINESS & MEDICINE REPORT, 2010, pages 32 - 38
LS BIO: "LS-C200779 anti-TGFBR1 (ALK5) (aa 112-161)", LSBIO CATALOGUE, 1 January 2015 (2015-01-01), XP093143533, Retrieved from the Internet <URL:https://www.lsbio.com/antibodies/tgfbr1-antibody-alk5-antibody-aa112-161-wb-western-ls-c200779/208835#specifications-section> *
MAHATO ET AL., ADV DRUG DELIV REV, vol. 63, 2011, pages 659
MARTIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 9268 - 9272
MCGINN ET AL., J. NATL. CANCER INST., vol. 88, 1996, pages 1193 - 11203
MITCHELL ET AL., INT. J. RADIAT. BIOL., vol. 56, 1989, pages 827 - 836
MU ET AL., NATURE COMMS, 2011
MU YABING ET AL: "TRAF6 ubiquitinates TGF[beta] type I receptor to promote its cleavage and nuclear translocation in cancer", NATURE COMMUNICATIONS, vol. 2, no. 1, 31 May 2011 (2011-05-31), UK, XP093141355, ISSN: 2041-1723, Retrieved from the Internet <URL:https://www.nature.com/articles/ncomms1332.pdf> DOI: 10.1038/ncomms1332 *
MU YSUNDAR RTHAKUR NEKMAN MGUDEY SKYAKYMOVYCH M ET AL.: "TRAF6 ubiquitinates TGFbeta type I receptor to promote its cleavage and nuclear translocation in cancer", NAT COMMUN, vol. 2, 2011, pages 330
MU YSUNDAR RTHAKUR NEKMAN MKUMAR SYAKYMOVYCH MDIMITROU LHERMANSSON ABENGOECHEA-ALONSO MTERICSSON J: "TRAF6 ubiquitinates TGF-beta type I receptor to promote its cleavage and nuclear translocation in cancer", NATURE COMMUNICATIONS, vol. 2, 2011, pages 330
PLUCKTHUN: "The Pharmacology of Monoclonal Antibodies", vol. 113, 1994, SPRINGER-VERLAG, pages: 269 - 315
PRIMUS ET AL., BIOCONJUG. CHEM., vol. 7, 1996, pages 532 - 535
RAN ET AL., CANCER RES, vol. 58, 1998, pages 4646 - 4653
RIPPMANN ET AL.: "Fusion of the tissue factor extracellular domain to a tumour stroma specific single-chain fragment variable antibody results in an antigen-specific coagulation-promoting molecule", BIOCHEM J., vol. 349, 2000, pages 805 - 12, XP001021508
S AMEB, SALAWU A, BROWN JE: " Bone Health in Men with Prostate Cancer: Review Article", CURR OSTEOPOROS REP, vol. 17, no. 6, 2019, pages 527 - 37, XP036980404, DOI: 10.1007/s11914-019-00536-8
SALL ET AL., PROTEIN ENG DES SEL, vol. 29, 2016, pages 427 - 437
SEMENAS JALLEGRUCCI CBOORJIAN SAMONGAN NPPERSSON JL: "Overcoming drug resistance and treating advanced prostate cancer", CURR DRUG TARGETS, vol. 13, no. 10, 2012, pages 1308 - 23, XP055243526, DOI: 10.2174/138945012802429615
SENTER ET AL.: "Antitumor effects of antibody-alkaline phosphatase conjugates in combination with etoposide phosphate", PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 4842 - 4846
SHENOYSINGH, CLIN. INVEST., vol. 10, 1992, pages 533 - 551
SHEWACHLAWRENCE, INVEST. NEW DRUGS, vol. 14, 1996, pages 257 - 263
SONG ET AL., ONCOTARGET, vol. 7, no. 1, 5 January 2016 (2016-01-05), pages 279 - 92
SONG JMU YLI CBERGH AMIACZYNSKA MHELDIN CH ET AL.: "APPL proteins promote TGFbeta-induced nuclear transport of the TGFbeta type I receptor intracellular domain", ONCOTARGET, vol. 7, no. 1, 2016, pages 279 - 92
SONG JMU YLI CBERGH AMIACZYNSKA MHELDIN CHLANDSTROM M: "APPL proteins promote TGF(3-induced nuclear transport of the TGF[3 type I receptor intracellular domain", ONCOTARGET, 18 November 2015 (2015-11-18)
SONG JZHOU YYAKYMOVYCH ISCHMIDT ALI CHELDIN CH ET AL.: "The ubiquitin-ligase TRAF6 and TGFbeta type I receptor form a complex with Aurora kinase B contributing to mitotic progression and cytokinesis in cancer cells", EBIOMEDICINE, vol. 82, 2022, pages 104155
STEFAN ANDERSSON-ENGELS ET AL.: "In vivo fluorescence imaging for tissue diagnostics", PHYS. MED. BIOL., vol. 42, pages 815 - 824, XP008138564, DOI: 10.1088/0031-9155/42/5/006
T. SCHLOTHAUER ET AL., PROTEIN ENG DES SEL, vol. 29, no. 10, October 2016 (2016-10-01), pages 457 - 466
TEIXEIRA AFTEN DIJKE PZHU HJ: "On-Target Anti-TGF-beta Therapies Are Not Succeeding in Clinical Cancer Treatments: What Are Remaining Challenges?", FRONT CELL DEV BIOL, vol. 8, 2020, pages 605
TEO MYRATHKOPF DEKANTOFF P: "Treatment of Advanced Prostate Cancer", ANNU REV MED, vol. 70, 2019, pages 479 - 99
TIMMERMAN: "Functional reconstruction and synthetic mimicry of a conformational epitope using CLIPSTM technology", J. MOL. RECOGNIT., vol. 20, 2007, pages 283 - 299, XP055012496, DOI: 10.1002/jmr.846
TSAI ET AL., DIS. COLON RECTUM, vol. 38, 1995, pages 1067 - 1074
V.V. RANADE, J. CLIN. PHARMACOL, 1989
WANG B. ET AL.: "An organoid library of salivary gland tumors reveals subtype-specific characteristics and biomarkers", J EXP CLIN CANCER RES, no. 41, 2022, pages 350
WILKINSON ET AL.: "Fc-engineered antibodies with immune effector functions completely abolished", PLOS ONE, vol. 16, no. 12, 2021, XP093016187, DOI: 10.1371/journal.pone.0260954
ZANG ET AL., ONCOGENE, vol. 38, no. 22, 2019, pages 4215 - 4231
ZANG GMU Y*GAO LBERGH ALANDSTROM M: "PKOP facilitates lymphatic metastatic spread of prostate cancer cells in a mice xenograft model", ONCOGENE, vol. 38, no. 700874-72-2, 2019, pages 4215 - 4231
ZANG GMU YGAO LBERGH ALANDSTROM M: "PKCzeta facilitates lymphatic metastatic spread of prostate cancer cells in a mice xenograft model", ONCOGENE, vol. 38, no. 22, 2019, pages 4215 - 31

Also Published As

Publication number Publication date
GB202219154D0 (en) 2023-02-01
WO2024133132A9 (fr) 2024-08-22

Similar Documents

Publication Publication Date Title
JP6678627B2 (ja) 治療的低密度リポタンパク質関連タンパク質６（ｌｒｐ６）多価抗体の組成物および使用方法
AU2013278075B2 (en) Anti-jagged 1/Jagged 2 cross-reactive antibodies, activatable anti-Jagged antibodies and methods of use thereof
JP2022137092A (ja) 治療的低密度リポタンパク質関連タンパク質６（ｌｒｐ６）抗体の組成物および使用方法
US20230159643A1 (en) Agent, uses and methods for treatment
CA2977621C (fr) Nouvel anticorps se liant a la tfpi et composition le comprenant
JP6709212B2 (ja) Ｌｏｘ１特異的結合タンパク質及びその使用
JP2015501639A (ja) 抗ｃｄ９８抗体およびその使用方法
US11993658B2 (en) Anti-BCMA antibodies and treatment methods
JP7419238B2 (ja) Ｐｄ１結合剤
KR20210141992A (ko) Vegf 및 ang2에 특이적으로 결합되는 이중특이적 항체
JP2020527152A (ja) 治療のための薬剤、使用及び方法
JP2022529232A (ja) 抗ｈｅｒ２結合分子
US20240239878A1 (en) Binding molecule against dll3 and use thereof
JP2024517953A (ja) アルファ５ベータ１インテグリン結合剤及びその使用
WO2024133132A1 (fr) Anticorps du récepteur 1 anti-tgfbêta et leurs utilisations
US20230159653A1 (en) Adam17 binding molecules and uses thereof
US20210309746A1 (en) Antibodies that bind cd277 and uses thereof
TW202417516A (zh) Ptk7結合蛋白及其用途
CN118496364A (zh) uPARAP特异性结合蛋白及其制备方法和应用
WO2022078424A1 (fr) Anticorps anti-trop-2, fragment de liaison à l&#39;antigène de celui-ci ou mutant de celui-ci, et utilisation médicale associée
CN118047871A (zh) 一种靶向FRα的抗体或其抗原结合片段及其应用
Putelli Human antibody phage technology-isolation and characterization of monoclonal antibodies for the targeting of cancer and rheumatoid arthritis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23833774

Country of ref document: EP

Kind code of ref document: A1