WO2024123700A1 - Inhibiteurs d'histone désacétylase - Google Patents

Inhibiteurs d'histone désacétylase Download PDF

Info

Publication number
WO2024123700A1
WO2024123700A1 PCT/US2023/082358 US2023082358W WO2024123700A1 WO 2024123700 A1 WO2024123700 A1 WO 2024123700A1 US 2023082358 W US2023082358 W US 2023082358W WO 2024123700 A1 WO2024123700 A1 WO 2024123700A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
fold
alkyl
pharmaceutically acceptable
acceptable salt
Prior art date
Application number
PCT/US2023/082358
Other languages
English (en)
Inventor
Changning Wang
Ping Bai
Can Zhang
Shiqian SHEN
Rudolph E. Tanzi
Original Assignee
The General Hospital Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The General Hospital Corporation filed Critical The General Hospital Corporation
Publication of WO2024123700A1 publication Critical patent/WO2024123700A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/165—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • A61K31/166—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the carbon of a carboxamide group directly attached to the aromatic ring, e.g. procainamide, procarbazine, metoclopramide, labetalol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C15/00—Cyclic hydrocarbons containing only six-membered aromatic rings as cyclic parts
    • C07C15/02—Monocyclic hydrocarbons
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C237/00—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups
    • C07C237/28—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups having the carbon atom of at least one of the carboxamide groups bound to a carbon atom of a non-condensed six-membered aromatic ring of the carbon skeleton

Definitions

  • HISTONE DEACETYLASE INHIBITORS CLAIM OF PRIORITY This application claims the benefit of U.S. Patent Application Serial No. 63/385,999, filed on December 5, 2022. The entire contents of the foregoing is hereby incorporated by reference.
  • TECHNICAL FIELD This disclosure relates to the fields of chemistry, biology, and medicine, and more specifically to certain compounds that are inhibitors of histone deacetylases (HDACs), as well as compositions thereof and methods of using such compounds to treat diseases, such as those described herein.
  • HDACs histone deacetylases
  • Histone deacetylases are a class of amide hydrolases that catalyze a variety of substrates, including histones and other proteins. Eleven zinc-dependent HDACs have been found in mammals, including class I (HDAC1, HDAC2, HDAC3, HDAC8), class IIa (HDAC4, HDAC5, HDAC7, HDAC9), class IIb (HDAC6, HDAC10), and class IV (HDAC11). Each of these isoforms has distinct functions in epigenetic regulation. Among them, HDAC11 is the most recently identified member of the class IV HDAC. HDAC11 has higher expression levels in the brain than other HDACs and it has been implicated in various neurologic diseases including neurodegenerative disorders and neuropathic pain.
  • Some embodiments provide a pharmaceutical composition comprising a compound of Formula (I), or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients. Some embodiments provide a method of treating an HDAC-associated disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • FIG. 1 shows the discovery of PB94 via structure-activity (SAR) investigation of 4a and lead optimization to identify lead compound PB94.
  • FIG. 2A and FIG. 2B show the HDAC selectivity profile of 4a and PB94, respectively, and demonstrate that the selectivity for HDAC6 and HDAC11 are transposed. Dose-response curves for HDAC1-11 are included for reference.
  • FIG. 3A shows molecular docking results of 4a and FIG. 3B shows molecular docking results of PB94; docking studies used zHDAC6 crystal complex (PDB entry 6THV).
  • FIG. 4A shows PB94 docked into the homology model of HDAC11 (cartoon representation), which was constructed based on human HDAC2 (PDB: 7KBH) crystal structure using the Modeler 9.14.
  • FIG. 4B shows detailed binding interactions between PB94 and HDAC11.
  • FIG.5A shows in vitro BioMAP phenotypic activity profile of PB94 at 0.37 ⁇ M and 1.1 ⁇ M, and 3.3 ⁇ M in the Diversity PLUS Panel.
  • the X-axis lists the quantitative protein- based biomarker readouts measured in each system.
  • the grey region around the Y-axis represents the 95% significance envelope generated from historical vehicle controls.
  • Biomarker activities are annotated when two or more consecutive concentrations change in the same direction relative to vehicle controls, are outside of the significance envelope, and have at least one concentration with an effect size > 20% (
  • Antiproliferative effects are indicated by a thick grey arrow.
  • FIG. 5B shows reference benchmark overlay of PB94 (3.3 ⁇ M) and vorinostat (3.3 ⁇ M).
  • FIG. 5C shows top database search result for PB94 (3.3 ⁇ M) is parthenolide (1.2 ⁇ M).
  • FIG. 5D shows PB94 is antiproliferative to human primary endothelial cells (3.3 ⁇ M), T cells (3.3 ⁇ M), B cells (3.3 ⁇ M), and coronary artery smooth muscle cells (3.3 ⁇ M) (grey arrows).
  • FIG. 6 shows mechanism HeatMAP analysis for PB94. HeatMAP analysis of the 148 biomarker readouts (rows) within the Diversity PLUS Panel by PB94 in comparison to 19 consensus mechanism class profiles (columns).
  • FIG. 7 shows mechanism of action by which PB94 affects neuroinflammatory events was characterized by a focus on IL-10 using mouse microglia BV2 cells.
  • FIG. 9A and FIG. 9B show the time-activity curves of [ 11 C]PB94 in mice brain regions of interest, including cortex, cerebellum, brain stem, thalamus, hypothalamus, striatum, hippocampus, and amygdala.
  • FIG.10 shows the biodistribution of [ 11 C]PB94 in peripheral organs in mice at five different time points (1, 5, 15, 30, and 60 min).
  • FIG. 11B shows mechanical paw withdrawal thresholds significantly decreased in the surgery paw compared with the contralateral paw in CCI mice.
  • FIG.13C shows mouse body weight change during the treatment.
  • FIG. 14A shows representative Western blot images indicating PB94 increases endogenous fatty acylation levels of SHMT2 in HEK293T cells at the concentration of 20 ⁇ M.
  • FIG.14B shows PB94 (20 ⁇ M) and reference compound TD034 (5 ⁇ M) significantly increase endogenous fatty acylation levels of SHMT2 in HEK293T cells.
  • Signal intensity was quantified by ImageJ, and the signal of the control group (DMSO) without inhibitor treatment was set as 1.0. *p value ⁇ 0.1; **p value ⁇ 0.05; ***p value ⁇ 0.01.
  • FIG. 15 shows representative Iba1 staining of Sham, PB94 + CCI, vehicle + CCI. Images were taken at 4 ⁇ (scale bar represents 500 ⁇ m); Iba1 + cells in the boxed regions of S1HL and VPL were analyzed. (Scale bar represents 50 ⁇ m).
  • FIG.17 shows the design and discovery of selective HDAC6 inhibitor PB131.
  • FIG.18A shows the chemical structure of PB131 and its inhibitory activities against HDAC1–11.
  • FIG. 18B shows the interactions between PB131 and HDAC6 (PDB code: 6THV). Zn 2+ is shown as a gray sphere, and hydrogen bonds as dotted lines; key amino acid residues that create the specific pocket in HDAC6 are represented as a stick and labeled as shown.
  • FIG.18C shows the surface poses of PB131 in the HDAC6 hydrophobic cavity.
  • FIG. 19A and 19B show the radiosynthesis of [ 18 F]8b and [ 18 F]PB131.
  • Molar activity 108 GBq/ ⁇ mol (EOB).
  • FIG. 20A shows representative baseline PET/CT image and FIG. 20B shows blocking (pretreated with 3.0 mg/kg 8b) mice brain PET/CT images (summed from 0 to 60 min) after [ 18 F]8b injection via tail vein.
  • FIG. 20C shows time–activity curves of [ 18 F]8b in the mice whole brain.
  • FIG. 21A shows representative baseline mice brain PET/CT image
  • FIG. 21C shows mice brain PET/CT image after blocking (pretreated with 3.0 mg/kg Tubastatin A and PB131, respectively, (summed from 0 to 60 min) after [ 18 F]PB131 injection via tail vein.
  • FIG. 21 D shows time–activity curves of [ 18 F]PB131 in the mice whole brain.
  • FIG.22A shows the biodistribution of [ 18 F]PB131 in mice whole body at different time points post-injection.
  • FIG.23 shows the anti-inflammatory activity study of PB131.
  • FIG. 24 shows the anti-inflammatory activity study of PB131 (normalized protein level) The bars above each cytokine correspond to concentration in the same order from left to right as shown for IL-12P-70.
  • FIG.25 shows future chemical optimization and iterative lead optimization process.
  • FIG.26 shows representative HDAC-11 enzymatic assay results.
  • FIG. 27 shows no significant binding of CNS targets (PDSP) and metalloenzymes (MMP enzymes), Cerep/Eurofins at 10 ⁇ m PB94.
  • FIG. 28B shows body weights after dosing with PB94 or vehicle (CON).
  • FIG. 30A shows optical imaging using amyloid beta plaque probe ADLumin-1 indicate treatment of 5XFAD model mice with HDAC11 inhibitor PB94 could reduce amyloid beta plaques in the brain.
  • FIG.30B shows analysis of 3D6-stained plaque burden in hemispheres of animals and analysis of plasma immune proteins led to the identification of CXCL1 as key protein as a function of PB94.
  • FIG.31 shows in vitro intracerebral hemorrhage (ICH) study with treated mice.
  • ICH in vitro intracerebral hemorrhage
  • FIG.32A shows neuroinflammation reduction by PB94 through PET imaging using 11 CPBR28 to measure TSPO level in mice brain.
  • FIG. 32B shows standardized uptake value (SUV) for the two study arms. Bars of each arm in the brain regions are the same from left to right as indicated in the thalmus.
  • FIG. 33 shows PB94-associated improved cognitive function by behavior tests in 5XFAD mice.
  • FIG. 34 shows PB94 treatment can reduce tau in the brain as evidenced by optical imaging using tau tangles probe ADLumin-1.
  • FIG. 35 shows PB94-associated improved cognitive function by behavior tests in P301S mice.
  • FIG 36 shows HDACi reduces the ratios of the phosphorylated tau compared to total tau proteins in P301S mice.
  • FIG.38 shows an AAV1/2 expression system was used to drive the overexpression of mutant A53T human a-synuclein (aSyn) in the SNpc of rats, which results in ⁇ 60% loss of ipsilateral dopaminergic neurons after 21 days. Injection of empty AAV1/2 into contralateral SNpc provides a vector-matched, within-animal control.
  • Characteristics of this model include ipsilateral loss of dopamine cells identified with tyrosine hydroxylase staining as shown in FIG. 38A, robust ipsilateral phosphorylation of aSyn at serine 129, a pathological feature of PD-associated A53T toxicity as shown in FIG. 38B, and the formation of proteinase K-resistant aggregates of aSyn as shown in FIG.38C.
  • FIG. 40 shows dopamine transporter concentration was measured b C11-Altopane PET imaging before and after PB94 treatment.
  • the right striatum showed more severe dopamine loss at baseline.
  • FIG. 41 shows The HPLC chromatogram of [ 11 C]PB94 and unlabeled PB94.
  • the subtle difference in retention times between [ 11 C]PB94 and unlabeled PB94 is due to the different dictators.
  • the chemical structures and formulae set forth herein are constructed according to the standard rules of chemical valency known in the chemical arts.
  • Compounds described herein can comprise one or more asymmetric centers or double bonds, and thus can exist in various isomeric forms, e.g., enantiomers, diastereomers, racemates, geometric isomers, stereoisomeric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (S)-.
  • the compounds described herein can be in the form of an individual enantiomer, diastereomer or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer.
  • Isomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high pressure liquid chromatography (HPLC) and the formation and crystallization of chiral salts; or preferred isomers can be prepared by asymmetric syntheses. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, Stereochemistry of Carbon Compounds (McGraw– Hill, NY, 1962); and Wilen, Tables of Resolving Agents and Optical Resolutions p. 268 (E.L. Eliel, Ed., Univ. of Notre Dame Press, Notre Dame, IN 1972).
  • the present disclosure includes compounds in racemic and optically pure forms.
  • the compounds described herein contain olefinic bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers.
  • the disclosure additionally encompasses compounds described herein as individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers. When a range of values is listed, it is intended to encompass each value and sub– range within the range.
  • C1-C6 alkyl is intended to encompass, C1, C2, C3, C4, C5, C6, C1-C6, C1-C5, C1-C4, C1-C3, C1-C2, C2-C6, C2-C5, C2-C4, C2-C3, C3-C6, C3-C5, C3-C4, C4-C6, C4-C5, and C5-C6 alkyl.
  • alkyl refers to a radical of a straight-chain or branched saturated hydrocarbon. In some embodiments, an alkyl group has, for example, 1 to 6 carbon atoms (“C1-C6 alkyl”).
  • C1-C6 alkyl groups include methyl (C1), ethyl (C2), n–propyl (C3), isopropyl (C3), n–butyl (C4), tert–butyl (C4), sec–butyl (C4), iso–butyl (C4), n–pentyl (C5), 3–pentanyl (C5), amyl (C5), neopentyl (C5), 3–methyl–2–butanyl (C5), tertiary amyl (C5), and n–hexyl (C6).
  • alkyl abbreviations include Me (–CH 3 ), Et (–CH 2 CH 3 ), iPr (–CH(CH 3 ) 2 ), nPr (–CH 2 CH 2 CH 3 ), nBu (—CH 2 CH 2 CH 2 CH 3 ), or i–Bu (– CH 2 CH(CH 3 ) 2 ).
  • Alkenyl refers to a radical of a straight-chain or branched hydrocarbon containing at least one double bond. In some embodiments, an alkenyl group has, for example, 1 to 6 carbon atoms (“C1-C6 alkenyl”). Examples of C1-C6 alkenyl groups include vinyl, allyl, and 2-methylprop-1-en-1-yl.
  • Halo or “halogen,” independently or as part of another substituent, means a fluorine (F), chlorine (Cl), bromine (Br), or iodine (I) atom.
  • halide by itself or as part of another substituent, refers to a fluoride, chloride, bromide, or iodide atom.
  • the halo group is fluorine.
  • the halo group is chloride.
  • the halo group is bromide.
  • Haloalkyl refers to an alkyl group as described herein (e.g., a C1-C6 alkyl group) in which one or more of the hydrogen atoms are replaced by a halogen (e.g., mono- haloalkyl, di-haloalkyl and tri-haloalkyl).
  • halogen e.g., mono- haloalkyl, di-haloalkyl and tri-haloalkyl.
  • Such groups include but are not limited to, chloromethyl, fluoromethyl, difluoromethyl, trifluoromethyl, chloro-fluoroalkyl, chloro- difluoroalkyl, and 2-fluoroisobutyl.
  • Alkoxy refers to an alkyl group as described herein (e.g., a C1-C6 alkyl group), which is attached to a molecule via oxygen atom. This includes moieties where the alkyl part may be linear or branched, such as methoxy, ethoxy, n-propoxy, iso- propoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy and n-hexoxy.
  • Haloalkoxy refers to an alkoxy group as described herein (e.g., a C1-C6 alkoxy group), in which one or more of the hydrogen atoms are replaced by a halogen (e.g., mono- haloalkoxy, di-haloalkoxy and tri-haloalkoxy).
  • halogen e.g., mono- haloalkoxy, di-haloalkoxy and tri-haloalkoxy.
  • Such groups include but are not limited to, chloromethoxy, fluoromethoxy, difluoromethoxy, trifluoromethoxy, chloro-fluoroalkoxy, chloro-difluoroalkoxy, and 2-fluoroisobutoxy.
  • an aryl group has ten ring carbon atoms (“C10 aryl”; e.g., naphthyl such as 1–naphthyl and 2–naphthyl). In some embodiments, an aryl group has fourteen ring carbon atoms (“C14 aryl”; e.g., anthracyl). An aryl group may be described as, e.g., a C6-C10 aryl.
  • Aryl groups include, but are not limited to, phenyl, naphthyl, indenyl, and tetrahydronaphthyl.
  • arylene refers to a divalent aryl linking group having 6 to 14 ring carbon atoms.
  • arylene group include phenylene and naphthylene.
  • Heteroaryl refers to a radical of a 5–14 membered monocyclic, bicyclic or tricyclic 4n+2 aromatic ring system (e.g., having 6, 10 or 14 ⁇ electrons shared in a cyclic array) having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen and sulfur (“6–10 membered heteroaryl”).
  • Heteroaryl bicyclic ring systems can include one or more heteroatoms in one, two or three rings. “Heteroaryl” also includes ring systems wherein the heteroaryl ring, as defined above, is fused with one or more aryl groups wherein the point of attachment is either on the aryl or heteroaryl ring, and in such instances, the number of ring members designates the number of ring members in the fused (aryl/heteroaryl) ring system.
  • Bicyclic or tricylic heteroaryl groups wherein one ring does not contain a heteroatom e.g., indolyl, quinolinyl, carbazolyl, and the like
  • the point of attachment can be on either ring, i.e., either the ring bearing a heteroatom (e.g., 2–indolyl) or the ring that does not contain a heteroatom (e.g., 5–indolyl).
  • a heteroaryl group may be described as, e.g., a 6-10-membered heteroaryl, wherein the term “membered” refers to the non-hydrogen ring atoms within the moiety.
  • heteroarylene refers to a divalent heteroaryl linking group having 5 to 14 ring atoms.
  • heteroarylene group include indolylene, pyridinylene, and quinolinylene.
  • a heteroaryl group is a 6–10 membered aromatic ring system having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“6– 10 membered heteroaryl”).
  • a heteroaryl group is a 5–8 membered aromatic ring system having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5–8 membered heteroaryl”).
  • a heteroaryl group is a 5–6 membered aromatic ring system having ring carbon atoms and 1–4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5–6 membered heteroaryl”).
  • the 5–6 membered heteroaryl has 1–3 ring heteroatoms selected from nitrogen, oxygen, and sulfur.
  • the 5–6 membered heteroaryl has 1–2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5– 6 membered heteroaryl has 1 ring heteroatom selected from nitrogen, oxygen, and sulfur. In certain embodiments, the heteroaryl group is unsubstituted 5–14 membered heteroaryl. In certain embodiments, the heteroaryl group is substituted 5–14 membered heteroaryl. Exemplary 5–membered heteroaryl groups containing one heteroatom include, without limitation, pyrrolyl, furanyl and thiophenyl.
  • Exemplary 5–membered heteroaryl groups containing two heteroatoms include, without limitation, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl.
  • Exemplary 5–membered heteroaryl groups containing three heteroatoms include, without limitation, triazolyl, oxadiazolyl, and thiadiazolyl.
  • Exemplary 5–membered heteroaryl groups containing four heteroatoms include, without limitation, tetrazolyl.
  • Exemplary 6–membered heteroaryl groups containing one heteroatom include, without limitation, pyridinyl.
  • Exemplary 6–membered heteroaryl groups containing two heteroatoms include, without limitation, pyridazinyl, pyrimidinyl, and pyrazinyl.
  • Exemplary 6–membered heteroaryl groups containing three or four heteroatoms include, without limitation, triazinyl and tetrazinyl, respectively.
  • Exemplary 7–membered heteroaryl groups containing one heteroatom include, without limitation, azepinyl, oxepinyl, and thiepinyl.
  • Exemplary 5,6–bicyclic heteroaryl groups include, without limitation, indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranyl, benzoisofuranyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzthiazolyl, benzisothiazolyl, benzthiadiazolyl, indolizinyl, and purinyl.
  • Exemplary 6,6–bicyclic heteroaryl groups include, without limitation, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl.
  • Cycloalkyl refers to a radical of a saturated or partially unsaturated cyclic hydrocarbon group having from 3 to 10 ring carbon atoms (“C3-C10 cycloalkyl”) and zero heteroatoms in the non–aromatic ring system.
  • a cycloalkyl group has, for example, 3 to 6 ring carbon atoms (“C3-C6 cycloalkyl”).
  • Exemplary C3-C6 cycloalkyl groups include, without limitation, cyclopropyl (C3), cyclopropenyl (C3), cyclobutyl (C4), cyclobutenyl (C4), cyclopentyl (C5), cyclopentenyl (C5), cyclohexyl (C6), cyclohexenyl (C6), cyclohexadienyl (C6), and the like.
  • Cycloalkyl also includes ring systems wherein the cycloalkyl ring, as defined above, is fused with one or more aryl groups wherein the point of attachment is on the cycloalkyl ring, and in such instances, the number of carbons continue to designate the number of carbons in the cycloalkyl ring system. “Cycloalkyl” also includes bridged ring systems, e.g, bicyclo[1.1.1]pentanyl, bicyclo[3.2.1]octanyl, adamantanyl, and the like.
  • cycloalkylene refers to a divalent cycloalkyl linking group having 3 to 10 ring carbon carbons.
  • cycloalkylene groups include cyclopropylene and cyclohexylene.
  • Heterocyclyl refers to a radical of a 4-12 membered saturated or partially unsaturated ring system having ring carbon atoms and 1 to 4 ring heteroatomic groups, wherein each heteroatomic group is independently selected from nitrogen, oxygen, sulfur and oxidized forms of sulfur (for example, S, S(O) and S(O) 2 ), boron, phosphorus, and silicon (“3–12 membered heterocyclyl”).
  • heterocyclyl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon, nitrogen, phosphorus, or silicon atom, as valency permits.
  • a heterocyclyl group can either be monocyclic (“monocyclic heterocyclyl”) or a fused, bridged, or spiro ring system such as a bicyclic system (“bicyclic heterocyclyl”).
  • Heterocyclyl bicyclic ring systems can include one or more heteroatoms in one or both rings.
  • Heterocyclyl also includes ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more cycloalkyl groups wherein the point of attachment is either on the cycloalkyl or heterocyclyl ring, or ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more aryl or heteroaryl groups, wherein the point of attachment is on the heterocyclyl ring, and in such instances, the number of ring members continue to designate the number of ring members in the heterocyclyl ring system.
  • a heterocyclyl group may be described as, e.g., a 4-7-membered heterocyclyl, wherein the term “membered” refers to the non-hydrogen ring atoms, i.e., carbon, nitrogen, oxygen, and sulfur and oxidized forms of sulfur (for example, S, S(O) and S(O) 2 ), within the moiety.
  • the term “heterocyclylene”, employed alone or in combination with other terms refers to a divalent heterocyclyl linking group having 4 to 12 ring atoms. Examples of heterocyclylene groups include piperazinylene, tetrahydrofuranylene, and pyrrolidinylene.
  • Exemplary 4–membered heterocyclyl groups containing one heteroatom include, without limitation, azetidinyl, oxetanyl and thietanyl.
  • Exemplary 5–membered heterocyclyl groups containing one heteroatom include, without limitation, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, dihydrothiophenyl, pyrrolidinyl, dihydropyrrolyl and pyrrolyl–2,5–dione.
  • Exemplary 5–membered heterocyclyl groups containing two heteroatoms include, without limitation, dioxolanyl, oxasulfuranyl, disulfuranyl, and oxazolidin–2–one.
  • Exemplary 5–membered heterocyclyl groups containing three heteroatoms include, without limitation, triazolinyl, oxadiazolinyl, and thiadiazolinyl.
  • Exemplary 6–membered heterocyclyl groups containing one heteroatom include, without limitation, piperidinyl, tetrahydropyranyl, dihydropyridinyl, and thianyl.
  • Exemplary 6–membered heterocyclyl groups containing two heteroatoms include, without limitation, piperazinyl, morpholinyl, dithianyl, dioxanyl. Exemplary 6–membered heterocyclyl groups containing two heteroatoms include, without limitation, triazinanyl. Exemplary 7–membered heterocyclyl groups containing one heteroatom include, without limitation, azepanyl, oxepanyl and thiepanyl. Exemplary 8–membered heterocyclyl groups containing one heteroatom include, without limitation, azocanyl, oxecanyl and thiocanyl.
  • Exemplary 5–membered heterocyclyl groups fused to a C6 aryl ring include, without limitation, indolinyl, isoindolinyl, dihydrobenzofuranyl, dihydrobenzothienyl, benzoxazolinonyl, and the like.
  • Exemplary 6– membered heterocyclyl groups fused to an aryl ring include, without limitation, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and the like.
  • “Hydroxy” or “hydroxyl” refers to the radical -OH. Whenever a group is described as being “optionally substituted”, that group may be unsubstituted or substituted with one or more of the indicated substituents. Likewise, when a group is described as being “substituted” the substituent(s) may be selected from one or more the indicated substituents. If no substituents are indicated, it is meant that the indicated “optionally substituted” or “substituted” group may be substituted with one or more individually and independently selected group(s) that are stable and chemically acceptable for the group being substituted.
  • Non-limiting examples of optional substituents are halogen, cyano, hydroxyl, nitro, sulfhydryl, amino, acyl, alkyl, hydroxyalkyl, aminoalkyl, haloalkyl, alkenyl, alkynyl, alkoxy, alkenoxy, alkynoxy, haloalkoxy, haloalkenoxy, haloalkynoxy, cycloalkyl, halocycloalkyl, cycloalkoxy, aryl, aryloxy, arylalkoxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclyloxy, aralkyl, cycloalkylalkyl, cycloalkylalkoxy, heteroaralkyl, alkoxyalkyl, heterocyclylalkyl, O- carbamyl, N-carbamyl, alkoxycarbonyl, C-amido, N-amido, alkyl phosphine
  • one or more of the nitrogen atoms of a disclosed compound if present are oxidized to the corresponding N-oxide.
  • pharmaceutically acceptable salts is meant to include salts that are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds described herein.
  • pharmaceutically acceptable salts are obtained by reacting a compound having acidic group described herein with a base to form a salt such as an ammonium salt, an alkali metal salt, such as a sodium or a potassium salt, an alkaline earth metal salt, such as a calcium or a magnesium salt, a salt of organic bases such as dicyclohexylamine, N-methyl-D-glucamine, tris(hydroxymethyl)methylamine, and salts with amino acids such as arginine, lysine, and the like, or by other methods previously determined.
  • a salt such as an ammonium salt, an alkali metal salt, such as a sodium or a potassium salt, an alkaline earth metal salt, such as a calcium or a magnesium salt, a salt of organic bases such as dicyclohexylamine, N-methyl-D-glucamine, tris(hydroxymethyl)methylamine, and salts with amino acids such as arginine, lysine, and the like, or by other methods previously determined.
  • Examples of a salt that the compounds described herein form with a base include the following: salts thereof with inorganic bases such as sodium, potassium, magnesium, calcium, and aluminum; salts thereof with organic bases such as methylamine, ethylamine and ethanolamine; salts thereof with basic amino acids such as lysine and ornithine; and ammonium salt.
  • pharmaceutically acceptable excipients refers to a carrier or an adjuvant that may be administered to a patient, together with a compound of the present disclosure, or a pharmaceutically acceptable salt, solvate, salt of the solvate or prodrug thereof, and which does not destroy the pharmacological activity thereof and is nontoxic when administered in doses sufficient to deliver a therapeutic amount of the compound.
  • tautomer refers to compounds whose structures differ markedly in arrangement of atoms, but which exist in easy and rapid equilibrium, and it is to be understood that compounds provided herein may be depicted as different tautomers, and when compounds have tautomeric forms, all tautomeric forms are intended to be within the scope of the invention, and the naming of the compounds does not exclude any tautomer.
  • An example of a tautomeric forms includes the following example: It will be apparent to one skilled in the art that certain compounds of this disclosure may exist in tautomeric forms, all such tautomeric forms of the compounds being within the scope of the disclosure.
  • Compounds provided herein may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. That is, an atom, in particular when mentioned in relation to a compound according to Formula (I), comprises all isotopes and isotopic mixtures of that atom, either naturally occurring or synthetically produced, either with natural abundance or in an isotopically enriched form.
  • the compounds provided herein therefore also comprise compounds with one or more isotopes of one or more atoms, and mixtures thereof, including radioactive compounds, wherein one or more non-radioactive atoms has been replaced by one of its radioactive enriched isotopes.
  • Radiolabeled compounds are useful as additional agents, e.g., therapeutic agents, research reagents, e.g., assay reagents, and diagnostic agents, e.g., in vivo imaging agents. All isotopic variations of the compounds provided herein, whether radioactive or not, are intended to be encompassed within the scope of the present invention.
  • the compounds described herein (and pharmaceutically acceptable salts thereof) are isotopically labeled. In some embodiments, the compounds described herein (and pharmaceutically acceptable salts thereof) are isotopically labeled for PET imaging. In some embodiments, the compounds described herein (and pharmaceutically acceptable salts thereof) are isotopically labeled with 11 C. “Treating” or “treatment” refers to reducing the symptoms or arresting or inhibiting further development of the disease (in whole or in part). “Treating” or “treatment” includes any effect, e.g., lessening, reducing, modulating, or eliminating, that results in the improvement of the disease and the like.
  • HDAC histone deacetylase
  • An “effective amount” is an amount sufficient to accomplish a stated purpose (e.g. achieve the effect for which it is administered, treat a disease, reduce protein activity, reduce or increase protein levels, or reduce one or more symptoms of a disease).
  • an “effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a “therapeutically effective amount.”
  • the term “inhibition”, “inhibit”, “inhibiting” and the like in reference to a protein-inhibitor (e.g., antagonist) interaction means negatively affecting (e.g., decreasing) the activity or function of the protein relative to the activity or function of the protein in the absence of the inhibitor.
  • inhibition refers to reduction in the progression of a disease and/or symptoms of disease.
  • inhibition refers to a reduction in the activity of a signal transduction pathway or signaling pathway.
  • inhibition includes, at least in part, partially or totally blocking stimulation, decreasing, preventing, or delaying activation, or inactivating, desensitizing, or down-regulating signal transduction or enzymatic activity or the amount of a protein.
  • inhibition refers to a decrease in the activity of HDAC- 11 or HDAC-6.
  • a “subject,” as used herein, refers to a living organism suffering from or prone to a disease that can be treated by administration of a compound or pharmaceutical composition, as provided herein. Non-limiting examples include mammals such as humans. In some embodiments, a subject is human. In some embodiments, the subject is a pediatric subject (e.g., a subject 21 years of age or less).
  • HDAC histone deacetylase
  • HDAC-11 histone deacetylase
  • HDAC-associated disease refers to diseases associated with epigenetic regulation of histone and other protein substrates.
  • Non-limiting examples of HDAC-associated diseases include cancer, neurological diseases, metabolic/endocrine disorders, inflammatory diseases, immunological disorders, cardiovascular diseases, and pulmonary diseases.
  • HDAC-11 diseases associated with HDAC-11 specifically include Hodgkin lymphoma, neuroblastoma, various other cancers (hepatocellular, prostate, ovarian, pituitary, pancreatic, and myeloma), hepatic steatosis (fatty liver disease), insulin resistance, hypercholesterolemia, multiple sclerosis, schizophrenia, frontotemporal dementia (FTD), age-related macular degeneration, and fragile X tremor ataxia syndrome (FXTAS).
  • FDD frontotemporal dementia
  • FXTAS fragile X tremor ataxia syndrome
  • HDAC11 could have potential roles in memory and learning and recovery from traumatic brain injuries. Modulation of HDAC-11 levels after drug and alcohol intake also implicate use in drug addiction disorders.
  • Q is a bond or -NH-
  • R 1 is -OH, -C1-C4 haloalkyl, and -NH(C1-C4 alkyl)
  • R 2 is halogen, -OH, C1-C6 alkyl, and C1-C6 alkoxy
  • R 3 is hydrogen, C1-C6 alkenyl, and C1-C6 alkyl optionally substituted with C3- C6 cycloalkyl
  • R 4 is C1-C4 alkyl, phenyl, 9-15 membered heteroaryl, 9-15 membered heterocycl
  • R 1 is -NH(C1-C4 alkyl).
  • R 2 is halogen.
  • R 2 is -OH.
  • R 2 is C1-C6 alkyl.
  • R 2 is C1-C6 alkoxy.
  • R 3 is hydrogen.
  • R 3 is C1-C6 alkenyl.
  • R 3 is C1-C6 alkyl optionally substituted with C3-C6 cycloalkyl.
  • R 4 is C1-C4 alkyl optionally substituted with 1-2 R 4a .
  • R 4 is phenyl optionally substituted with 1-2 R 4a .
  • R 4 is 9-15 membered heteroaryl optionally substituted with 1-2 R 4a . In some embodiments, R 4 is 9-15 membered heterocyclyl optionally substituted with 1-2 R 4a . In some embodiments, R 3 and R 4 taken together with the nitrogen to which each is bound join to form a 9-13 membered heterocyclyl or 9-10 membered heteroaryl, each optionally substituted with R 5 . In some embodiments, R 3 and R 4 taken together with the nitrogen to which each is bound join to form a 9-13 membered heterocyclyl optionally substituted with R 5 .
  • R 3 and R 4 taken together with the nitrogen to which each is bound join to form an unsubstituted 9-13 membered heterocyclyl. In some embodiments, R 3 and R 4 taken together with the nitrogen to which each is bound join to form a 9-10 membered heteroaryl optionally substituted with R 5 . In some embodiments, the 9-10 membered heteroaryl is selected from indolyl, azaindolyl, quinazolinedionyl, and benzimidazoly.
  • the 9-10 membered heteroaryl is selected from the group consisting of indolyl, pyrrolo[2,3-b]pyridinyl, benzo[d]imidazolyl, and quinazoline-2,4- dione.
  • the 9-10 membered heteroaryl is indolyl substituted with R 5 .
  • the 9-10 membered heteroaryl is pyrrolo[2,3-b]pyridinyl substituted with R 5 .
  • the 9-10 membered heteroaryl is benzo[d]imidazolyl substituted with R 5 .
  • the 9-10 membered heteroaryl is quinazoline-2,4-dione substituted with R 5 .
  • at least one R 4a is halogen.
  • at least one R 4a is C1-C6 alkyl.
  • at least one R 4a is C1-C6 alkoxy.
  • at least one R 4a is C6-C10 cycloalkyl.
  • at least one R 4a is oxo.
  • one of R 5c and R 5d is hydrogen and the other one of R 5c and R 5d is C1-C6 alkyl substituted with oxo and/or C6-C10 cycloalkyl. In some embodiments, one of R 5c and R 5d is hydrogen and the other one of R 5c and R 5d is C1-C6 alkenyl substituted with oxo and/or C6-C10 cycloalkyl. In some embodiments, one of R 5e and R 5f is hydrogen and the other one of R 5e and R 5f is C1-C6 alkyl substituted with oxo and/or C6-C10 cycloalkyl.
  • one of R 5a , R 5b , R 5c , R 5d , R 5e and R 5f is C1-C6 alkyl substituted with oxo and/or adamantly. In some embodiments, one of R 5a , R 5b , R 5c , R 5d , R 5e and R 5f is C1-C6 alkenyl substituted with oxo and/or adamantly. In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, Formula (I) is (I-a): or a pharmaceutically acceptable salt thereof.
  • Formula (I) is (I-b): or a pharmaceutically acceptable salt thereof, wherein ring A is 9-13 membered heterocyclyl optionally substituted with R 5 .
  • Formula (I) is (I-c): or a pharmaceutically acceptable salt thereof.
  • Formula (I) is (I-d): or a pharmaceutically acceptable salt thereof.
  • Formula (I) is (I-e): or a pharmaceutically acceptable salt thereof, wherein ring B is 9-10 membered heteroaryl optionally substituted with R 5 .
  • Formula (I) is (I-f): or a pharmaceutically acceptable salt thereof, wherein X is CH or N.
  • Formula (I) is (I-g): or a pharmaceutically acceptable salt thereof.
  • Formula (I) is (I-h): or a pharmaceutically acceptable salt thereof.
  • the compound of Formula (I), or a pharmaceutically acceptable salt thereof is selected from the compounds in Table 1A, or a pharmaceutically acceptable salt thereof.
  • the compound of Formula (I), or a pharmaceutically acceptable salt thereof is selected from the compounds in Table 1B, or a pharmaceutically acceptable salt thereof.
  • the compound of Formula (I), or a pharmaceutically acceptable salt thereof is selected from the compounds in Table 1A, or a pharmaceutically acceptable salt thereof, wherein the compound is isotopically labeled. In some embodiments, the compound is isotopically labeled with 11 C.
  • the compound of Formula (I), or a pharmaceutically acceptable salt thereof is selected from the compounds in Table 1B, or a pharmaceutically acceptable salt thereof, wherein the compound is isotopically labeled. In some embodiments, the compound is isotopically labeled with 11 C. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is PB94, or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is PB94. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is [ 11 C]PB94, or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is [ 11 C]PB94.
  • Some embodiments provide a pharmaceutical composition comprising a compound of Formula (I), or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients.
  • Some embodiments provide a pharmaceutical composition comprising a compound described in Table 1A, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients. Some embodiments provide a pharmaceutical composition comprising a compound described in Table 1B, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients.
  • Some embodiments provide a method of treating an HDAC-associated disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating an HDAC-associated disease in a subject, comprising (a) determining that the subject has an HDAC-associated disease, and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating an HDAC-associated disease in a subject previously identified or diagnosed as having an HDAC-associated disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating an HDAC-associated disease in a subject previously determined to have an HDAC-associated disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating an HDAC-associated disease in a subject suspected of having an HDAC-associated disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating an HDAC-associated disease in a subject with a clinical record indicating a diagnosis of an HDAC-associated disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating an HDAC-associated disease in a subject at risk of developing an HDAC-associated disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • the HDAC-associated disease is an HDAC-11-associated disease. In some embodiments, the HDAC-associated disease is an HDAC-6-associated disease.
  • the HDAC-associated disease is cancer.
  • the cancer is a solid tumor.
  • the cancer is a blood cancer.
  • the cancer is a leukemia, lymphoma, or myeloma.
  • the cancer is a leukemia.
  • the cancer is a lymphoma.
  • the cancer is a myeloma.
  • the cancer is selected from the group consisting of: Hodgkin’s lymphoma, non-Hodgkin’s lymphoma, neuroblastoma, hepatocellular carcinoma, prostate cancer, ovarian cancer, pituitary cancer, pancreatic cancer, multiple myeloma, lung cancer (including SCLC and NSCLC), cutaneous T-cell lymphoma (CTCL), breast cancer, myelodysplastic syndromes, chronic myelomonocytic leukemia (CMML), diffuse large B-cell lymphoma (DLBCL), gastric cancer, and esophageal squamous cell carcinoma (ESCC).
  • the HDAC-associated disease is pain.
  • the pain is selected from the group consisting of: neuropathic pain, acute pain, chronic pain, nociceptive pain, and radicular pain.
  • the pain is neuropathic pain.
  • the pain is acute pain.
  • the pain is chronic pain.
  • the pain is nociceptive pain.
  • the pain is radicular pain.
  • the HDAC-associated disease is a neurodegenerative disorder.
  • the neurodegenerative disorder is selected from the group consisting of: multiple sclerosis, frontotemporal dementia (FTD), Alzheimer’s disease ataxia, Huntington’s disease, Parkinson’s disease, motor neuron disease, multiple system atrophy, progressive supranuclear palsy, dementia with Lewy bodies and amyotrophic lateral sclerosis (ALS).
  • FDD frontotemporal dementia
  • Alzheimer’s disease ataxia Huntington’s disease
  • Parkinson’s disease motor neuron disease
  • multiple system atrophy progressive supranuclear palsy
  • dementia with Lewy bodies amyotrophic lateral sclerosis
  • the HDAC-associated disease is selected from the group consisting of: neuropathic pain, Hodgkin’s lymphoma, neuroblastoma, hepatocellular carcinoma, prostate cancer, ovarian cancer, pituitary cancer, pancreatic cancer, multiple myeloma, hepatic steatosis (e.g., non-alcoholic fatty liver disease (NAFLD) or non- alcoholic steatohepatitis (NASH)), insulin resistance, hypercholesterolemia, multiple sclerosis, schizophrenia, frontotemporal dementia (FTD), age-related macular degeneration, and fragile X tremor ataxia syndrome (FXTAS).
  • NAFLD non-alcoholic fatty liver disease
  • NASH non-alcoholic alcoholic steatohepatitis
  • FXTAS fragile X tremor ataxia syndrome
  • the HDAC-associated disease is selected from the group consisting of: Hodgkin’s lymphoma, neuroblastoma, hepatocellular carcinoma, prostate cancer, ovarian cancer, pituitary cancer, pancreatic cancer, and multiple myeloma.
  • the HDAC-associated disease is Hodgkin’s lymphoma.
  • the HDAC-associated disease is neuroblastoma.
  • the HDAC-associated disease is hepatocellular carcinoma.
  • the HDAC-associated disease is prostate cancer.
  • the HDAC-associated disease is ovarian cancer.
  • the HDAC-associated disease is pituitary cancer.
  • the HDAC-associated disease is pancreatic cancer. In some embodiments, the HDAC-associated disease is multiple myeloma. In some embodiments, the HDAC-associated disease is hepatic steatosis. In some embodiments, the hepatic steatosis is NAFLD. In some embodiments, the hepatic steatosis is NASH. In some embodiments, the HDAC-associated disease is insulin resistance. In some embodiments, the HDAC-associated disease is hypercholesterolemia. In some embodiments, the HDAC-associated disease schizophrenia. In some embodiments, the HDAC-associated disease is multiple sclerosis. In some embodiments, the HDAC-associated disease is frontotemporal dementia (FTD).
  • FTD frontotemporal dementia
  • the HDAC-associated disease is neuropathic pain. In some embodiments, the HDAC-associated disease is age-related macular degeneration. In some embodiments, the HDAC-associated disease is fragile X tremor ataxia syndrome (FXTAS).
  • FXTAS fragile X tremor ataxia syndrome
  • Some embodiments provide a method of treating multiple sclerosis in a subject, comprising (a) determining that the subject has multiple sclerosis, and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating multiple sclerosis in a subject previously identified or diagnosed as having multiple sclerosis, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating multiple sclerosis in a subject previously determined to have multiple sclerosis, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating multiple sclerosis in a subject suspected of having multiple sclerosis, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating multiple sclerosis in a subject with a clinical record indicating a diagnosis of multiple sclerosis, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating multiple sclerosis in a subject at risk of developing multiple sclerosis, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject, comprising (a) determining that the subject has frontotemporal dementia (FTD), and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject previously identified or diagnosed as having frontotemporal dementia (FTD), comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject previously determined to have frontotemporal dementia (FTD), comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject suspected of having frontotemporal dementia (FTD), comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject with a clinical record indicating a diagnosis of frontotemporal dementia (FTD), comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating frontotemporal dementia (FTD) in a subject at risk of developing frontotemporal dementia (FTD), comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating neuropathic pain in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating neuropathic pain in a subject, comprising (a) determining that the subject has neuropathic pain, and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating neuropathic pain in a subject previously identified or diagnosed as having neuropathic pain, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating neuropathic pain in a subject previously determined to have neuropathic pain, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating neuropathic pain in a subject suspected of having neuropathic pain, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating neuropathic pain in a subject with a clinical record indicating a diagnosis of neuropathic pain, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating neuropathic pain in a subject at risk of developing neuropathic pain, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating cancer in a subject, comprising (a) determining that the subject has cancer, and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating cancer in a subject previously identified or diagnosed as having cancer, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating cancer in a subject previously determined to have cancer, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating cancer in a subject suspected of having cancer, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating cancer in a subject with a clinical record indicating a diagnosis of cancer, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating cancer in a subject at risk of developing cancer, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating a neurodegenerative disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating a neurodegenerative disease in a subject, comprising (a) determining that the subject has a neurodegenerative disease, and (b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating a neurodegenerative disease in a subject previously identified or diagnosed as having a neurodegenerative disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating a neurodegenerative disease in a subject previously determined to have a neurodegenerative disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating a neurodegenerative disease in a subject suspected of having a neurodegenerative disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein. Some embodiments provide a method of treating a neurodegenerative disease in a subject with a clinical record indicating a diagnosis of a neurodegenerative disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of treating a neurodegenerative disease in a subject at risk of developing a neurodegenerative disease, comprising administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition as described herein.
  • Some embodiments provide a method of inhibiting HDAC activity in a cell comprising an HDAC protein, comprising contacting the cell with an effective amount of a compound of Formula (I).
  • the cell is a human cell.
  • the cell is a neural cell.
  • the cell is a human neural cell.
  • the contacting occurs in vitro.
  • the contacting occurs in vivo.
  • the contacting occurs in vivo in the central nervous system (CNS) of a subject.
  • CNS central nervous system
  • the compound of Formula (I), or a pharmaceutically acceptable salt thereof, used in the methods described herein is selected from the compounds in Table 1A, or a pharmaceutically acceptable salt thereof.
  • the compound of Formula (I), or a pharmaceutically acceptable salt thereof, used in the methods described herein is selected from the compounds in Table 1B, or a pharmaceutically acceptable salt thereof.
  • the compound of Formula (I), or a pharmaceutically acceptable salt thereof, used in the methods described herein is PB94, or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, used in the methods described herein, is PB94.
  • the compounds described herein are selective for HDAC11 over other HDACs, such as HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9 and/or HDAC10, as measured in an assay described herein or other similar assays to measure HDAC11 inhibitory activity or designed to test similar activity and/or binding.
  • An HDAC11 inhibitor as described herein can be about 2-fold to about 10,000-fold, or more, selective for HDAC11, for example, about 2-fold, about 10- fold, about 50-fold, about 100-fold, about 200 fold, about 300-fold, about 400-fold, about 500-fold, about 600-fold, about 700-fold, about 800-fold, about 900-fold, about 1,000-fold, about 1,500-fold, about 2,000-fold, about 2,500-fold, about 3,000-fold, about 3,500-fold, about 4,000-fold, about 4,500-fold, about 5,000-fold, about 5,500-fold, about 6,000-fold, about 6,500-fold, about 7,000-fold, about 7,500-fold, about 8,000-fold, about 8,500-fold, about 9,000-fold, about 9,500-fold, or about 10,000-fold selective for HDAC11.
  • the compounds described herein are selective for HDAC6 over other HDACs, such as HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC7, HDAC8, HDAC9, HDAC10, and/or HDAC11, as measured in an assay described herein or other similar assays to measure HDAC6 inhibitory activity or designed to test similar activity and/or binding.
  • HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC7, HDAC8, HDAC9, HDAC10, and/or HDAC11 as measured in an assay described herein or other similar assays to measure HDAC6 inhibitory activity or designed to test similar activity and/or binding.
  • an HDAC6 inhibitor is selective for HDAC6 by about 2-fold to about 20- fold, about 5-fold to about 50-fold, about 10-fold to about 100-fold, about 20-fold to about 200-fold, about 50-fold to about 500-fold, about 100-fold to about 1,000 fold, about 200- fold to about 2,000-fold, about 300-fold to about 3,000-fold, about 400-fold to about 4,000 fold, about 500-fold to about 5,000-fold, about 600-fold to about 6,000-fold, about 700- fold to about 7,000 fold, about 800-fold to about 8,000-fold, about 900-fold to about 9,000- fold, or about 1,000-fold to about 10,000 fold.
  • the compounds described herein are selective for HDAC6 and HDAC11 over other HDACs, such as HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC7, HDAC8, HDAC9, and/or HDAC10, as measured in an assay described herein or other similar assays to measure HDAC6 and HDAC11 inhibitory activity or designed to test similar activity and/or binding.
  • HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC7, HDAC8, HDAC9, and/or HDAC10 as measured in an assay described herein or other similar assays to measure HDAC6 and HDAC11 inhibitory activity or designed to test similar activity and/or binding.
  • an HDAC6 and HDAC11 inhibitor is selective for HDAC6 and HDAC11 by about 2-fold to about 20-fold, about 5- fold to about 50-fold, about 10-fold to about 100-fold, about 20-fold to about 200-fold, about 50-fold to about 500-fold, about 100-fold to about 1,000 fold, about 200-fold to about 2,000-fold, about 300-fold to about 3,000-fold, about 400-fold to about 4,000 fold, about 500-fold to about 5,000-fold, about 600-fold to about 6,000-fold, about 700-fold to about 7,000 fold, about 800-fold to about 8,000-fold, about 900-fold to about 9,000-fold, or about 1,000-fold to about 10,000 fold.
  • a number of embodiments of the present disclosure have been described.
  • Mass spectrometry data were recorded on an Agilent 6310 ion trap mass spectrometer (ESI source) connected to an Agilent 1200 series HPLC with a quaternary pump, vacuum degasser, diode-array detector, and autosampler.
  • [ 11 C]CH 4 was obtained by the reduction of [ 11 C]CO 2 in the presence of Ni/hydrogen at 350 °C and recirculated through an oven containing I2 to produce [ 11 C]CH 3 I via a radical reaction.
  • Scheme 1 Synthetic routes of analogues 4a-j ⁇
  • the desired fraction [ 11 C]3g
  • SPE solid-phase exchange
  • N-heterobicyclic substituted benzyl esters (7a-e) were prepared by reacting methyl 4-(bromomethyl) benzoate (1) with corresponding commercially available heterobicyclic amines in the presence of a base. The resulting methyl esters were converted to corresponding hydroxamic acid (8a-8e) by treating aqueous NH 2 OH/NaOH solution at room temperature.
  • HDAC11 As the crystal structure of HDAC11 was not available, a Swiss-Model was used to construct an HDAC11 homology model based on human HDAC2 (PDB: 7KBH) crystal structure and carried out a molecular docking study. As depicted in FIGs.4A and 4B, PB94 exhibited a favorable conformation in the binding pocket of HDAC11. The hydroxamate group of PB94 interacts with Zn 2+ and forms a hydrogen bond.
  • the benzyl linker and residue Tyr87 form a ⁇ - ⁇ stacking interaction, and the indole-adamantane group occupies the lateral pocket of the HDAC11 structure.
  • the zHDAC6 crystal structure was obtained from Protein Data Bank (6THV, www.rcsb.org).
  • PB94 was docked with the binding pocket of HDAC6 and HDAC11 using AutoDock Vina (v 1.1.2).
  • the plots of protein-ligand interaction between PB94 and zHDAC6 as well as PB94 and HDAC11 were generated using PyMOL.
  • Example 20 Binding selectivity evaluation and in vitro phenotypic activity profile of PB94 The off-target binding of PB94 was evaluated in a panel of 46 targets (National Institute on Mental Health-Psychoactive Drug Screening Program (PDSP)) and observed no significant off-target binding at 10 ⁇ M (details presented below).
  • PDSP National Institute on Mental Health-Psychoactive Drug Screening Program
  • PB94 did not exhibit any cytotoxic effects at tested concentrations (0.37 ⁇ M – 3.3 ⁇ M) but exhibited antiproliferative activity to human primary endothelial cells, T cells, B cells, and coronary artery smooth muscle cells at 3.3 ⁇ M (grey arrows, FIG. 5D).
  • a comparative analysis of the biological activities of known bioactive agents in the BioMAP reference database was used to predict the safety, efficacy, and function of PB94.
  • Example 21 Western blot analysis
  • the tissues lysates were obtained by homogenization in cold RIPA buffer (89900, Thermo Fisher) containing proteinase inhibitor (05892970001, Roche) with a PRO200 homogenizer. Supernatants were collected and total protein concentrations were measured by using a BCA Protein Assay Kit (23227, Thermo Scientific). Equal amounts of protein (50 ⁇ g) were used for electrophoresis on 4- 20% Criterion TGX stain-free precast gels (5678095, Bio-Rad) and electrophoretically transferred onto PVDF membranes (1620264, Millipore).
  • the membranes were blocked in 3% BSA 0.5 hour at room temperature and then probed with antibody against HDAC-11 (1:1000, 09-827, Millipore) and GAPDH (1:10000, ab8245, Abcam) overnight at 4°C.
  • the blots were then incubated for 1 hour with anti-rabbit (1:5000, #7074, Cell Signaling Technology) secondary antibodies at room temperature. Signal was visualized using ECL Solution and Imager (Bio-Rad). Densitometry of protein bands was analyzed by image J. For the quantification of the protein, the band intensities were normalized by GAPDH as the internal reference. Subsequently, normalized band intensities were divided by the average of the sham group to determine normalized fold change vs. the sham group.
  • Example 22 HDAC 1-11 enzyme inhibition assays
  • the HDAC inhibition assay of target compounds were carried out at Nanosyn (Santa Clara CA, United States) using the electrophoretic mobility shift assay.
  • Full-length human recombinant HDAC proteins were expressed in the baculoviral system and purified by affinity chromatography.
  • the peptide substrates were used: FAM-RHKK(Ac)-NH 2 for HDAC3, HDAC6, and HDAC8; FITC-H3K27(Ac)-NH 2 for HDAC1, HDAC2, and HDAC10; and FAM-RHKK (tri-fluor-Ac)-NH 2 for HDAC4, HDAC5, HDAC7, HDAC9, and HDAC11.
  • Test compounds were diluted in 100% DMSO using 3-fold dilution steps. The final compound concentration in the assay ranged from 10 ⁇ M to 0.056 nM.
  • Compound, enzymes (Table 3), and substrate were combined in reaction buffer (100 mM N-2-hydroxyethylpiperazine-N ⁇ -2-ethanesulfonic acid [HEPES; pH 7.5], 25 mM KCl, 0.1% bovine serum albumin, 0.01% Triton X-100) at 25°C and quenched by the addition of termination buffer (100 mM HEPES [pH7.5], 0.01% Triton X-100, 0.05% sodium dodecyl sulfate).
  • reaction buffer 100 mM N-2-hydroxyethylpiperazine-N ⁇ -2-ethanesulfonic acid [HEPES; pH 7.5], 25 mM KCl, 0.1% bovine serum albumin, 0.01% Triton X-100
  • termination buffer 100 mM H
  • Example 23 Defatty acylation of SHMT2 assays
  • SHMT2 was identified as a defatty-acylation substrate of HDAC11 in cells.
  • HEK293T cells were treated with PB94 to test whether it could upregulate the fatty acylation level of SHMT2 via HDAC11 inhibition.
  • HEK293T was incubated with Alk14 (an alkyne-tagged myristic acid analog) and PB94 at different concentrations for 3 hours. Then, the Alk14- labeled SHMT2 was conjugated with biotin using click chemistry, pulled down with streptavidin, and measured by Western blot.
  • HDAC11 inhibitor TD034, was used as the reference compound.
  • PB94 significantly increased the fatty acylation level of SHMT2 at the concentration of 20 ⁇ M (FIG. 14), indicating it has HDAC11 inhibitory activity in cells.
  • SDS lysis buffer 50 mM triethanolamine, 150 mM NaCl, 4% SDS, pH 7.4
  • HEPES buffer 50 mM HEPES, 150 mM NaCl, 1% NP-40, pH 7.4
  • magnetic streptavidin beads 10 ⁇ g were suspended in HEPES buffer (100 ⁇ L), after which Biotin-N 3 (5 ⁇ L, 5 mM in DMF) was added.
  • the mixture was shaken at 37 °C for 30 minutes, then the supernatant was removed, and the beads were washed with HEPES buffer (1 x 100 ⁇ L). The mixture was shaken for 1 h at 37°C, and the supernatant was removed.
  • HDAC11 protein level increased in neuropathic pain
  • the primary somatosensory cortex has been previously identified as a key brain region implicated in pain processing.
  • HDAC11 expression was assessed in the primary somatosensory cortex after CCI injury by qPCR. Notably, HDAC11 protein significantly increased in the cortex compared with sham mice 14 days after surgery (FIG. 11A). HDAC6 expression levels were less effected by CCI injury.
  • Procedure using qPCR analysis A one-step real-time PCR was performed using iTaqTM Universal SYBR® Green One-Step Kit (BioRad 1725150) in a Thermofisher 7500 fast thermocycler.
  • the primer sequences are as follows: GAPDH: CATCACTGCCACCCAGAAGACTG ((forward) and ATGCCAGTGAGCTTCCCGTTCAG (reverse); HDAC11: ATGGGGCAAGGTGATCAACT (forward) and AGGACCACTTCAGCTCGTTG (reverse).
  • GAPDH CATCACTGCCACCCAGAAGACTG
  • ATGCCAGTGAGCTTCCCGTTCAG reverse
  • HDAC11 ATGGGGCAAGGTGATCAACT
  • AGGACCACTTCAGCTCGTTG reverse
  • Mouse brain tissue was harvested one week after sham or CCI surgery, followed by RNA isolation using Trizol. Melting curve and Ct value used for quantification. Gapdh was used as the internal control for normalization for each sample.
  • Example 25 Example 25.
  • PET/CT imaging in rodents To investigate the pharmacokinetics of PB94 in vivo, radiolabeled PB94 was used for PET imaging studies using [ 11 C]PB94 in rodents.
  • [ 11 C]PB94 was prepared through a two-step reaction using 3g as the precursor (FIG. 8).
  • CT computed tomography
  • the representative PET/CT images focused on the mice brain (coronal, sagittal, and axial, summed from 0 to 60 minutes) and time-activity curves (TACs) of eight brain regions of interest are shown in FIG.
  • [ 11 C]PB94 exhibited significant blood-brain-barrier (BBB) penetration and fast brain uptake, with the maximum %ID/cc (percent injected dose per cc tissue) of 2.8 in the whole brain at the first few minutes post-injection.
  • Regional brain analysis was carried out using the FUSION module (Ma-Benveniste-Mirrione) in PMOD (PMOD 4.003, PMOD Technologies Ltd., Zurich, Switzerland). Heterologous distribution of radioactivity was observed in eight ROIs, indicating the heterologous expression level of HDAC11 in brain regions. Of note, relatively high radioactivity uptake was found in the striatum, cortex, and amygdala, while the cerebellum and brain stem showed lower radioactivity uptake.
  • mice that underwent CCI to assess the development of nociceptive behavior.
  • the hind paw mechanical withdrawal thresholds ipsilateral to the injury side decreased after surgery and remained at low levels from day 3 to day 14.
  • no significant change in mechanical pain thresholds was observed in the contralateral paw.
  • mice were treated with PB94 at different doses, and mechanical withdrawal thresholds were examined. Single-dose injection of PB94 was able to increase mechanical withdrawal thresholds (FIG.
  • PWTs of CCI mice were measured every 30 min during a 3-hour period after PB94 administration.
  • Example 28 Hindpaw withdrawal latency Mice were placed on a preheated glass platform (28 - 29°C) and clear Plexiglas cubicles to acclimate to the testing room 30 minutes daily for 3 consecutive days before the testing. A radiant heat source emitted from underneath the glass and focused on the middle of the hindpaws of mice. Paw withdrawal latency was defined as the time (seconds) from the initiation of heat exposure to the hind paw withdrawal.
  • a cut-off time was set at 20 seconds to avoid tissue damage.
  • Example 29 Examination of analgesic effect of PB94 by Iba-1 staining To interrogate potential mechanisms that are linked to the analgesic effect of PB94, brain samples of mice received 14 days of PB94 treatment were stained for Iba-1, a microglia marker. Microglia-mediated neuroinflammation has been shown to be critical for the development of neuropathic pain, including pain in the CCI model.
  • mice were transcranial perfused with ice-cold PBS followed by 4% paraformaldehyde. Extracted mouse brains were stored at 4°C with 4% PFA fixation for two days.
  • brains were sliced at 40 ⁇ m in thickness using a Leica vibratome (VT 1000s).
  • the desired slices were bathed in a blocking buffer containing 0.03% Tween-20 and 5% BSA for 1h at room temperature.
  • the primary antibody (Iba1; 1:1000; Wako) in PBS was incubated at 4°C overnight.
  • the slices were incubated with the second antibody of anti-rabbit Alexa488 (1:2000; Invitrogen) for one hour at room temperature.
  • images were taken at 4x and 20 ⁇ magnification for analysis. Images were analyzed using ImageJ (NIH open-source software).
  • Example 30 Example 30.
  • CYP inhibition assay of PB94 Phenacetin, acetaminophen, (+)-N-3-Benaylnirvanol, ⁇ -Naphthoflavone, diclofenac, sulfaphenazole, dextrorphan tartrate, quinidine, testosterone, 6- hydroxytestosterone, ketoconazole were purchased from Sigma (St. Louis, MO, USA). 4- Hydroxydiclofenac, s-mephenytoin, 4- hydroxymephenytoin, dextromethorphan, ticlopidine were purchased from TRC (Toronto, Canada).
  • incubation mixtures contained pooled human liver microsome (0.5 mg/mL), 3.0 mM MgCl 2 , specific substrate of each isoform, and probe inhibitor or test compound (10 and 0 ⁇ M) in 0.1 M potassium phosphate buffer (total volume 0.1 mL).
  • the final concentrations of substrates and inhibitors are listed in the table above.
  • Final concentration of organic solvent is less than 1% (v/v). The mixture was pre- incubated for 10 min at 37 °C. Then, 1 mM NADPH was added to initiate reaction.
  • incubation mixtures contained pooled human liver microsome (0.1 mg/mL), 3.0 mM MgCl 2 , specific substrate of each isoform, and probe inhibitor or test compound (10 and 0 ⁇ M) in 0.1 M potassium phosphate buffer (total volume 0.1 mL). The final concentrations of substrates and inhibitors are listed in the table above. Final concentration of organic solvent is less than 1% (v/v). The mixture was pre-incubated for 10 min at 37 °C.
  • IP intraperitoneal
  • PB94 Hepatocyte stability Test compound PB94 was weighed and dissolved in 100% DMSO to get 10 mM stock solution. The stock solution was diluted to 500 ⁇ M with mixture of methanol and H 2 O (1:1). The final concentrations of DMSO and methanol were equal or less than 0.1%. Stock solutions of testosterone and 7-ethoxycoumarin were prepared at a concentration of 10 mM in 100% DMSO, respectively.
  • the stock solution for each compound was diluted into 500 ⁇ M or 100 ⁇ M with mixture of methanol and H 2 O (1:1) .
  • the final concentrations of DMSO and methanol were equal or less than 0.1%.
  • Hepatocytes incubations were conducted in duplicate in 96-well plates. Each well contains 50 ⁇ L of williams E medium containing 1*glutamax and 1 million/mL hepatocytes and test compound (5 ⁇ M) or positive control compound (5 ⁇ M or 1 ⁇ M). Reactions in appropriate wells as designed were terminated at various time points (0, 15, 30, 60, 120 min) by adding 200 ⁇ L of ice-cold acetonitrile containing internal standard.
  • Each well contains 40 ⁇ L of 0.1 M potassium phosphate buffer (pH 7.4), 4.125 mM MgCl 2 , 0.625 mg/mL liver microsomes, and test compound (1.25 ⁇ M) or positive control.
  • 10 ⁇ L of 5.0 mM NADPH in 0.1 M potassium phosphate buffer was added to initiate the enzymatic reaction.
  • the final component concentrations are 0.1 M potassium phosphate buffer (pH 7.4), 1.0 mM. NADPH, 3.3 mM MgCl 2 , 0.5 mg/mL liver microsomes, and test compound (1.0 ⁇ M) or positive control (1.0 ⁇ M).
  • Reactions were terminated at various time points (0, 5, 10, 20, 40 min) by adding 200 ⁇ L of ice-cold acetonitrile containing internal standard.
  • a parallel incubation was performed using 0.1 M potassium phosphate buffer (pH 7.4) instead of NADPH as the negative control, and reactions was terminated at 40 min after incubation at 37°C.
  • Samples were analyzed by HPLC- MS/MS and peak areas were recorded for each analyte. The peak area ratio of test compound to internal standard will be plotted as a percentage of the relevant zero time point control (%Remained) for each reaction.
  • the rate of metabolism (k) is the slope of the linear regression from log percentage remaining versus incubation time.
  • the in vitro T1/2 is calculated as -0.693/k.
  • Example 34 Acute toxicity assays To investigate the safety profile of PB94, acute toxicity was evaluated in mice. The results showed that there is no observed adverse effect after treating the BP94 at 200 mg/kg.
  • the biochemical analysis showed that BP94 administration didn’t change the important kidney and liver function indexes, such as uric acid and alanine aminotransferase, as well as electrolytes including Na + , K + , Cl-.
  • the blood analysis showed that BP94 administration didn’t change the blood count indexes, including red blood cells, white blood cells, and blood platelets (FIG.28A). And there are no significant differences in body weight between control (FIG.28B).
  • mice Male and female mice (Balb/c) (around 20 g, 5 weeks old) were procured from HFK Biotechnology Company (Beijing, China) with Animal Quarantine Conformity Certificates. Mice were maintained at around 20 °C and 55% humidity, with a 12 h light/dark cycle and ad libitum food/water. The acute toxicity assays on animals were performed in conformity with the ARRIVE guidelines which were approved by the Institutional Animal Care and Treatment Committee of West China Hospital (Permit Number: 20230105003).
  • mice received an intraperitoneal dose of BP94 at 200 mg/kg.
  • the control group was given the solvent.
  • the body weight of the mice was recorded every three days. After a fortnight, the mice were euthanized. Blood samples were taken for both biochemical and routine blood examinations. Additionally, primary organs such as the heart, liver, spleen, lungs, and kidneys were harvested for H&E staining.
  • Example 35 In Vitro ADME Evaluation and In Vivo Pharmacokinetic Profiling of PB94 In vitro ADME assessments were carried out to evaluate the drug-like profiles of PB94. Data shown in Table 8 indicate that PB94 possesses good metabolic stability in human liver microsomal and mouse plasma, with half-lives (t1/2) of 54.6 min and 133.8 min, respectively.
  • cytochrome P450 enzymes CYPs 1A2, 2C19, and 2D6 at 10 ⁇ M of PB94.
  • the pharmacokinetic (PK) profiles of PB94 were assessed by administrating 10 mg/kg PB94 intravenously (i.v) and orally (p.o) in mice. Results show that PB94 had suitable PK properties with a half-life of 5.3 hours by p.o. administration. Of note, PB94 showed less favorable bioavailability when by oral administration (11.2 %).
  • PB94 showed less favorable bioavailability when by oral administration (11.2 %).
  • to evaluate the brain permeability of PB94 in vivo brain/plasma pharmacokinetic studies were performed by IP administrating PB94 at 1mg/kg in C57BL/6 mice. As a result, PB94 exhibited good brain permeability, with brain/plasma ratios of 2.3 at 30 min and 2.2 at 4 h post-injection. Table 8. ADME/PK studies of PB94 ⁇
  • Example 37 Cell-based Assay of PB94 Using Mouse Microglia BV2 Cells HDAC11 is characterized by immune regulatory functions involving regulation of IL-10.
  • a mechanistic study was performed in order to evaluate whether PB94 may affect neuroinflammatory events with a focus on IL-10 using mouse microglia BV2 cells.
  • Mouse microglia BV2 cells were induced by the well-characterized and previously reported immune-stimulating molecule lipopolysaccharides (LPS), alone or in combination with PB94, to assess inflammatory changes as a function of PB94.
  • LPS immune-stimulating molecule lipopolysaccharides
  • PB94 significantly reduced IL-10 expression in LPS (10 ng/ml) treated cells (FIG.7), indicating the inflammation regulatory activity of PB94.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente divulgation concerne certains composés qui sont des inhibiteurs d'histone désacétylase (HDAC), ainsi que des compositions de ceux-ci et des méthodes d'utilisation de tels composés pour traiter des maladies, telles que celles décrites ici.
PCT/US2023/082358 2022-12-05 2023-12-04 Inhibiteurs d'histone désacétylase WO2024123700A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263385999P 2022-12-05 2022-12-05
US63/385,999 2022-12-05

Publications (1)

Publication Number Publication Date
WO2024123700A1 true WO2024123700A1 (fr) 2024-06-13

Family

ID=91380086

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/082358 WO2024123700A1 (fr) 2022-12-05 2023-12-04 Inhibiteurs d'histone désacétylase

Country Status (1)

Country Link
WO (1) WO2024123700A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040214862A1 (en) * 2001-06-15 2004-10-28 Ulrike Leser-Reiff Aromatic dicarboxylic acid derivatives
US20170037059A1 (en) * 2009-09-11 2017-02-09 Merck Sharp & Dohme Corp. Gyrase inhibitors
US20190375735A1 (en) * 2017-01-10 2019-12-12 Cstone Pharmaceuticals (Suzhou) Co., Ltd. HDAC6 Selective Inhibitors, Preparation Method Therefor, and Application Thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040214862A1 (en) * 2001-06-15 2004-10-28 Ulrike Leser-Reiff Aromatic dicarboxylic acid derivatives
US20170037059A1 (en) * 2009-09-11 2017-02-09 Merck Sharp & Dohme Corp. Gyrase inhibitors
US20190375735A1 (en) * 2017-01-10 2019-12-12 Cstone Pharmaceuticals (Suzhou) Co., Ltd. HDAC6 Selective Inhibitors, Preparation Method Therefor, and Application Thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE PUBCHEM SUBSTANCE 22 April 2017 (2017-04-22), ANONYMOUS: "SCHEMBL18485212", XP093182531, Database accession no. 333585490 *

Similar Documents

Publication Publication Date Title
JP6788683B2 (ja) 複素環化合物
CA2948721C (fr) Composes heterocycliques deuteres et leur utilisation comme agents d'imagerie
JP4604129B2 (ja) ムスカリン受容体アンタゴニストとしてのキヌクリジノール誘導体
JP2020502047A (ja) Ｍａｇｌ阻害剤
JP2011506487A (ja) トランスロケータータンパク質リガンド
KR20190077544A (ko) Magl 억제제
CN109651359B (zh) 取代的烟酰胺类化合物及药物组合物及其用途
HUE035413T2 (en) Diazacarbazole derivatives as tau-PET ligand
HUE030172T2 (en) Tau imaging probe
CN110179791B (zh) 细胞坏死抑制剂tak-632及其作为药物的用途
JP2022508699A (ja) Ｌｐａ１受容体のイメージングのための放射性リガンド
KR20120094056A (ko) Ｍｇｌｕ２ 효능제
KR20230040953A (ko) 치환된 피페리딘 화합물 및 이의 적용례
JP2015523385A (ja) τリン酸化を阻害する方法
WO2022174193A1 (fr) Compositions radiomarquées et leurs procédés d'utilisation
JP2012507534A (ja) 新規置換アザベンゾオキサゾール類
EP4089102A1 (fr) Modulateurs de la activité de sortiline
JP7492005B2 (ja) ベンゼン環含有化合物及びその応用
JP2022532810A (ja) 選択的ｂａｃｅ１阻害活性を有する縮合複素環誘導体
US8722714B2 (en) Oxazolidine derivatives as NMDA antagonists
WO2016079669A1 (fr) Dérivés d'aminopyrimidine marqués
WO2024123700A1 (fr) Inhibiteurs d'histone désacétylase
US9724435B2 (en) Highly selective sigma receptor ligands and radioligands as probes in nociceptive processing and the pathphysiological study of memory deficits and cognitive disorders
EP3793552A1 (fr) Inhibiteurs d'abhd12 et leurs procédés de fabrication et d'utilisation
TW201206485A (en) Compounds for binding and imaging amyloid plaques and their use