WO2024117677A1 - 가뭄내성 증진을 위한 CaAIBZ1 유전자교정 고추의 제조방법 - Google Patents

가뭄내성 증진을 위한 CaAIBZ1 유전자교정 고추의 제조방법 Download PDF

Info

Publication number
WO2024117677A1
WO2024117677A1 PCT/KR2023/019049 KR2023019049W WO2024117677A1 WO 2024117677 A1 WO2024117677 A1 WO 2024117677A1 KR 2023019049 W KR2023019049 W KR 2023019049W WO 2024117677 A1 WO2024117677 A1 WO 2024117677A1
Authority
WO
WIPO (PCT)
Prior art keywords
pepper
gene
caaibz1
genome
base sequence
Prior art date
Application number
PCT/KR2023/019049
Other languages
English (en)
French (fr)
Inventor
우제욱
한지학
강민성
문아람
성은지
박윤지
Original Assignee
주식회사 툴젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 툴젠 filed Critical 주식회사 툴젠
Publication of WO2024117677A1 publication Critical patent/WO2024117677A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/10—Seeds
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/82—Solanaceae, e.g. pepper, tobacco, potato, tomato or eggplant
    • A01H6/822—Capsicum sp. [pepper]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Definitions

  • the present invention relates to a method of producing CaAIBZ1 ( Capsicum annuum ASRF1-Interacting bZIP transcription factor 1) gene-edited pepper for improving drought tolerance.
  • CaAIBZ1 Capsicum annuum ASRF1-Interacting bZIP transcription factor 1
  • Pepper Capsicum annuum L.
  • More than 90% of sweet peppers and chili peppers are grown in open fields, and in countries such as India and China, where pepper cultivation density is high, production sometimes drops sharply due to drought and water shortage during the growing season.
  • As there are currently no drought-tolerant pepper genetic resources it is difficult to develop varieties that adapt to various environmental changes such as drought using existing traditional breeding and MAS (maker-assisted selection) breeding.
  • gene editing technology can develop new genetic resources, making it possible to develop drought-resistant peppers.
  • the guide RNA for the target gene that confers drought tolerance characteristics was inserted into a GFP (green fluorescent protein) and Cas9 expression vector, a gene correction body was developed through pepper transformation, and then drought-tolerant peppers were selected.
  • GFP green fluorescent protein
  • Korean Patent Publication No. 2015-0106528 discloses ‘ MSRB2 gene derived from pepper that increases abiotic stress tolerance of plants and its use’
  • Korean Patent Publication No. 2013-0055050 discloses ‘East Sea and drought-resistant pepper.
  • the 'transcription factor CaWRKY1 gene and its use' is disclosed, there is no description of the 'method for producing CaAIBZ1 gene-edited peppers for improving drought tolerance' of the present invention.
  • the present invention was developed in response to the above-mentioned needs, and the present inventor constructed a CRISPR vector containing gRNA targeting the drought tolerance-related gene CaAIBZ1 and Cas9 and GFP expression cassettes. Afterwards, the vector was transformed into pepper cotyledon explants using Agrobacterium, and a genome-edited plant with a corrected target region was obtained. Afterwards, as a result of performing a drought tolerance experiment of single irrigation and re-irrigation using the T 2 generation genome correction plants, the bi-allelic correction plants of the CaAIBZ1 gene showed a significant increase compared to the control (non-correction plants) and the mono-allelic correction plants. The present invention was completed by confirming that it exhibits drought tolerance.
  • the present invention is a complex of guide RNA and endonuclease protein specific to the target base sequence of the pepper-derived CaAIBZ1 ( Capsicum annuum ASRF1-Interacting bZIP transcription factor 1) gene ( ribonucleoprotein); Or a recombinant vector comprising DNA encoding a guide RNA specific for the target base sequence of the pepper-derived CaAIBZ1 gene and a nucleic acid sequence encoding an endonuclease protein; for improving drought tolerance of pepper plants, containing as an active ingredient
  • a composition for genome editing is provided.
  • the present invention includes the steps of (a) correcting the genome by introducing guide RNA and endonuclease protein specific to the target base sequence of the pepper-derived CaAIBZ1 gene into pepper plant cells; and (b) redifferentiating pepper plants from the genome-corrected pepper plant cells.
  • the present invention provides a genome-edited pepper plant with improved drought tolerance prepared by the above method and a seed whose genome has been corrected.
  • the genome-edited pepper plants with improved drought tolerance produced through the method of the present invention can be usefully used in the future to secure drought-tolerant pepper genetic resources and develop high value-added pepper varieties.
  • the method of the present invention does not involve the insertion of foreign genes and only has small mutations that cannot be distinguished from natural mutations, so GMO (Genetically Modified Organism) crops require enormous costs and time to evaluate safety and environmental hazards. Unlike other methods, it is expected to save cost and time.
  • FIG. 1 is a schematic diagram of the CRISPR-Cas9 vector pCam-CaAIBZ1 for editing the pepper CaAIBZ1 gene.
  • the pepper gene editing vector has a pCambia vector backbone and is structured to simultaneously contain gRNA expression, Cas9 expression cassettes, and GFP expression cassettes.
  • Cas9 expression is regulated by the Cauliflower mosaic virus (CaMV) 35S promoter, and CaAIBZ1 gene target gRNA is expressed by the AtU6 promoter.
  • CaMV Cauliflower mosaic virus
  • LB T-DNA left border
  • NLS nuclear localization signal
  • pCas9 Plant-codon optimized spCas9
  • 2A 2A self-cleaving peptide
  • eGFP enhanced green fluorescent protein
  • CaMV35S P Cauliflower mosaic virus (CaMV) 35S promoter
  • 35S(T) CaMV 35S terminator
  • NOS-T nopaline synthase terminator
  • NPTII neomycin phosphotransferase II (kanamycin resistance determinants)
  • RB T-DNA right border.
  • Figure 2 shows the target guide RNA location and sequence of the CaAIBZ1 gene on the pepper genome, where the color bar represents the target RNA location, the black bar represents the PAM location, the arrow represents the expected cleavage site, and the black box represents the exon region on the genome.
  • Figure 3 shows the results of analyzing the proofreading efficiency of target gRNA using RNP (sgRNA/Cas9 protein) in pepper protoplasts.
  • Figure 4 shows the process of securing pepper transformants, showing the growth process from pepper cotyledon explants through the callus stage to redifferentiation and small plants.
  • FIG. 5 shows a CaAIBZ1 gene-edited pepper plant (T 0 ) that has been planted in a pot and is flowering in a plant growth room.
  • Figure 6 shows NGS results analyzing the correction pattern of the CaAIBZ1 gene-corrected pepper T 0 individual.
  • Figures 7 and 8 are NGS results analyzing the correction pattern of the CaAIBZ1 gene-corrected pepper T 1 individual.
  • Figure 9 shows the appearance of CaAIBZ1 gene-corrected pepper T 1 generation plants for securing T 2 seeds for drought tolerance experiments.
  • Figure 10 shows the results of a drought tolerance test of a pepper T 2 individual in which the CaAIBZ1 gene was corrected.
  • Figure 11 shows the results of a survival rate experiment after re-watering of pepper T 2 individuals in which the CaAIBZ1 gene was corrected.
  • Figure 12 is the result of PCR analysis to confirm whether the T-DNA is free of the pepper T 2 individual in which the CaAIBZ1 gene was corrected.
  • M 1kb marker
  • N wild type
  • P vector
  • 10-1 #1 ⁇ 12-18 #1 CaAIBZ1 gene edited hot pepper T 2 plants.
  • the present invention is a guide RNA specific to the target base sequence of the pepper-derived CaAIBZ1 ( Capsicum annuum ASRF1-Interacting bZIP transcription factor 1) gene and an endonuclease protein. complex (ribonucleoprotein); Or a recombinant vector containing DNA encoding a guide RNA specific for the target base sequence of the pepper-derived CaAIBZ1 gene and a nucleic acid sequence encoding an endonuclease protein; for improving drought tolerance of pepper plants, containing as an active ingredient A composition for genome editing is provided.
  • the pepper-derived CaAIBZ1 Capsicum annuum ASRF1-Interacting bZIP transcription factor 1
  • complex ribonucleoprotein
  • a recombinant vector containing DNA encoding a guide RNA specific for the target base sequence of the pepper-derived CaAIBZ1 gene and a nucleic acid sequence encoding an endonuclease protein for improving drought tolerance
  • the target gene for genome editing to improve drought tolerance of pepper plants is the CaAIBZ1 gene, GenBank accession no: LY715037.1.
  • gene/gene editing refers to a technology that can introduce target-directed mutations into the genome sequence of animal and plant cells, including human cells, and is a technique for deleting nucleic acid molecules by cutting DNA. Knock-out or knock-in of a specific gene by deletion, insertion, or substitution, or non-coding that does not produce a protein This refers to a technology that can introduce mutations into the DNA sequence.
  • gene editing may be used interchangeably with “gene editing.”
  • the genome editing may be to introduce mutations into plants using endonuclease such as Cas9 (CRISPR associated protein 9) protein and guide RNA.
  • endonuclease such as Cas9 (CRISPR associated protein 9) protein and guide RNA.
  • target gene refers to some DNA within the genome of a plant to be corrected through the present invention, and may include both coding regions and non-coding regions. A person skilled in the art can select a target gene for the genome editing plant to be produced, depending on the purpose.
  • guide RNA refers to a short single-stranded RNA, which includes RNA specific to the target DNA among the base sequences encoding the target gene, and all or part of it binds complementary to the target DNA base sequence. It refers to a ribonucleic acid that plays the role of guiding an endonuclease protein to the target DNA base sequence.
  • the guide RNA is a dual RNA containing two RNAs, namely crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; or a single chain comprising a first portion comprising a sequence that is fully or partially complementary to a base sequence in the target gene and a second portion comprising a sequence that interacts with an endonuclease (particularly an RNA-guide nuclease).
  • CRISPR RNA crRNA
  • tracrRNA trans-activating crRNA
  • RNA single guide RNA, sgRNA
  • endonuclease it refers to a guide RNA (single guide RNA, sgRNA) form, but as long as the endonuclease is in a form that can be active at the target base sequence, it can be included within the scope of the present invention without limitation, and the type of endonuclease or endonuclease used together It can be manufactured and used according to techniques known in the art, taking into account the microorganism from which the nuclease is derived.
  • the guide RNA may be transcribed from a plasmid template, transcribed in vitro (e.g., oligonucleotide double-stranded), or synthesized guide RNA, but is not limited thereto.
  • the guide RNA is specifically designed for the target base sequence of the pepper-derived CaAIBZ1 gene consisting of the base sequence of SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 4.
  • the endonuclease protein is Cas9, Cpf1 (CRISPR from Prevotella and Francisella 1, also known as CAs12a), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc) Finger Nuclease) or a functional analog thereof may be one or more selected from the group consisting of, preferably Cas9 protein, but is not limited thereto.
  • the Cas9 protein is a Cas9 protein derived from Streptococcus pyogenes , a Cas9 protein derived from Campylobacter jejuni, a Streptococcus thermophilus ( S. thermophilus ) or a Streptococcus aureus ( S. aureus )-derived Cas9 protein, Neisseria meningitidis -derived Cas9 protein, Pasteurella multocida -derived Cas9 protein, Francisella novicida-derived Cas9 protein, etc. It may be one or more selected from the group consisting of, but is not limited thereto. Cas9 protein or its genetic information can be obtained from known databases such as GenBank of the National Center for Biotechnology Information (NCBI).
  • NCBI National Center for Biotechnology Information
  • the Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double stranded DNA breaks.
  • a short base sequence consisting of three bases known as PAM (Protospacer Adjacent Motif) must exist next to the target base sequence, and the Cas9 protein must have a PAM sequence (NGG) It is estimated and cut between the 3rd and 4th base pairs.
  • PAM Protospacer Adjacent Motif
  • the guide RNA and the endonuclease protein form a ribonucleoprotein complex and can operate as RNA-Guided Engineered Nuclease (RGEN).
  • RGEN RNA-Guided Engineered Nuclease
  • the present invention also,
  • the guide RNA and endonuclease protein specific to the target base sequence of the pepper-derived CaAIBZ1 gene are the same as described above.
  • the CRISPR/Cas9 system used in the present invention introduces a double-strand break at a specific position in a specific gene to be corrected, thereby inducing insertion-deletion (InDel) mutations due to incomplete repair induced during the DNA repair process (non-homologous NHEJ). It is a gene editing method using the end joining mechanism.
  • introducing the guide RNA and endonuclease protein in step (a) into pepper plant cells includes guide RNA and endonuclease specific to the target base sequence of the pepper-derived CaAIBZ1 gene. complex of proteins (ribonucleoprotein); Alternatively, a recombinant vector comprising DNA encoding a guide RNA specific to the target base sequence of the pepper-derived CaAIBZ1 gene and a nucleic acid sequence encoding an endonuclease protein may be used, but is not limited thereto.
  • the method of transfecting the complex of the guide RNA and endonuclease protein into plant cells includes the calcium/polyethylene glycol method for protoplasts, electroporation of protoplasts, and microinjection method into plant elements. , particle bombardment of various plant elements (DNA or RNA-coated), infection by bacteria (incomplete) in Agrobacterium tumefaciens mediated gene transfer, etc.
  • introducing a recombinant vector containing a DNA encoding a guide RNA specific for the target base sequence and a nucleic acid sequence encoding an endonuclease protein into a plant cell refers to a transformation method. Transformation of plant species is now common for plant species including both monocots as well as dicots. In principle, any transformation method can be used to introduce the recombinant vector according to the invention into suitable progenitor cells.
  • the “plant cell” into which the guide RNA and endonuclease protein specific to the target base sequence are introduced can be any plant cell.
  • a plant cell is a cultured cell, cultured tissue, cultured organ, or whole plant.
  • Plant tissue refers to differentiated or undifferentiated plant tissues, such as, but not limited to, roots, stems, leaves, pollen, spores, egg cells, seeds, and various types of cells used in culture, i.e., single cells, Includes protoplast, bud and callus tissue. Plant tissue may be in planta or in organ culture, tissue culture, or cell culture.
  • the pepper plant cell whose genome has been corrected in step (b) may be a bi-allelic corrected plant cell of the CaAIBZ1 gene derived from pepper, but is not limited thereto.
  • any method known in the art can be used to redifferentiate a genome-corrected plant from a genome-corrected plant cell.
  • Techniques for redifferentiation of mature plants from callus or protoplast cultures are well known in the art for many different species.
  • the present invention also provides genome-edited pepper plants with improved drought tolerance prepared by the above method and seeds with their genomes corrected.
  • the genome-edited pepper plant with improved drought tolerance according to the present invention is one in which the CaAIBZ1 gene involved in drought tolerance has been corrected using the CRISPR/Cas9 system, and the genome has not been corrected by bi-allelic knock-out of the CaAIBZ1 gene. It is a genome-edited pepper plant with improved drought tolerance compared to pepper plants and mono-allelic modified plants of the CaAIBZ1 gene.
  • the pepper CaAIBZ1 gene target gRNA sequence is shown in Table 1.
  • the sgRNA disclosed in Table 1 was obtained using the CaAIBZ1 gene sequence (GenBank no: LY715037.1) under various conditions (GC contents, out of frame score, genome were selected based on the mismatch number within the sequence, etc.
  • sgRNA target sequence for CaAIBZ1 gene editing Name sequence number Base sequence (5'-3') direction CaAIBZ1 sgRNA1 One ATCATTGTTGCCGATGTACT CGG - CaAIBZ1 sgRNA2 2 CTCAGTTCGTTGCCTCAAGA AGG + CaAIBZ1 sgRNA3 3 CACTACATCAAATTGGCATG TGG + CaAIBZ1 sgRNA4 4 TGCCGATGTACTCGGGCAAC TGG -
  • each sgRNA was synthesized and mixed with Cas9 protein to form an RNP (ribonucleoprotein) complex, which was then introduced into pepper protoplast cells (1 x 10 5 ) using PEG-mediated transduction. 24 hours later, genomic DNA was isolated from the protoplasts and target deep-sequencing analysis was performed to analyze InDel efficiency.
  • RNP ribonucleoprotein
  • Pepper protoplasts were used by separating them from cotyledons of germinated seedlings of the C15 pepper line (Nongwoo Bio). The method of Yu et al. (Nat. Protoc. (2007) 2;1565-1572) was referred to and some modifications were made to isolate pepper protoplasts. did.
  • the RNP complex was prepared by mixing 30 ⁇ g of sgRNA and 30 ⁇ g of Cas9 with 1 ⁇ l of NEB buffer (#3) and reacting at room temperature for 10 minutes. Afterwards, 10 to 20 ⁇ l of the RNP complex (sgRNA + Cas9) was mixed with the protoplast, an equal amount of 40% PEG solution was added, mixed, and reacted at room temperature for 10 minutes.
  • the target site correction efficiency was confirmed to be 6.0% for sgRNA 1, 0.0005% for sgRNA 2, 3.4% for sgRNA 3, and 4.8% for sgRNA 4 (Figure 3). It was confirmed that all can be used as targets except for sgRNA 2, whose proofreading efficiency was not confirmed, and a recombinant transformation vector was constructed using sgRNA 4.
  • the present inventors introduced a recombinant vector containing sgRNA4 into pepper cotyledon explants through Agrobacterium-mediated transformation.
  • the process of redifferentiating plants from cotyledon fragments refers to the method of Lee et al. (Plant Cell Rep. 2004 Aug;23(1-2):50-8. doi: 10.1007/s00299-004-0791-1.) with some modifications. So we proceeded.
  • Pepper C15 line (Nongwoo Bio) was used in the experiment.
  • the surface of the seed was disinfected with 95% ethanol for 30 seconds and then again with 50% bleach for 10 minutes. Afterwards, it was washed three times with sterile water. Sterilized seeds were placed on 1/2 MS medium and germinated under light conditions at 25°C. Afterwards, cotyledons and hypocotyls were excised from plants on the 8th to 10th day of germination and used as explants. After cutting the explants with a knife, they were placed on pre-culture medium PM-A and cultured under light conditions at 22-28°C for 2-6 days.
  • the recombinant vector was introduced into Agrobacterium EHA105 strain.
  • the transformed Agrobacterium was cultured in YEP medium containing 50 mg/l kanamycin, 50 mg/l rifampicin, and 100 ⁇ M acetosyringone. After centrifuging the culture medium, it was diluted with MS basic medium so that the OD 600 value was 0.3 to 0.5.
  • the culture suspension was mixed with MS liquid medium (CCM medium in Table 2) containing 100 ⁇ M acetosyringone and 100 ⁇ M DTT (Dithiothreitol), and then injected into the explants pre-cultured in 2-1 above for 10 to 20 minutes. Inoculated.
  • the explants co-cultured with Agrobacterium in Example 2-2 were mixed with 0.2 mg/l zeatin, 1.0 mg/l IAA, 100 mg/l kanamycin, and 300 mg/l timentin. and 10 ⁇ M STS (silver thiosulfate + silver nitrate) and cultured for 4 to 6 weeks in MS basic medium (Selection-A medium in Table 2). After 4-5 weeks of culture, callus-like tissue was observed to form around the wound area in some explants.
  • the explants were cultured in MS basal medium containing 2 mg/l zeatin, 0.05 mg/l IAA, 50 mg/l kanamycin, 300 mg/l timentin and 10 ⁇ M STS (Table The cells were transferred to TSIM medium (2) and cultured for 8 to 12 weeks. Thereafter, for shoot growth, the explants were incubated with 2 mg/l zeatin, 0.05 mg/l IAA, 2 mg/l GA 3 , 50 mg/l kanamycin, 300 mg/l timentin and 10 ⁇ M STS. It was transferred to MS basic medium (TEM medium in Table 2) and cultured for 2 to 4 weeks.
  • MS basal medium containing 2 mg/l zeatin, 0.05 mg/l IAA, 50 mg/l kanamycin, 300 mg/l timentin and 10 ⁇ M STS (Table The cells were transferred to TSIM medium (2) and cultured for 8 to 12 weeks. Thereafter, for shoot growth, the explants were incubated with 2 mg/l
  • the elongated shoots were planted on MS basic medium (TRIM medium in Table 2) containing 1 mg/l IBA (Indole-3-butyric acid) and 150 mg/l timementin and cultured to induce rooting for 2 to 4 weeks. did.
  • MS basic medium TMM medium in Table 2
  • IBA Indole-3-butyric acid
  • timementin 150 mg/l timementin and cultured to induce rooting for 2 to 4 weeks. did.
  • the regenerated plants rooted in this way were transferred to a seedling pot and soil containing horticultural medium and cultured for 3 to 6 weeks under 25°C and 16 hours of light conditions.
  • NGS analysis was performed to confirm correction efficiency in the obtained T 0 transgenic individuals.
  • the CaAIBZ1-I4 T 0 #10 individual was confirmed to have a mono-allelic proofreading level (50%) with an overall proofreading efficiency of 49.8%, and the main proofreading pattern was confirmed to be in the form of 1bp introduction of A or G ( Figure 6).
  • the CaAIBZ1-I4 T 0 #12 individual was confirmed to have a mono-allelic proofreading level (50%) with an overall proofreading efficiency of 45.6%, and the main proofreading pattern was confirmed to be introduced in the form of 1bp of T or A ( Figure 6) .
  • CaAIBZ1-I4 T 0 #10 and CaAIBZ1-I4 T 0 #12 individuals were expected to be isolated in the next generation and secure a proofreader with a 1bp single base introduced.
  • the CaAIBZ1-I4 T 0 #28 individual was confirmed to have a mono-allelic proofreading level (50%) with an overall proofreading efficiency of 54.8%, and the main proofreading pattern was confirmed to be mostly -1bp deletion (Figure 6).
  • the CaAIBZ1-I4 T 0 #28 individual was expected to be isolated in the next generation and obtain a single base -1bp deletion individual.
  • NGS analysis was performed to confirm correction efficiency in pot-planted pepper T 1 transgenic plants.
  • the correction efficiency of CaAIBZ1-I4 T 1 #10-8, #12-6 objects was confirmed to be a bi-allelic correction level (over 99%), and the correction efficiency of CaAIBZ1-I4 T 1 #10-1, #12-18 objects was confirmed to be bi-allelic correction level (over 99%).
  • the efficiency was confirmed to be at the mono-allelic correction level (50% level), and at this time, the correction pattern showed that the A or T base was introduced in the form of +1 bp ( Figures 7 and 8). In other words, it was possible to secure a +1 bp single nucleotide introduction type gene corrector.
  • the Cas9 primer set [Cas9 #2] was used to check whether T-DNA was free in the 13 pepper CaAIBZ1 T 2 corrected plants selected as drought tolerant through the drought tolerance test (re-watering after water cut).
  • PCR was performed using -F: TTCGATAAGAACCTTCCAAA (SEQ ID NO: 5), Cas9 #2-R: TTGAGCCTTTCTTCAATCAT (SEQ ID NO: 6)].
  • PCR bands were not confirmed in 11 specimens except 2 specimens (10-8 #2, 10-8 #3), and T-DNA was removed from the CaAIBZ1 gene correction plants after T 2 generation progression, and bi-allelic Nine properly corrected specimens (10-8 #1, #4 and 12-6 #1 ⁇ #7) were obtained ( Figure 12).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Environmental Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Botany (AREA)
  • Physiology (AREA)
  • Medicinal Chemistry (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

본 발명은 고추 식물체의 가뭄내성 증진을 위한 유전체 교정용 조성물 및 상기 조성물을 이용한 가뭄내성이 증진된 T-DNA free 유전체 교정 고추 식물체의 제조방법에 관한 것이다. 보다 구체적으로, 본 발명의 조성물은 고추 유래 CaAIBZ1 유전자의 표적 염기서열에 특이적인 가이드 RNA와 엔도뉴클레아제 단백질의 복합체(ribonucleoprotein); 또는 고추 유래 CaAIBZ1 유전자의 표적 염기서열에 특이적인 가이드 RNA를 암호화하는 DNA 및 엔도뉴클레아제 단백질을 암호화하는 핵산 서열을 포함하는 재조합 벡터;를 유효성분으로 포함한다.

Description

가뭄내성 증진을 위한 CaAIBZ1 유전자교정 고추의 제조방법
본 발명은 가뭄내성 증진을 위한 CaAIBZ1 (Capsicum annuum ASRF1-Interacting bZIP transcription factor 1) 유전자교정 고추의 제조방법에 관한 것이다.
본 결과물은 농촌진흥청의 차세대농작물신육종기술개발사업(New Breeding Technology Center)의 지원을 받아 연구되었습니다(과제번호: PJ01479802).
기후변화와 지구온난화로 인해 전 세계적으로 가뭄과 물 부족, 그리고 홍수 등 자연재해 현상이 일어나고 있으며, 이러한 현상은 앞으로도 심화될 것이다. 고추(Capsicum annuum L.)는 글로벌 채소시장에서 토마토 다음으로 두 번째로 크며 전 세계적으로 재배되고 있다. Sweet pepper나 chili pepper의 90% 이상이 노지에서 재배되고 있으며 특히 고추재배 밀도가 높은 인도, 중국 등에서는 생육기간 동안 가뭄과 물 부족으로 생산량이 급감하는 경우가 있다. 현재까지 가뭄에 내성이 있는 고추 유전자원이 없는 실정이어서 기존 전통육종 및 MAS (maker-assisted selection) 육종으로는 가뭄 등 다양한 환경변화에 적응하는 품종을 개발하기 어렵다. 반면, 유전자교정 기술은 새로운 유전자원을 개발할 수 있어서 가뭄내성 고추개발이 가능하다.
본 발명에서는 가뭄내성 특성을 부여하는 표적 유전자에 대한 가이드 RNA를 GFP (green fluorescent protein)와 Cas9 발현 벡터에 넣고 고추 형질전환을 통하여 유전자 교정체를 개발한 다음 가뭄내성 고추를 선발하고자 하였다.
한편, 한국공개특허 제2015-0106528호에는 '식물의 비생물학적 스트레스 내성을 증가시키는 고추 유래의 MSRB2 유전자 및 이의 용도'가 개시되어 있고, 한국공개특허 제2013-0055050호에는 '동해 및 가뭄 저항성 고추 전사인자 CaWRKY1 유전자 및 이의 용도'가 개시되어 있으나, 본 발명의 '가뭄내성 증진을 위한 CaAIBZ1 유전자교정 고추의 제조방법'에 대해서는 기재된 바가 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자는 가뭄내성과 관련된 유전자 CaAIBZ1을 표적으로 하는 gRNA와, Cas9 및 GFP 발현 카세트를 포함하는 CRISPR 벡터를 구성하였다. 그 후, 상기 벡터를 아그로박테리움을 매개하여 고추 자엽 절편체에 형질전환하였고, 표적 부위가 교정된 유전체 교정 식물체를 확보하였다. 그 후, T2 세대 유전체 교정 식물체를 이용하여 단수 및 재관수의 가뭄내성 실험을 수행한 결과, CaAIBZ1 유전자의 bi-allelic 교정 식물체가 대조군(비교정 식물체) 및 mono-allelic 교정 식물체 대비 현저히 증가된 가뭄내성을 나타내는 것을 확인함으로써, 본 발명을 완성하였다.
상기 과제를 해결하기 위해, 본 발명은 고추 유래 CaAIBZ1 (Capsicum annuum ASRF1-Interacting bZIP transcription factor 1) 유전자의 표적 염기서열에 특이적인 가이드 RNA (guide RNA)와 엔도뉴클레아제(endonuclease) 단백질의 복합체(ribonucleoprotein); 또는 고추 유래 CaAIBZ1 유전자의 표적 염기서열에 특이적인 가이드 RNA를 암호화하는 DNA 및 엔도뉴클레아제 단백질을 암호화하는 핵산 서열을 포함하는 재조합 벡터;를 유효성분으로 함유하는, 고추 식물체의 가뭄내성 증진을 위한 유전체 교정용 조성물을 제공한다.
또한, 본 발명은 (a) 고추 유래 CaAIBZ1 유전자의 표적 염기서열에 특이적인 가이드 RNA 및 엔도뉴클레아제 단백질을 고추 식물세포에 도입하여 유전체를 교정하는 단계; 및 (b) 상기 유전체가 교정된 고추 식물세포로부터 고추 식물체를 재분화하는 단계;를 포함하는, 가뭄내성이 증진된 유전체 교정 고추 식물체의 제조방법을 제공한다.
또한, 본 발명은 상기 방법에 의해 제조된 가뭄내성이 증진된 유전체 교정 고추 식물체 및 이의 유전체가 교정된 종자를 제공한다.
본 발명의 방법을 통해 제조된 가뭄내성이 증진된 유전체 교정 고추 식물체는 향후 가뭄내성 고추 유전자원 확보와 고부가가치 고추 품종 개발에 유용하게 활용될 수 있을 것이다. 또한, 본 발명의 방법은 외래 유전자의 삽입이 없고, 자연적 변이와 구별할 수 없는 작은 변이만 가지고 있으므로, 안전성과 환경 유해성 여부를 평가하기 위해 막대한 비용과 시간이 소모되는 GMO (Genetically Modified Organism) 작물과 달리 비용과 시간을 절약할 수 있을 것으로 기대된다.
도 1은 고추 CaAIBZ1 유전자 교정을 위한 CRISPR-Cas9 벡터 pCam-CaAIBZ1의 모식도이다. 고추 유전자교정 벡터는 pCambia 벡터 백본을 가지고 있으며 gRNA 발현 및 Cas9 발현 카세트와 GFP 발현 카세트를 동시에 가지는 구조이다. Cas9는 Cauliflower mosaic virus (CaMV) 35S 프로모터 의해 발현 조절되고, CaAIBZ1 유전자 타겟 gRNA는 AtU6 프로모터에 발현 조절된다. LB: T-DNA left border; NLS: nuclear localization signal; pCas9: Plant-codon optimized spCas9; 2A: 2A self-cleaving peptide; eGFP: enhanced green fluorescent protein; CaMV35S P: Cauliflower mosaic virus (CaMV) 35S promoter; 35S(T): CaMV 35S terminator, NOS-T: nopaline synthase terminator; NPTⅡ: neomycin phosphotransferase Ⅱ (kanamycin resistance determinants), RB: T-DNA right border.
도 2는 고추 게놈상 CaAIBZ1 유전자의 타겟 가이드 RNA 위치 및 서열을 보여주는 것으로, 컬러바는 타겟 RNA 위치, 검정바는 PAM 위치, 화살표는 예상 절단부위, 블랙박스는 게놈상 엑손 부위를 나타낸다.
도 3은 고추 원형질체에서 RNP (sgRNA/Cas9 protein)를 이용한 타겟 gRNA의 교정 효율을 분석한 결과이다.
도 4는 고추 형질전환체 확보 과정으로, 고추 자엽 절편체부터 캘러스 단계를 거쳐 재분화 및 작은 식물체까지 성장하는 과정의 모습을 보여준다.
도 5는 화분 정식하여 식물생장실에서 개화 중인 CaAIBZ1 유전자교정 고추 식물체(T0)의 모습이다.
도 6은 CaAIBZ1 유전자교정 고추 T0 개체의 교정패턴을 분석한 NGS 결과이다.
도 7 및 도 8은 CaAIBZ1 유전자교정 고추 T1 개체의 교정패턴을 분석한 NGS 결과이다.
도 9는 가뭄내성 실험을 위한 T2 종자 확보용 CaAIBZ1 유전자교정 고추 T1 세대 식물체의 모습이다.
도 10은 CaAIBZ1 유전자가 교정된 고추 T2 개체의 가뭄내성 실험 결과이다.
도 11은 CaAIBZ1 유전자가 교정된 고추 T2 개체의 재급수 후 생존율 실험 결과이다.
도 12는 CaAIBZ1 유전자가 교정된 고추 T2 개체의 T-DNA free 여부를 확인하기 위한 PCR 분석 결과이다. M: 1kb marker, N: wild type, P: vector, 10-1 #1~12-18 #1: CaAIBZ1 gene edited hot pepper T2 plants.
본 발명의 목적을 달성하기 위하여, 본 발명은 고추 유래 CaAIBZ1 (Capsicum annuum ASRF1-Interacting bZIP transcription factor 1) 유전자의 표적 염기서열에 특이적인 가이드 RNA(guide RNA)와 엔도뉴클레아제(endonuclease) 단백질의 복합체(ribonucleoprotein); 또는 고추 유래 CaAIBZ1 유전자의 표적 염기서열에 특이적인 가이드 RNA를 암호화하는 DNA 및 엔도뉴클레아제 단백질을 암호화하는 핵산 서열을 포함하는 재조합 벡터;를 유효성분으로 함유하는, 고추 식물체의 가뭄내성 증진을 위한 유전체 교정용 조성물을 제공한다.
본 발명의 조성물에 있어서, 고추 식물체의 가뭄내성 증진을 위한 유전체 교정의 표적 유전자는 GenBank accession no: LY715037.1인 CaAIBZ1 유전자이다.
본 명세서에서 용어 "유전체/유전자 교정(genome/gene editing)"은, 인간 세포를 비롯한 동·식물 세포의 유전체 염기서열에 표적지향형 변이를 도입할 수 있는 기술로서, DNA 절단에 의한 핵산 분자의 결실(deletion), 삽입(insertion) 또는 치환(substitutions) 등에 의하여 특정 유전자를 녹-아웃(knock-out) 또는 녹-인(knock-in)하거나, 단백질을 생성하지 않는 비-코딩(non-coding) DNA 서열에도 변이를 도입할 수 있는 기술을 말한다. 용어 "유전자 교정"은 "유전자 편집"과 혼용되어 사용될 수 있다.
본 발명의 목적상 상기 유전체 교정은 특히 엔도뉴클레아제 예컨대, Cas9 (CRISPR associated protein 9) 단백질 및 가이드 RNA를 이용하여 식물체에 변이를 도입하는 것일 수 있다.
또한, 용어 "표적 유전자"는 본 발명을 통해 교정하고자 하는 식물체의 유전체 내에 있는 일부 DNA를 의미하며, 코딩 영역 및 비-코딩 영역을 모두 포함할 수 있다. 당업자는 그 목적에 따라, 제조하고자 하는 유전체 교정 식물체에 대하여 표적 유전자를 선별할 수 있다.
또한, 용어 "가이드 RNA(guide RNA)"는 짧은 단일 가닥의 RNA로, 표적 유전자를 암호화하는 염기서열 중 표적 DNA에 특이적인 RNA를 포함하며, 표적 DNA 염기서열과 전부 또는 일부가 상보적으로 결합하여 해당 표적 DNA 염기서열로 엔도뉴클레아제 단백질을 이끄는 역할을 하는 리보핵산을 의미한다. 상기 가이드 RNA는 두 개의 RNA, 즉, crRNA (CRISPR RNA) 및 tracrRNA (trans-activating crRNA)를 구성 요소로 포함하는 이중 RNA (dual RNA); 또는 표적 유전자 내 염기서열과 전부 또는 일부 상보적인 서열을 포함하는 제1 부위 및 엔도뉴클레아제(특히, RNA-가이드 뉴클레아제)와 상호작용하는 서열을 포함하는 제2 부위를 포함하는 단일 사슬 가이드 RNA (single guide RNA, sgRNA) 형태를 말하나, 엔도뉴클레아제가 표적 염기서열에서 활성을 가질 수 있는 형태라면 제한없이 본 발명의 범위에 포함될 수 있으며, 함께 사용된 엔도뉴클레아제의 종류 또는 엔도뉴클레아제의 유래 미생물 등을 고려하여 당업계의 공지된 기술에 따라 제조하여 사용할 수 있다.
또한, 상기 가이드 RNA는 플라스미드 주형으로부터 전사된 것, 생체 외(in vitro)에서 전사된(transcribed) 것(예컨대, 올리고뉴클레오티드 이중가닥) 또는 합성한 가이드 RNA 등일 수 있으나, 이에 제한되지 않는다.
본 발명에 따른 유전체 교정용 조성물에 있어서, 상기 가이드 RNA는 서열번호 1, 서열번호 3 또는 서열번호 4의 염기서열로 이루어진 고추 유래 CaAIBZ1 유전자의 표적 염기서열에 특이적으로 고안된 것이다.
또한, 본 발명에 따른 유전체 교정용 조성물에 있어서, 상기 엔도뉴클레아제 단백질은 Cas9, Cpf1 (CRISPR from Prevotella and Francisella 1, also known as CAs12a), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) 또는 이의 기능적 유사체로 이루어진 군으로부터 선택되는 하나 이상일 수 있고, 바람직하게는 Cas9 단백질일 수 있으나, 이에 제한되지 않는다.
또한, 상기 Cas9 단백질은 스트렙토코커스 피요제네스(Streptococcus pyogenes) 유래의 Cas9 단백질, 캠필로박터 제주니(Campylobacter jejuni) 유래의 Cas9 단백질, 스트렙토코커스 써모필러스(S. thermophilus) 또는 스트렙토코커스 아우레우스(S. aureus) 유래의 Cas9 단백질, 네이쎄리아 메닝기티디스(Neisseria meningitidis) 유래의 Cas9 단백질, 파스투렐라 물토시다(Pasteurella multocida) 유래의 Cas9 단백질, 프란시셀라 노비시다(Francisella novicida) 유래의 Cas9 단백질 등으로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 제한되지 않는다. Cas9 단백질 또는 이의 유전자 정보는 NCBI (National Center for Biotechnology Information)의 GenBank와 같은 공지의 데이터베이스에서 얻을 수 있다.
Cas9 단백질은 RNA-guided DNA 엔도뉴클레아제 효소로, 이중 가닥 DNA 절단(double stranded DNA break)을 유도한다. Cas9 단백질이 정확하게 표적 염기서열에 결합하여 DNA 가닥을 잘라내기 위해서는 PAM (Protospacer Adjacent Motif)이라 알려진 3개의 염기로 이루어진 짧은 염기서열이 표적 염기서열 옆에 존재해야 하며, Cas9 단백질은 PAM 서열(NGG)로부터 3번째와 4번째 염기쌍 사이를 추정하여 절단한다.
본 발명에 따른 유전체 교정용 조성물에 있어서, 상기 가이드 RNA와 엔도뉴클레아제 단백질은 리보핵산-단백질(ribonucleoprotein) 복합체를 형성하여 RNA 유전자 가위(RNA-Guided Engineered Nuclease, RGEN)로 작동할 수 있다.
본 발명은 또한,
(a) 고추 유래 CaAIBZ1 (Capsicum annuum ASRF1-Interacting bZIP transcription factor 1) 유전자의 표적 염기서열에 특이적인 가이드 RNA(guide RNA) 및 엔도뉴클레아제(endonuclease) 단백질을 고추 식물세포에 도입하여 유전체를 교정하는 단계; 및
(b) 상기 유전체가 교정된 고추 식물세포로부터 고추 식물체를 재분화하는 단계;를 포함하는, 가뭄내성이 증진된 유전체 교정 고추 식물체의 제조방법을 제공한다.
본 발명의 일 구현 예에 따른 제조방법에 있어서, 상기 고추 유래 CaAIBZ1 유전자의 표적 염기서열에 특이적인 가이드 RNA 및 엔도뉴클레아제 단백질은 전술한 것과 같다.
본 발명에서 사용된 CRISPR/Cas9 시스템은 교정하고자 하는 특정 유전자의 특정위치에 이중나선 절단을 도입하여 DNA 수선 과정에서 유도되는 불완전 수선에 의한 삽입-결실(InDel) 돌연변이를 유도시키는 NHEJ (non-homologous end joining) 기작에 의한 유전자 교정 방법이다.
본 발명에 따른 제조방법에 있어서, 상기 (a) 단계의 가이드 RNA 및 엔도뉴클레아제 단백질을 고추 식물세포에 도입하는 것은, 고추 유래 CaAIBZ1 유전자의 표적 염기서열에 특이적인 가이드 RNA와 엔도뉴클레아제 단백질의 복합체(ribonucleoprotein); 또는 고추 유래 CaAIBZ1 유전자의 표적 염기서열에 특이적인 가이드 RNA를 암호화하는 DNA 및 엔도뉴클레아제 단백질을 암호화하는 핵산 서열을 포함하는 재조합 벡터;를 이용하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 따른 제조방법에 있어서, 상기 가이드 RNA와 엔도뉴클레아제 단백질의 복합체를 식물세포에 형질도입하는 방법은 원형질체에 대한 칼슘/폴리에틸렌 글리콜 방법, 원형질체의 전기천공법, 식물 요소로의 현미주사법, 각종 식물 요소의(DNA 또는 RNA-코팅된) 입자 충격법, 아그로박테리움 튜메파시엔스(Agrobacterium tumefaciens) 매개된 유전자 전이에서(비완전성) 박테리아에 의한 감염 등으로부터 적당하게 선택될 수 있다.
또한, 상기 표적 염기서열에 특이적인 가이드 RNA를 암호화하는 DNA 및 엔도뉴클레아제 단백질을 암호화하는 핵산 서열을 포함하는 재조합 벡터를 식물세포에 도입하는 것은 형질전환 방법을 의미한다. 식물 종의 형질전환은 이제는 쌍자엽 식물뿐만 아니라 단자엽 식물 양자를 포함한 식물 종에 대해 일반적이다. 원칙적으로, 임의의 형질전환 방법은 본 발명에 따른 재조합 벡터를 적당한 선조 세포로 도입시키는데 이용될 수 있다.
본 발명에 따른 제조방법에 있어서, 상기 표적 염기서열에 특이적인 가이드 RNA 및 엔도뉴클레아제 단백질이 도입되는 "식물세포"는 어떤 식물세포도 된다. 식물세포는 배양 세포, 배양 조직, 배양 기관 또는 전체 식물이다. "식물 조직"은 분화된 또는 미분화된 식물의 조직, 예를 들면 이에 한정되진 않으나, 뿌리, 줄기, 잎, 꽃가루, 소포자, 난세포, 종자 및 배양에 이용되는 다양한 형태의 세포들, 즉 단일 세포, 원형질체(protoplast), 싹 및 캘러스 조직을 포함한다. 식물 조직은 인 플란타(in planta)이거나 기관 배양, 조직 배양 또는 세포 배양 상태일 수 있다.
본 발명에 따른 제조방법에 있어서, 상기 (b) 단계의 유전체가 교정된 고추 식물세포는 고추 유래 CaAIBZ1 유전자의 bi-allelic 교정 식물세포일 수 있으나, 이에 제한되지 않는다.
본 발명의 제조방법에 있어서, 유전체가 교정된 식물세포로부터 유전체가 교정된 식물을 재분화하는 방법은 당업계에 공지된 임의의 방법을 이용할 수 있다. 캘러스 또는 원형질체 배양으로부터 성숙한 식물의 재분화를 위한 기술은 수많은 여러 가지 종에 대해서 당업계에 주지되어 있다.
본 발명은 또한, 상기 방법에 의해 제조된 가뭄내성이 증진된 유전체 교정 고추 식물체 및 이의 유전체가 교정된 종자를 제공한다.
본 발명에 따른 가뭄내성이 증진된 유전체 교정 고추 식물체는 가뭄내성에 관여하는 CaAIBZ1 유전자를 CRISPR/Cas9 시스템을 이용하여 교정한 것으로, CaAIBZ1 유전자의 bi-allelic 녹-아웃에 의해, 유전체를 교정하지 않은 고추 식물체 및 CaAIBZ1 유전자의 mono-allelic 교정 식물체에 비해 가뭄내성이 증진된 형질을 가지는 유전체 교정 고추 식물체이다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
실시예 1. CaAIBZ1 유전자 sgRNA 선발
고추 CaAIBZ1 유전자 표적 gRNA 서열은 표 1과 같다. 표 1에 개시된 sgRNA는 CaAIBZ1 유전자 서열(GenBank no: LY715037.1)을 이용하여 CRISPR RGEN Tools 웹사이트(www.rgenome.net/Cas-designer)에서 여러가지 조건들(GC contents, out of frame score, 게놈 서열내 mismatch number 등)을 반영하여 선발되었다.
CaAIBZ1 유전자 편집을 위한 sgRNA 표적 서열
Name 서열번호 염기서열(5'-3') 방향
CaAIBZ1 sgRNA1 1 ATCATTGTTGCCGATGTACTCGG -
CaAIBZ1 sgRNA2 2 CTCAGTTCGTTGCCTCAAGAAGG +
CaAIBZ1 sgRNA3 3 CACTACATCAAATTGGCATGTGG +
CaAIBZ1 sgRNA4 4 TGCCGATGTACTCGGGCAACTGG -
선발된 4개의 sgRNA의 교정 효율을 확인하기 위해서, sgRNA를 각각 합성한 후 Cas9 단백질과 혼합하여 RNP (ribonucleoprotein) 복합체를 형성한 뒤 고추 원형질체 세포(1 x 105)에 PEG 매개 형질도입 방법으로 도입시키고 24시간 후, 원형질체로부터 게노믹 DNA를 분리하여 Target deep-sequencing 분석을 진행하여 InDel 효율을 분석하였다.
고추 원형질체는 C15 고추 계통(농우바이오)의 발아된 유식물체 자엽으로부터 분리하여 사용하였으며, 유 등(Nat. Protoc. (2007) 2;1565-1572)의 방법을 참고하고 일부 변형하여 고추 원형질체를 분리하였다. 또한, RNP 복합체는 sgRNA 30 ㎍과 Cas9 30 ㎍을 넣고, NEB buffer(#3) 1 ㎕를 섞어 상온에서 10분간 반응시켜 제조하였다. 그 후, 원형질체에세 상기 RNP 복합체(sgRNA+Cas9) 10~20 ㎕을 섞고, 40% PEG 용액을 동량 넣어 혼합한 후 상온에서 10분간 반응시켰다.
분석 결과, 타겟 부위 교정효율은 sgRNA 1은 6.0%, sgRNA 2는 0.0005%, sgRNA 3은 3.4%, sgRNA 4는 4.8%로 확인되었다(도 3). 교정 효율이 확인되지 않은 sgRNA 2를 제외하고 모두 타겟으로 사용할 수 있음을 확인할 수 있었으며, sgRNA 4를 사용하여 형질전환 재조합 벡터를 제작하였다.
실시예 2. CaAIBZ1 유전자교정 식물체의 제작
본 발명자는 고추 자엽 절편체에 sgRNA4를 포함하는 재조합 벡터를 아그로박테리움 매개 형질전환을 통해 도입하였다. 자엽절편으로부터 식물체를 재분화하는 과정은 Lee 등(Plant Cell Rep. 2004 Aug;23(1-2):50-8. doi: 10.1007/s00299-004-0791-1.)의 방법을 참고하여 일부 변형하여 진행하였다.
2-1. 절편체의 준비 및 전 배양
고추 C15 계통(농우바이오)을 실험에 사용하였다. 종자의 표면을 95% 에탄올로 30초 동안 소독한 후, 다시 50% 표백제로 10분 동안 소독하였다. 이후, 멸균수로 3회 세척하였다. 멸균된 종자들을 1/2 MS 배지에 치상한 후 25℃의 광 조건에서 발아시켰다. 이후, 발아 8~10일차의 식물체로부터 자엽과 하배축을 절제하고 이를 절편체로 사용하였다. 절편체들을 칼로 상처낸 후, 전 배양 배지 PM-A에 치상하여 2~6일간 22~28℃의 광 조건에서 배양하였다.
2-2. 아그로박테리움과 공동 배양
재조합 벡터를 아그로박테리움 EHA105 균주에 도입하였다. 형질전환된 아그로박테리움을 50 ㎎/ℓ 카나마이신(kanamycin), 50 ㎎/ℓ 리팜피신(rifampicin) 및 100 μM 아세토시린곤(acetosyringone)을 포함하는 YEP 배지에서 배양하였다. 배양액을 원심분리한 후, MS 기본 배지로 OD600 값이 0.3~0.5가 되도록 희석하였다. 배양 현탁액을 100 μM 아세토시린곤과 100 μM DTT (Dithiothreitol)을 포함하는 MS 액체 배지(표 2의 CCM 배지)와 혼합한 후, 이를 상기 2-1.에서 전 배양한 절편체에 10~20분간 접종하였다. 이후, 상기 2-1.에서 사용한 전 배양 배지 PM-A에서 48~96시간 동안 광 조건으로 공배양하였다. 아그로박테리움과 공배양한 절편체를 3% 수크로스, 600 ㎎/ℓ 티멘틴(timentin) 및 2 ㎖/ℓ의 PPM (Plant preservation mixture; Plant Cell Technology, USA)을 포함하는 1/2 MS 액체 배지로 3회 세척하였다.
2-3. 캘러스 유도 및 신초(shoot) 형성
형질전환체를 선발하기 위하여 상기 실시예 2-2.에서 아그로박테리움과 공 배양한 절편체를 0.2 ㎎/ℓ 제아틴, 1.0 ㎎/ℓ IAA, 100 ㎎/ℓ 카나마이신, 300 ㎎/ℓ 티멘틴 및 10 μM STS (silver thiosulfate + silver nitrate)를 포함하는 MS 기본 배지(표 2의 Selection-A 배지)에서 4~6주 동안 배양하였다. 배양한 지 4-5주 째에 몇몇 절편체에서는 상처 부위 주변에 캘러스와 유사한 조직이 생기는 것을 관찰할 수가 있었다. 이후, 캘러스에서 신초를 유도하기 위하여 상기 절편체들을 2 ㎎/ℓ 제아틴, 0.05 ㎎/ℓ IAA, 50 ㎎/ℓ 카나마이신, 300 ㎎/ℓ 티멘틴 및 10 μM STS를 포함하는 MS 기본 배지(표 2의 TSIM 배지)로 옮겨 8~12주 동안 배양하였다. 그 후, 신초 성장을 위해 상기 절편체들을 2 ㎎/ℓ 제아틴, 0.05 ㎎/ℓ IAA, 2 ㎎/ℓ GA3, 50 ㎎/ℓ 카나마이신, 300 ㎎/ℓ 티멘틴 및 10 μM STS를 포함하는 MS 기본 배지(표 2의 TEM 배지)로 옮겨 2~4주 동안 배양하였다.
2-4. 뿌리 유도 및 토양 순화
신장된 신초를 1 ㎎/ℓ IBA (Indole-3-butyric acid) 및 150 ㎎/ℓ 티멘틴을 포함하는 MS 기본 배지(표 2의 TRIM 배지)에 치상하여 2~4주 동안 발근을 유도하며 배양하였다. 이렇게 발근된 재분화 식물체를 원예용 상토가 든 화분(seedling pot & soil)으로 옮겨 25℃, 16시간의 광 조건 하에서 3~6주 동안 순화하며 배양하였다.
Figure PCTKR2023019049-appb-img-000001
실시예 3. 고추 T0 식물체에서 교정효율 확인
확보된 T0 형질전환 개체에서 교정효율을 확인하기 위하여 NGS 분석을 수행하였다. CaAIBZ1-I4 고추 재분화 35개체 분석결과, mono-allelic 수준(50%)의 교정 개체 3개를 포함하여 10% 이상의 교정 효율을 갖는 개체 15개를 확인할 수 있었다(전체 개체 중에 10% 이상의 교정효율 개체수: 42.8%).
Figure PCTKR2023019049-appb-img-000002
CaAIBZ1-I4 T0 #10 개체는 전체 교정 효율 49.8%로 mono-allelic 교정 수준(50%)으로 확인되었으며, 주요 교정 패턴은 A 또는 G의 1bp 도입 형태로 되어 있는 것을 확인하였다(도 6). CaAIBZ1-I4 T0 #12 개체는 전체 교정 효율 45.6%로 mono-allelic 교정 수준(50%)으로 확인되었으며, 주요 교정 패턴은 T 또는 A의 1bp 형태로 도입되어 있는 것을 확인할 수 있었다(도 6). CaAIBZ1-I4 T0 #10 및 CaAIBZ1-I4 T0 #12 개체는 다음세대에서 분리되어 1bp 단일 염기가 도입된 교정체 확보가 예상되었다. 또한, CaAIBZ1-I4 T0 #28 개체는 전체 교정 효율 54.8%로 mono-allelic 교정 수준(50%)으로 확인되었으며, 주요 교정 패턴은 대부분 -1bp 결실 형태인 것으로 확인되었다(도 6). CaAIBZ1-I4 T0 #28 개체는 다음세대에서 분리되어 단일 염기 -1bp 결실 개체 확보가 예상되었다.
실시예 4. 고추 T1 식물체에서 교정효율 확인
화분 정식된 고추 T1 형질전환 개체에서 교정효율을 확인하기 위해서 NGS 분석을 수행하였다. CaAIBZ1-I4 고추 재분화 42개체 분석결과 bi-allelic 교정 수준(93% 이상)의 개체 12개를 포함하여, 50% 이상의 교정효율을 갖는 개체 34개를 확보할 수 있었다(전체 개체 중에 50% 이상의 교정효율 개체수: 81.0%).
CaAIBZ1-I4 T1 #10-8, #12-6 개체의 교정 효율은 bi-allelic 교정 수준(99% 이상)으로 확인되었으며, CaAIBZ1-I4 T1 #10-1, #12-18 개체의 교정 효율은 mono-allelic 교정 수준(50% 수준)으로 확인되었으며, 이때 교정패턴은 A 또는 T 염기가 +1 bp 형태로 도입되어 있음을 알 수 있었다(도 7 및 도 8). 즉, +1 bp 단일 염기 도입 형태 유전자 교정체를 확보할 수 있었다.
Figure PCTKR2023019049-appb-img-000003
실시예 5. CaAIBZ1 유전자교정 식물체의 가뭄내성 분석
CaAIBZ1 유전자가 교정된 고추의 가뭄내성을 조사하기 위해 대조군(control: C15 line)과, T1 세대에서 CaAIBZ1 유전자교정이 확인된 4개의 T2 고추를 파종하였다(도 9). 파종후 4주일 된 고추 교정체를 8일 및 9일 동안 단수를 하여 가뭄내성 정도를 관찰하였다. 단수 6일째 부터 대조군은 잎이 시들기 시작하다가 8일째 부터는 완전히 시들었음을 확인할 수 있었다(도 10). Mono-allelic한 고추 교정체는 대조군과 가뭄내성 정도가 유사하였으며, bi-allelic한 고추 교정체에서는 대조군보다 훨씬 강한 가뭄내성 형질을 보였주었다(도 10). 9일째 단수에서 완전 생존한 고추(bi-allelic; 10-8과 12-6)는 약 47%였으며, 대조군과 mono-alleilc 고추는 생존율이 0%임을 확인하였다(도 10).
또한, 9일까지 단수를 했던 대조군 고추와 유전자교정 고추에 대해 10일째 부터 재급수를 시작하였다. 대조군에서는 재급수 2일째까지 1개체만이 회복되었고(20%), 유전자교정 고추의 경우 mono-alleic한 개체들은 bi-allelic한 개체에 비해 회복이 느렸으며 완전 회복률은 재급수 2일째 각각 mono-alleic한 교정체는 25%, bi-allelic한 교정체는 73%로 확인되었다(도 11).
또한, 상기 가뭄내성 시험(단수 후 재급수)을 통해 가뭄내성을 보이는 개체로 선발된 13개 고추 CaAIBZ1 T2 교정체 식물체를 대상으로 T-DNA free 여부를 확인하기 위해 Cas9 프라이머 세트[Cas9 #2-F: TTCGATAAGAACCTTCCAAA (서열번호 5), Cas9 #2-R: TTGAGCCTTTCTTCAATCAT (서열번호 6)]를 이용하여 PCR을 수행하였다. 그 결과, 2개체(10-8 #2, 10-8 #3)를 제외한 11개체에서 PCR 밴드가 확인되지 않아, T2 세대진전 후 CaAIBZ1 유전자교정 식물체에서 T-DNA가 제거되고, bi-allelic하게 교정된 9개체(10-8 #1, #4와 12-6 #1~#7)를 확보하였다(도 12).

Claims (9)

  1. 고추 유래 CaAIBZ1 (Capsicum annuum ASRF1-Interacting bZIP transcription factor 1) 유전자의 표적 염기서열에 특이적인 가이드 RNA (guide RNA)와 엔도뉴클레아제(endonuclease) 단백질의 복합체(ribonucleoprotein); 또는 고추 유래 CaAIBZ1 유전자의 표적 염기서열에 특이적인 가이드 RNA를 암호화하는 DNA 및 엔도뉴클레아제 단백질을 암호화하는 핵산 서열을 포함하는 재조합 벡터;를 유효성분으로 함유하는, 고추 식물체의 가뭄내성 증진을 위한 유전체 교정용 조성물.
  2. 제1항에 있어서, 상기 고추 유래 CaAIBZ1 유전자의 표적 염기서열은 서열번호 1, 서열번호 3 또는 서열번호 4의 염기서열로 이루어진 것을 특징으로 하는 조성물.
  3. (a) 고추 유래 CaAIBZ1 (Capsicum annuum ASRF1-Interacting bZIP transcription factor 1) 유전자의 표적 염기서열에 특이적인 가이드 RNA (guide RNA) 및 엔도뉴클레아제(endonuclease) 단백질을 고추 식물세포에 도입하여 유전체를 교정하는 단계; 및
    (b) 상기 유전체가 교정된 고추 식물세포로부터 고추 식물체를 재분화하는 단계;를 포함하는, 가뭄내성이 증진된 유전체 교정 고추 식물체의 제조방법.
  4. 제3항에 있어서, 상기 (a) 단계의 가이드 RNA 및 엔도뉴클레아제 단백질을 고추 식물세포에 도입하는 것은, 고추 유래 CaAIBZ1 유전자의 표적 염기서열에 특이적인 가이드 RNA와 엔도뉴클레아제 단백질의 복합체(ribonucleoprotein); 또는 고추 유래 CaAIBZ1 유전자의 표적 염기서열에 특이적인 가이드 RNA를 암호화하는 DNA 및 엔도뉴클레아제 단백질을 암호화하는 핵산 서열을 포함하는 재조합 벡터;를 이용하는 것을 특징으로 하는 제조방법.
  5. 제3항에 있어서, 상기 고추 유래 CaAIBZ1 유전자의 표적 염기서열은 서열번호 1, 서열번호 3 또는 서열번호 4의 염기서열로 이루어진 것을 특징으로 하는 제조방법.
  6. 제3항 내지 제5항 중 어느 한 항의 방법에 의해 제조된 가뭄내성이 증진된 유전체 교정 고추 식물체.
  7. 제6항에 있어서, 상기 유전체 교정 고추 식물체는 CaAIBZ1 유전자의 bi-allelic 교정 식물체인 것을 특징으로 하는 가뭄내성이 증진된 유전체 교정 고추 식물체.
  8. 제6항에 있어서, 상기 유전체 교정 고추 식물체는 T-DNA free인 것을 특징으로 하는 가뭄내성이 증진된 유전체 교정 고추 식물체.
  9. 제6항에 따른 고추 식물체의 유전체가 교정된 종자.
PCT/KR2023/019049 2022-12-01 2023-11-24 가뭄내성 증진을 위한 CaAIBZ1 유전자교정 고추의 제조방법 WO2024117677A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20220166094 2022-12-01
KR10-2022-0166094 2022-12-01

Publications (1)

Publication Number Publication Date
WO2024117677A1 true WO2024117677A1 (ko) 2024-06-06

Family

ID=91324384

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/019049 WO2024117677A1 (ko) 2022-12-01 2023-11-24 가뭄내성 증진을 위한 CaAIBZ1 유전자교정 고추의 제조방법

Country Status (2)

Country Link
KR (1) KR20240087554A (ko)
WO (1) WO2024117677A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102101690B1 (ko) * 2018-04-10 2020-04-17 중앙대학교 산학협력단 고추 녹광품종 유래 bZIP 전사인자 CaAIBZ1을 이용한 식물체의 건조 스트레스 저항성 증진방법
KR20220060872A (ko) * 2020-11-05 2022-05-12 경상국립대학교산학협력단 식물체의 비생물적 스트레스 저항성을 조절하는 α1-COP 유전자 및 이의 용도
KR102418848B1 (ko) * 2020-06-08 2022-07-11 대한민국 지잔티아 유전자 교정용 가이드 rna 및 이의 용도
KR20220138093A (ko) * 2021-04-05 2022-10-12 서울대학교산학협력단 식물체의 비생물적 스트레스 저항성을 조절하는 OsWRKY5 유전자 및 이의 용도

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102101690B1 (ko) * 2018-04-10 2020-04-17 중앙대학교 산학협력단 고추 녹광품종 유래 bZIP 전사인자 CaAIBZ1을 이용한 식물체의 건조 스트레스 저항성 증진방법
KR102418848B1 (ko) * 2020-06-08 2022-07-11 대한민국 지잔티아 유전자 교정용 가이드 rna 및 이의 용도
KR20220060872A (ko) * 2020-11-05 2022-05-12 경상국립대학교산학협력단 식물체의 비생물적 스트레스 저항성을 조절하는 α1-COP 유전자 및 이의 용도
KR20220138093A (ko) * 2021-04-05 2022-10-12 서울대학교산학협력단 식물체의 비생물적 스트레스 저항성을 조절하는 OsWRKY5 유전자 및 이의 용도

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
JOO HYUNHEE, LIM CHAE WOO; LEE SUNG CHUL: "A pepper RING‐type E3 ligase, CaASRF1, plays a positive role in drought tolerance via modulation of CaAIBZ1 stability", THE PLANT JOURNAL, BLACKWELL SCIENTIFIC PUBLICATIONS, OXFORD., GB, vol. 98, no. 1, 1 April 2019 (2019-04-01), GB , pages 5 - 18, XP093176838, ISSN: 0960-7412, DOI: 10.1111/tpj.14191 *

Also Published As

Publication number Publication date
KR20240087554A (ko) 2024-06-19

Similar Documents

Publication Publication Date Title
Frank et al. Molecular tools to study Physcomitrella patens
Manickavasagam et al. Agrobacterium-mediated genetic transformation and development of herbicide-resistant sugarcane (Saccharum species hybrids) using axillary buds
Christey et al. Regeneration of transgenic vegetable brassicas (Brassica oleracea and B. campestris) via Ri-mediated transformation
US4940838A (en) Process for the incorporation of foreign dna into the genome of dicotyledonous plants
Ooms et al. T-DNA organization in homogeneous and heterogeneous octopine-type crown gall tissues of Nicotiana tabacum
US20120192318A1 (en) Transformation system for Camelina sativa
Loopstra et al. Agrobacterium-mediated DNA transfer in sugar pine
EP0249432A2 (en) Transformation and foreign gene expression with plant species
Akashi et al. Agrobacterium-mediated transformation system for the drought and excess light stress-tolerant wild watermelon (Citrullus lanatus)
Hosoki et al. Transformation and regeneration of ornamental kale (Brassica oleracea var. acephala DC) mediated by Agrobacterium rhizogenes
AU706650B2 (en) Genetic modification of plants
Rech et al. Agrobacterium rhizogenes mediated transformation of the wild soybeans Glycine canescens and G. clandestine: production of transgenic plants of G. canescens
Deroles et al. Transformation in Eustoma grandiflorum (lisianthus)
WO2024117677A1 (ko) 가뭄내성 증진을 위한 CaAIBZ1 유전자교정 고추의 제조방법
WO2023096614A1 (en) Method for developing haploid-inducing lines in tomato via mutant centromere- specific histone 3 protein (mtcenh3)
CN115747233A (zh) 一种调控草莓叶色的FaPDS基因及其应用
JPS6181793A (ja) 武装解除されたｔ−ｄｎａ
WO2024143970A1 (ko) 형광 단백질 발현을 이용한 Cas9 과발현 고추 식물체의 제조방법 및 상기 방법에 의해 제조된 형광 단백질 및 Cas9 동시 발현 고추 식물체
KR20050091335A (ko) 캘러스 유도를 이용한 고추 형질전환체의 대량 생산 방법
WO2022203166A1 (ko) 유전자 교정을 이용한 토마토황화잎말림바이러스에 대한 저항성이 증가된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체
KR102665987B1 (ko) 대마의 미성숙 배아를 이용한 재분화 효율 증진 방법
KR102609708B1 (ko) 식물체의 재분화 효율을 조절하는 애기장대 유래 esr2 유전자 및 이의 용도
KR102629157B1 (ko) Potato Virus X 벡터를 이용한 토마토 식물체의 유전자 교정용 재조합 벡터 및 이의 용도
WO2023003177A1 (ko) 유전자 교정을 이용한 병 저항성이 조절된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체
Franche et al. Genetic transformation of trees in the Casuarinaceae family

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23898208

Country of ref document: EP

Kind code of ref document: A1