WO2024104663A1 - Procédé de réduction des mauvaises odeurs - Google Patents

Procédé de réduction des mauvaises odeurs Download PDF

Info

Publication number
WO2024104663A1
WO2024104663A1 PCT/EP2023/078131 EP2023078131W WO2024104663A1 WO 2024104663 A1 WO2024104663 A1 WO 2024104663A1 EP 2023078131 W EP2023078131 W EP 2023078131W WO 2024104663 A1 WO2024104663 A1 WO 2024104663A1
Authority
WO
WIPO (PCT)
Prior art keywords
specified
protein
sirna
apocrine
reducing
Prior art date
Application number
PCT/EP2023/078131
Other languages
English (en)
Inventor
Carmela ERRICO
Richard Livesey Evans
Patricia Esther Mary HERON-MARTIN
Original Assignee
Unilever Ip Holdings B.V.
Unilever Global Ip Limited
Conopco, Inc., D/B/A Unilever
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Unilever Ip Holdings B.V., Unilever Global Ip Limited, Conopco, Inc., D/B/A Unilever filed Critical Unilever Ip Holdings B.V.
Publication of WO2024104663A1 publication Critical patent/WO2024104663A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q15/00—Anti-perspirants or body deodorants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/60—Sugars; Derivatives thereof
    • A61K8/606—Nucleosides; Nucleotides; Nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783—Angiosperms [Magnoliophyta]
    • A61K8/9794—Liliopsida [monocotyledons]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/08—Anti-ageing preparations
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/40—Chemical, physico-chemical or functional or structural properties of particular ingredients
    • A61K2800/52—Stabilizers
    • A61K2800/522—Antioxidants; Radical scavengers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/74—Biological properties of particular ingredients
    • A61K2800/78—Enzyme modulators, e.g. Enzyme agonists
    • A61K2800/782—Enzyme inhibitors; Enzyme antagonists
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • the present invention relates to methods for reducing malodour on the surface of the human body and to cosmetic compositions enabling these methods.
  • Typical antiperspirant actives are synthetic astringent salts based on aluminum and/or zirconium and these operate by blocking or partially blocking the sweat ducts on the surface of the human body and thereby reducing perspiration and malodour resulting therefrom.
  • WO 02/011690 discloses an antiperspirancy method whereby calcium channels located in the secretory coil cells of the eccrine glands are blocked, thereby controlling sweat production at its source.
  • siRNA oligonucleotides known as siRNA in antiperspirancy and odour reduction.
  • siRNA are small interfering RNA molecules. Most of the siRNA are 20-30 nucleotides in length. siRNA molecules are involved in RNA interference and regulate (interfere with; silence) gene expression, post-transcriptionally. The 20-30 nucleotide length seems to maximize target gene specificity over non-specific effects.
  • W02014/107124 discloses a treatment of hyperhidrosis involving the reduction of ITRP2 protein function and the use of specific siRNA molecules in such therapy.
  • EP 3,270,881 B1 discloses the use of an siRNA for reducing perspiration by affecting specific calcium channel proteins in the eccrine glands of humans.
  • WO2018/023126 discloses a method for treating osmidrosis comprising administration an inhibitor of an ABCC11 gene in a target cell, wherein the inhibitor may be an siRNA.
  • WO2021/257630 discloses methods to reduce body odour and sweat volume using compositions that reduce ABCC11 transporter activity and/or AQP5 channel water conduction, the compositions including single-stranded RNA and DNA oligonucleotides that attenuate ABCC11 and AQP5 expression.
  • an siRNA for use in treating bromhidrosis wherein the siRNA is capable of at least one of: reducing levels of specified protein mRNA; reducing levels of specified protein; reducing specified apocrine protein function; wherein the specified protein is selected from the P2-adrenoceptor, the P2Y R1 purinoceptor, and gap junction proteins connexin-43 and pannexin-1.
  • the siRNA referred to in the above first aspect of the invention is capable of: (i) reducing levels of specified protein mRNA; (ii) reducing levels of specified protein; and/or (iii) reducing specified apocrine protein function.
  • a non-therapeutic method of reducing malodour comprising the topical application of a composition comprising a cosmetically acceptable carrier and an siRNA that is capable of at least one of: reducing levels of specified apocrine protein mRNA; reducing levels of specified apocrine protein; reducing specified apocrine protein function; wherein the specified apocrine protein is selected from the P2-adrenoceptor, the P2Y R1 purinoceptor, and gap junction proteins connexin-43 and pannexin-1.
  • the second aspect of the invention may alternatively be described as the non-therapeutic use of an siRNA for reducing malodour, wherein the siRNA is capable of at least one of: reducing levels of specified apocrine protein mRNA; reducing levels of specified apocrine protein; reducing specified apocrine protein function; wherein the specified apocrine protein is selected from the P2-adrenoceptor, the P2Y R1 purinoceptor, and gap junction proteins connexin-43 and pannexin-1.
  • a deodorant composition comprising a cosmetically acceptable carrier and an siRNA that is capable of at least one of: reducing levels of specified protein mRNA; reducing levels of specified protein; reducing specified apocrine protein function; wherein the specified apocrine protein is selected from the P2-adrenoceptor, the P2Y R1 purinoceptor, and gap junction proteins connexin-43 and pannexin-1.
  • deodorant compositions and methods include compositions and methods suitable for the reduction of malodour on the surface of the human body.
  • an “apocrine protein” is a protein found within the secretory coil of human apocrine glands.
  • compositions according to the invention are intended for topical application.
  • topical application means application to the skin and does not mean application to the hair or internal cavities such as the mouth or nasal passages.
  • Topical application to the underarm regions of the human body is particularly effective.
  • application is directly onto the surface the human body.
  • Deodorant compositions according to the invention comprise a cosmetically acceptable carrier but may take any physical form. Typical product formats include sprays, liquid rollons, gels, soft solids or sticks. Gels are a preferred product form.
  • the inventors have discovered novel functionality for specific apocrine proteins in the apocrine glands of humans. Further, they have found that such proteins and their function can be affected by selected siRNA molecules, thereby reducing apocrine sweat secretion at its source.
  • apocrine proteins identified as having relevance to human sweat production are the P2-adrenoceptor, the P2Y R1 purinoceptor, and gap junction proteins connexin-43 and pannexin-1.
  • the present invention utilizes an siRNA selected in accordance with specified functional and/or chemical parameters, selected after extensive research in this area.
  • the siRNA used in accordance with the present invention is capable of at least one of: reducing levels of specified apocrine protein mRNA; reducing levels of specified apocrine protein; reducing specified apocrine protein function; wherein the specified apocrine protein is selected from the P2-adrenoceptor, the P2Y R1 purinoceptor, and gap junction proteins connexin-43 and pannexin-1.
  • apocrine proteins should be understood to be with respect to their presence in human sweat glands, in particular human apocrine glands.
  • the present invention relates at least in part to the finding that one or more of the functional parameters listed above: reducing levels of the specified apocrine proteins mRNA; reducing levels of the specified apocrine proteins; reducing specified apocrine protein function; can lead to a reduction in malodour.
  • the siRNA used in the present invention is thought to interfere with the mRNA of a specified apocrine protein and thereby reduce the level of said apocrine protein in cells to which the siRNA gains access.
  • the specified apocrine proteins relevant to the present invention are involved in the regulation of cyclic adenosine monophosphate (cAMP) and calcium levels within human cells, in particular human apocrine cells. Some of the apocrine proteins are themselves receptors that mobilise cAMP and calcium levels within the apocrine secretory coil cells, whilst others promote cAMP and calcium movement between apocrine secretory coil cells (intercellular signalling).
  • the P2Y R1 purinoceptor, and gap junction proteins connexin-43 and pannexin-1 are of particular relevance with regard to intracellular signalling.
  • Cyclic AMP and calcium levels in the cells of human apocrine glands are critical to sweat generation.
  • the present inventors have found a new method for manipulating intracellular cAMP and calcium levels in and between such cells and thereby reducing malodour.
  • the siRNA used in accordance with the present invention is capable of at least one of: reducing levels of specified apocrine protein mRNA; reducing levels of specified apocrine protein; reducing specified apocrine protein function; wherein the specified apocrine protein is selected from the P2-adrenoceptor or the P2Y R1 purinoceptor.
  • the siRNA used in accordance with the present invention is capable of at least one of: reducing levels of specified apocrine protein mRNA; reducing levels of specified apocrine protein; reducing specified apocrine protein function; wherein the specified apocrine protein is selected from the gap junction proteins connexin-43 and pannexin-1.
  • the siRNA used in accordance with the present invention is capable of at least one of: reducing levels of specified apocrine protein mRNA; reducing levels of specified apocrine protein; reducing specified apocrine protein function; wherein the specified apocrine protein is selected from the P2Y R1 purinoreceptor, and gap junction proteins connexin-43 and pannexin-1.
  • a combination of siRNAs may be employed, selected from the groups consisting of:
  • siRNA capable reducing the level of the P2-adrenoceptor and an siRNA capable of reducing the level of gap junction protein connexin-43 or pannexin-1 (ii) An siRNA capable reducing the level of the P2Y R1 purinoreceptor and an siRNA capable of reducing the level of gap junction protein connexin-43 and/or pannexin-1.
  • a combination of siRNAs may be employed, comprising:
  • an siRNA capable of reducing the level of gap junction protein connexin-43 or pannexin-1 an siRNA capable of reducing the level of gap junction protein connexin-43 or pannexin-1 ; wherein a combination of siRNAs capable of reducing levels of specified protein mRNA; reducing levels of specified protein; and/or reducing specified apocrine protein function is employed; wherein the specified apocrine proteins include each of the P2Y R1 purinoreceptor and the gap junction protein connexin-43 and/or pannexin-1.
  • a combination of siRNAs may be employed, the combination being capable of reducing levels of specified protein mRNA; reducing levels of specified protein; and/or reducing specified apocrine protein function; wherein the specified apocrine proteins include each of the P2Y R1 purinoreceptor and the gap junction protein connexin-43 and/or pannexin-1.
  • siRNA sequences should be understood as being 5’ to 3’ sequences and that the code T denotes uracil.
  • siRNA comprising a sequence selected from the group consisting of:
  • a preferred siRNA of this type comprises SEQ ID 1.
  • a particularly preferred siRNA of this type is of SEQ ID 1.
  • siRNA comprising a sequence selected from the group consisting of:
  • SEQ ID 2 TTGACTTTACTCAATCTTTGGTCTGTA and a portion comprising at least 25 nucleotides thereof, wherein the siRNA size is from 25 to 30 nucleotides.
  • a preferred siRNA of this type comprises SEQ ID 2.
  • a particularly preferred siRNA of this type is of SEQ ID 2.
  • the siRNA used is as indicated in the paragraph immediately above.
  • siRNA comprising a sequence selected from the group consisting of:
  • SEQ ID 3 GAGTTTATACTGTATCTGCTTGTACCA and a portion comprising at least 25 nucleotides thereof, wherein the siRNA size is from 25 to 30 nucleotides.
  • a preferred siRNA of this type comprises SEQ ID 3.
  • a particularly preferred siRNA of this type is of SEQ ID 3.
  • the siRNA used is as indicated in the paragraph immediately above.
  • siRNA comprising a sequence selected from the group consisting of:
  • SEQ ID 4 CAGTTTACTATCTCTCAGGTGCTTCCT and a portion comprising at least 25 nucleotides thereof, wherein the siRNA size is from 25 to 30 nucleotides.
  • a preferred siRNA of this type comprises SEQ ID 4.
  • a particularly preferred siRNA of this type is of SEQ ID 4.
  • the siRNA used is as indicated in the paragraph immediately above.
  • the siRNA used in the present invention comprises a sequence selected from the group consisting of:
  • SEQ I D 1 AATACTTGAATAGTGAGGTAGATACAT;
  • SEQ ID 2 TTGACTTTACTCAATCTTTGGTCTGTA;
  • SEQ ID 3 GAGTTTATACTGTATCTGCTTGTACCA
  • SEQ ID 4 CAGTTTACTATCTCTCAGGTGCTTCCT and a portion comprising at least 25 nucleotides of any of the above nucleotide sequences, wherein the siRNA size is from 25 to 30 nucleotides.
  • the siRNA used in the present invention comprises a sequence selected from the group consisting of:
  • SEQ ID 2 TTGACTTTACTCAATCTTTGGTCTGTA;
  • SEQ ID 3 GAGTTTATACTGTATCTGCTTGTACCA
  • SEQ ID 4 CAGTTTACTATCTCTCAGGTGCTTCCT and a portion comprising at least 25 nucleotides of any of the above nucleotide sequences, wherein the siRNA size is from 25 to 30 nucleotides.
  • the siRNA size is typically from 25 to 30 nucleotides.
  • the siRNA that works to provide the benefits of the invention may be as small as 25 nucleotides long and, in such cases, the desired nucleotide may be any portion of the sequences claimed in the present invention.
  • the desired oligonucleotide may be as long as 30 nucleotides long and may comprise any one of the sequences in its entirety and, in addition, a few nucleotides attached at one or both ends.
  • the siRNA is preferably present in a safe and effective amount in any composition of which it is a part.
  • the siRNA is more preferably present in 0.00001 to 1%, more preferably 0.0001 to 0.01% by weight of the composition.
  • compositions according to the invention comprise a cosmetically acceptable carrier.
  • a cosmetically acceptable carrier is typically a fluid, the fluid comprising water in preferred embodiments, but being anhydrous in certain alternative embodiments of the invention.
  • an anhydrous carrier comprises less than 1% of water and preferably less than 0.1%.
  • carrier or ‘cosmetically acceptable carrier’ should be understood to include all components of the composition other than the siRNA or other deodorant active (excluding C1-C4 alcohols).
  • the cosmetically acceptable carrier may include components such as emollients and/or humectants. Such components are typically used at from 0.1 to 10%.
  • the cosmetically acceptable carrier may include oils, such as ester oils, ether oils, paraffin oils and silicone oils. Such components may be used at from 1 to 80%.
  • a preferred component in compositions of the invention is a fragrance, typically at a level of from 0.1 to 5% of the total composition.
  • the fragrance is preferably accompanied by a fragrance solubiliser, typically a non-ionic surfactant used a concentration of from 0.1 to 5% of the total composition.
  • a further optional component is an organic anti-microbial agent.
  • organic anti-microbial agent may be selected from any of those known in the art, provided reasonable skill is used to avoid any incompatibilities.
  • An organic anti-microbial agent is a particularly preferred additional component when the composition used does not include a conventional, astringent aluminium containing antiperspirant salt. When employed, organic anti-microbial agents are typically used at a level of from 0.1 to 5% by weight of the composition.
  • Thickening agents may be employed in compositions of the invention. Such agents increase the viscosity of or solidify the carrier fluid of the composition.
  • Thickening agents may be selected from any of those known in the art, provided reasonable skill is used to avoid any incompatibilities.
  • a preferred class of thickeners, especially for compositions also comprising water, are hydroxyalkyl celluloses, such as hydroxypropyl cellulose. When employed, thickening agents are typically used at a level of from 0.1 to 40%. When a hydroxyalkyl cellulose thickening agent is employed, this is typically used at a level of from 0.2 to 10% by weight.
  • a preferred component of the carrier of compositions according to the invention is a skin penetration enhancer (SPE).
  • SPE skin penetration enhancer
  • Such materials are capable of aiding the transport of the siRNA from the skin surface to the apocrine and/or apocrine secretory coil cells. It is highly preferably that such materials are co-soluble with the siRNA employed.
  • the SPE can be a solvent for the siRNA, the siRNA preferably having a solubility in the SPE of greater than 50 mmol. dm -3 , more preferably greater than 100 mmol. dm -3 .
  • Suitable SPEs include oleic acid, azone, urea, transcutol, and ethanol.
  • Preferred SPEs are short chain polyhydric alcohols, in particular C2 to C5 alcohols with 2-5 hydroxy groups, especially glycerol and propylene glycol.
  • the SPE may be present at a level of 0.5-90% by weight of the composition in which it is employed, excluding any propellant that may be present. Preferably, this level is 1-50% by weight, more preferably from 2-30%, and most preferably from 3-12%.
  • SPEs are SPACE peptides and SPACE-lipid carrier systems as disclosed in J. Controlled Release, 173, 2014, 67-74 and J. Controlled Release, 179, 2014, 33-41.
  • SPEs are preferably part of an ethosomal carrier system and may preferably include 1,2-dioleoyl-3-trimethylammonium-propane (DOPAC) as a building block or be conjugated to a phospholipid.
  • DOPAC 1,2-dioleoyl-3-trimethylammonium-propane
  • compositions according to the invention comprise an astringent antiperspirant salt, such as aluminum and/or aluminum-zirconium salt.
  • an astringent antiperspirant salt such as aluminum and/or aluminum-zirconium salt.
  • such materials are typically present at from 1 to 50% of the composition of which they are part.
  • compositions of the present invention can comprise a wide range of other optional components.
  • CTFA Cosmetic Ingredient Handbook Second Edition, 1992, which is incorporated by reference herein in its entirety, describes a wide variety of non-limiting cosmetic and pharmaceutical ingredients commonly used in the skin care industry, which are suitable for use in the compositions of the present invention. Examples include: antioxidants, binders, biological additives, buffering agents, colorants, thickeners, polymers, astringents, fragrance, humectants, opacifying agents, conditioners, exfoliating agents, pH adjusters, preservatives, natural extracts, essential oils, skin sensates, skin soothing agents, and skin healing agents.
  • composition of the invention is targeted for cosmetic and dermal applications and is therefore preferably not for therapeutic/ medical use, although such use is an alternative, non-excluded option.
  • Apocrine sweat gland cellular responses were studied using an indefinitely proliferating human-derived apocrine secretory coil cell line (ASG5 cells; W02008/116713 A1 , Burry et al., 2008).
  • ASG5 cells were grown in HuMEC basal serum free medium with added HuMEC supplement (containing epidermal growth factor, hydrocortisone, isoproterenol, transferrin and insulin, and 25mg of bovine pituitary extract) and 50 pg/ml penicillin I streptomycin (cHuMEC; Thermo Fisher Scientific, UK).
  • Cells were cultured at 37°C in 5% CO2, split at 80-90% confluence, and subsequently washed twice with Dulbecco's phosphate-buffered saline (Thermofisher, UK). Cell detachment was achieved using the dissociating agent TrypLETM Select 1x (Life TechnologiesTM), which was inactivated by the addition of cHuMEC medium. Cell suspensions were used to seed fresh cultures in flask or plate formats.
  • Short interfering RNAs (siRNA) against the P2-adrenoceptor and the ATP (adenosine triphosphate) purinoceptor P2Y R1 were purchased from Origene UK, and siRNA against connexin-43 (Cx43) and pannexin-1 (Px1) from Integrated DNA Technologies (IDT, UK).
  • the P2-adrenoceptor siRNA had the sequence AATACTTGAATAGTGAGGTAGATACAT.
  • the purinoceptor P2Y R1 siRNA had the sequence TTGACTTTACTCAATCTTTGGTCTGTA.
  • the connexin-43 siRNA had the sequence GAGTTTATACTGTATCTGCTTGTACCA.
  • pannexin-1 siRNA had the sequence CAGTTTACTATCTCTCAGGTGCTTCCT.
  • Cells (at 70-80% confluency) were transfected with appropriately targeted siRNA at 10nM using a lipofectamine RNAiMax mix according to the manufacturer’s instructions.
  • Transfected cells were washed twice with pre-warmed penicllin I streptomycin-free HuMEC and subsequently harvested for gene (24h post-transfection) and protein expression (48h post-transfection), or evaluated for cAMP and intracellular Ca 2+ ([Ca 2+ ]j) responses.
  • cyclic AMP (cAMP) response of ASG5 cells was measured in the supernatant of treated cells by ELISA assay (ParameterTM ELISA, R&D Systems) following the manufacturer’s instructions and using a FLOUstar OPTIMA plate reader (Thermo Fisher Scientific, UK). Cyclic AMP responses were evoked by stimulation of the P2-adrenoceptor with the P2-selective agonist formoterol (Bio-techne, UK; ‘Control’ cells in Table 1) at 100 pM for 5min. Cyclic AMP concentration was calculated from a standard curve using MyAssay software.
  • Intracellular Ca 2+ concentration ([Ca 2+ ]j) was measured in ASG5 cells seeded on to 25 mm 2 diameter glass coverslips (approx. 10 3 cells per coverslip).
  • Cells were loaded the calcium-sensitive fluorescent indicator Fura-2 (Invitrogen, UK) by incubation (45 min - 1h, 37°C, in the dark) with the membrane-permeable acetoxymethyl ester form of the dye (Fura-2AM; 2.5 pM) in the presence of the non-ionic detergent Pluronic F127 (0.2% w/v; Sigma, UK).
  • Fura-loaded cells were mounted in a specialised chamber attached to the stage of a Nikon T3000 inverted microscope (Nikon, UK) fitted with a Hamamatsu CCD camera (Hamamatsu Photonics, UK), and perfused (ca. 5ml/min, 37°C) with a physiological saline solution containing (mM): NaCI 134, KCI 6, MgCh 1, CaCI 2 1 , HEPES 10, D-glucose 10, pH 7.4 with NaOH.
  • mM physiological saline solution containing
  • cAMP and [Ca 2+ ]j are second messenger systems known to be effective in inducing fluid secretion in a wide variety of epithelial cell types.
  • Our data show for the first time that apocrine sweat gland cells (ASG5 cells) produce a cAMP response following stimulation with the P2-adrenoceptor selective agonist formoterol, and a [Ca 2+ ]j response following stimulation with ATP.
  • siRNA knockdown of the P2-adrenoceptor impairs the cAMP response, and knockdown of the P2Y R1 , Cx43 and Px1 inhibits the ATP-induced [Ca 2+ ]j response.
  • siRNA knockdown of the P2-adrenoceptor impairs the cAMP response
  • knockdown of the P2Y R1 , Cx43 and Px1 inhibits the ATP-induced [Ca 2+ ]j response.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Birds (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Diabetes (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Hematology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Dermatology (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un procédé de réduction des mauvaises odeurs comprenant l'application topique d'une composition comprenant un ARNsi qui agit sur une protéine apocrine spécifiée pour réduire les sécrétions apocrines ; la protéine apocrine spécifiée étant choisie parmi le β2-adrénocepteur, le purinocepteur P2Y R1, et les protéines de jonction lacunaire telles que la connexine 43 et la pannexine 1.
PCT/EP2023/078131 2022-11-16 2023-10-11 Procédé de réduction des mauvaises odeurs WO2024104663A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP22207666 2022-11-16
EP22207666.3 2022-11-16

Publications (1)

Publication Number Publication Date
WO2024104663A1 true WO2024104663A1 (fr) 2024-05-23

Family

ID=84359232

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2023/078131 WO2024104663A1 (fr) 2022-11-16 2023-10-11 Procédé de réduction des mauvaises odeurs

Country Status (1)

Country Link
WO (1) WO2024104663A1 (fr)

Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002011690A1 (fr) 2000-08-03 2002-02-14 Unilever Plc Produits antisudorifiques et deodorants et leurs procedes d'utilisation
US7087743B2 (en) 2000-02-11 2006-08-08 Lvmh Recherche Oligonucleotides and use of oligonucleotides modulating the expression of enzymes involved in the synthesis of melanic pigments, as depigmentation agents
EP1752536A1 (fr) 2004-05-11 2007-02-14 RNAi Co., Ltd. Polynucléotide provoquant l'interférence rna et procédé de regulation d'expression génétique avec l"usage de ce dernier
US20070134188A1 (en) 2005-09-21 2007-06-14 L'oreal Double-stranded RNA oligonucleotides which inhibit tyrosinase expression
WO2008116713A2 (fr) 2007-03-26 2008-10-02 Unilever Plc Lignée de cellules apocrines
WO2009001359A2 (fr) 2007-06-27 2008-12-31 Quark Pharmaceuticals, Inc. Compositions et procédés d'inhibition de l'expression de gènes pro-apoptotiques
US7504385B2 (en) 2003-12-17 2009-03-17 Avon Products, Inc. si-RNA-mediated gene silencing technology to inhibit tyrosinase and reduce pigmentation
US20090209627A1 (en) * 2008-02-15 2009-08-20 Alcon Research, Ltd. RNAi-MEDIATED INHIBITION OF CONNEXIN 43 FOR TREATMENT OF IOP-RELATED CONDITIONS
WO2010080452A2 (fr) 2008-12-18 2010-07-15 Quark Pharmaceuticals, Inc. Composés d'arnsi et leurs procédés d'utilisation
EP2213738A2 (fr) 2002-11-14 2010-08-04 Dharmacon, Inc. Molécules siRNA anti Bcl-2
WO2013120726A2 (fr) 2012-02-13 2013-08-22 Unilever N.V. Composition éclaircissant la peau
WO2014107124A1 (fr) 2013-01-03 2014-07-10 Niklas Dahl Traitement de l'hyperhidrose
WO2018023126A1 (fr) 2016-07-29 2018-02-01 Kaspar Roger L Procédés de traitement de l'osmidrose
EP3270881B1 (fr) 2015-03-20 2018-12-26 Unilever PLC, a company registered in England and Wales under company no. 41424 of Compositions antiperspirantes
WO2021257630A2 (fr) 2020-06-15 2021-12-23 Cutler Richelle Médicaments et procédés pour réduire l'odeur corporelle et la transpiration

Patent Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7087743B2 (en) 2000-02-11 2006-08-08 Lvmh Recherche Oligonucleotides and use of oligonucleotides modulating the expression of enzymes involved in the synthesis of melanic pigments, as depigmentation agents
WO2002011690A1 (fr) 2000-08-03 2002-02-14 Unilever Plc Produits antisudorifiques et deodorants et leurs procedes d'utilisation
EP2213738A2 (fr) 2002-11-14 2010-08-04 Dharmacon, Inc. Molécules siRNA anti Bcl-2
US7504385B2 (en) 2003-12-17 2009-03-17 Avon Products, Inc. si-RNA-mediated gene silencing technology to inhibit tyrosinase and reduce pigmentation
EP1752536A1 (fr) 2004-05-11 2007-02-14 RNAi Co., Ltd. Polynucléotide provoquant l'interférence rna et procédé de regulation d'expression génétique avec l"usage de ce dernier
US20070134188A1 (en) 2005-09-21 2007-06-14 L'oreal Double-stranded RNA oligonucleotides which inhibit tyrosinase expression
WO2008116713A2 (fr) 2007-03-26 2008-10-02 Unilever Plc Lignée de cellules apocrines
WO2009001359A2 (fr) 2007-06-27 2008-12-31 Quark Pharmaceuticals, Inc. Compositions et procédés d'inhibition de l'expression de gènes pro-apoptotiques
US20090209627A1 (en) * 2008-02-15 2009-08-20 Alcon Research, Ltd. RNAi-MEDIATED INHIBITION OF CONNEXIN 43 FOR TREATMENT OF IOP-RELATED CONDITIONS
WO2010080452A2 (fr) 2008-12-18 2010-07-15 Quark Pharmaceuticals, Inc. Composés d'arnsi et leurs procédés d'utilisation
WO2013120726A2 (fr) 2012-02-13 2013-08-22 Unilever N.V. Composition éclaircissant la peau
WO2014107124A1 (fr) 2013-01-03 2014-07-10 Niklas Dahl Traitement de l'hyperhidrose
EP3270881B1 (fr) 2015-03-20 2018-12-26 Unilever PLC, a company registered in England and Wales under company no. 41424 of Compositions antiperspirantes
WO2018023126A1 (fr) 2016-07-29 2018-02-01 Kaspar Roger L Procédés de traitement de l'osmidrose
WO2021257630A2 (fr) 2020-06-15 2021-12-23 Cutler Richelle Médicaments et procédés pour réduire l'odeur corporelle et la transpiration

Non-Patent Citations (24)

* Cited by examiner, † Cited by third party
Title
"Posters", DIABETIC MEDICINE, JOHN WILEY & SONS, LTD, GB, vol. 22, 7 April 2005 (2005-04-07), pages 29 - 121, XP071684891, ISSN: 0742-3071, DOI: 10.1111/J.1464-5491.2005.01668.X *
"The compositions of the present invention can comprise a wide range of other optional components", THE CTFA COSMETIC INGREDIENT HANDBOOK, 1992
ANONYMOUS: "ADRB2 siRNAs", 5 September 2023 (2023-09-05), pages 1 - 7, XP093078853, Retrieved from the Internet <URL:https://www.thermofisher.com/order/genome-database/SIRNA/gene/ADRB2#filters=primarygenes:^ADRB2$;;> [retrieved on 20230905] *
ANONYMOUS: "beta2-AR siRNA (h): sc-39866", 17 November 2022 (2022-11-17), pages 1 - 1, XP093078901, Retrieved from the Internet <URL:https://datasheets.scbt.com/sc-39866.pdf> [retrieved on 20230905] *
ANONYMOUS: "siRNA s1121", 5 September 2023 (2023-09-05), pages 1 - 2, XP093078886, Retrieved from the Internet <URL:https://www.thermofisher.com/order/genome-database/details/sirna/s1121> [retrieved on 20230905] *
BABISOVÁ KLAUDIA ET AL: "Apocrine secretion in the salivary glands of Drosophilidae and other dipterans is evolutionarily conserved", vol. 10, 13 January 2023 (2023-01-13), CH, pages 1 - 25, XP093079189, ISSN: 2296-634X, Retrieved from the Internet <URL:http://dx.doi.org/10.3389/fcell.2022.1088055> DOI: 10.3389/fcell.2022.1088055 *
HAYNES ET AL: "@b"2 and @b"3-adrenoceptor inhibition of @a"1-adrenoceptor-stimulated Ca^2^+ elevation in human cultured prostatic stromal cells", EUROPEAN JOURNAL OF PHARMACOLOGY, ELSEVIER SCIENCE, NL, vol. 570, no. 1-3, 16 August 2007 (2007-08-16), pages 18 - 26, XP022202418, ISSN: 0014-2999, DOI: 10.1016/J.EJPHAR.2007.05.035 *
J. CONTROLLED RELEASE, vol. 179, 2014, pages 33 - 41
LEE NAN SOOK ET AL: "Focused Ultrasound Stimulates ER Localized Mechanosensitive PANNEXIN-1 to Mediate Intracellular Calcium Release in Invasive Cancer Cells", FRONTIERS IN CELL AND DEVELOPMENTAL BIOLOGY, vol. 8, 23 June 2020 (2020-06-23), XP093079145, DOI: 10.3389/fcell.2020.00504 *
LINDSAY S L ET AL: "Innervation and receptor profiles of the human apocrine (epitrichial) sweat gland: routes for intervention in bromhidrosis", BRITISH JOURNAL OF DERMATOLOGY, JOHN WILEY, HOBOKEN, USA, vol. 159, no. 3, 15 July 2008 (2008-07-15), pages 653 - 660, XP071128648, ISSN: 0007-0963, DOI: 10.1111/J.1365-2133.2008.08740.X *
LOMA PATRICIA ET AL: "Beta2 adrenergic receptor silencing change intraocular pressure in New Zealand rabbits", vol. 11, no. 2, 1 April 2018 (2018-04-01), AMSTERDAM, NL, pages 69 - 74, XP093078891, ISSN: 1888-4296, Retrieved from the Internet <URL:https://pdf.sciencedirectassets.com/280299/1-s2.0-S1888429618X00028/1-s2.0-S1888429617300675/main.pdf?X-Amz-Security-Token=IQoJb3JpZ2luX2VjEIX//////////wEaCXVzLWVhc3QtMSJHMEUCIHpk6S2NqtbQTJwYrvdVqLvF+/tc5fyJmHfPBPhWK8uMAiEAgWDqpy1rqPHmZL2SGBDS+mK5tqOH1yLvhca13FfqzScqswUIXRAFGgwwNTkwMDM1NDY4NjUiDE6e8> DOI: 10.1016/j.optom.2017.08.002 *
MALMERSJÖ SETH ET AL: "Neural progenitors organize in small-world networks to promote cell proliferation", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 110, no. 16, 1 April 2013 (2013-04-01), XP093079003, ISSN: 0027-8424, DOI: 10.1073/pnas.1220179110 *
NADEALI ZAKIYE ET AL: "Possible role of pannexin 1 channels and purinergic receptors in the pathogenesis and mechanism of action of SARS-CoV-2 and therapeutic potential of targeting them in COVID-19", LIFE SCIENCE, PERGAMON PRESS, OXFORD, GB, vol. 297, 11 March 2022 (2022-03-11), XP087009763, ISSN: 0024-3205, [retrieved on 20220311], DOI: 10.1016/J.LFS.2022.120482 *
ROGER TSEIN ET AL., J. BIOL. CHEM., vol. 260, 1985, pages 3440 - 3450
SILVIU LOCOVEI ET AL: "Pannexin1 is part of the pore forming unit of the P2X7 receptor death complex", FEBS LETTERS, ELSEVIER, AMSTERDAM, NL, vol. 581, no. 3, 16 January 2007 (2007-01-16), pages 483 - 488, XP071249607, ISSN: 0014-5793, DOI: 10.1016/J.FEBSLET.2006.12.056 *
SNYDER E M ET AL: "Blood pressure variation in healthy humans: A possible interaction with @b-2 adrenergic receptor genotype and renal epithelial sodium channels", MEDICAL HYPOTHESES, EDEN PRESS, PENRITH, US, vol. 65, no. 2, 1 January 2005 (2005-01-01), pages 296 - 299, XP004909539, ISSN: 0306-9877, DOI: 10.1016/J.MEHY.2004.12.031 *
STEFANIE GÖDECKE ET AL: "Thrombin-induced ATP release from human umbilical vein endothelial cells", AMERICAN JOURNAL OF PHYSIOLOGY CELL PHYSIOLOGY, vol. 302, no. 6, 15 March 2012 (2012-03-15), US, pages C915 - C923, XP055652954, ISSN: 0363-6143, DOI: 10.1152/ajpcell.00283.2010 *
TAMARA MARTÍNEZ ET AL: "In Vitro and In Vivo Efficacy of SYL040012, a Novel siRNA Compound for Treatment of Glaucoma", MOLECULAR THERAPY, vol. 22, no. 1, 12 September 2013 (2013-09-12), pages 81 - 91, XP055189546, ISSN: 1525-0016, DOI: 10.1038/mt.2013.216 *
TAMÁS DELI ET AL: "Contribution from P2X and P2Y purinoreceptors to ATP-evoked changes in intracellular calcium concentration on cultured myotubes", PFLÜGERS ARCHIV - EUROPEAN JOURNAL OF PHYSIOLOGY, SPRINGER, BERLIN, DE, vol. 453, no. 4, 17 October 2006 (2006-10-17), pages 519 - 529, XP019473999, ISSN: 1432-2013, DOI: 10.1007/S00424-006-0146-6 *
WOLFE B B ET AL: "In Vitro Study of beta-Adrenergic Receptors", ANNUAL REVIEW OF PHARMACOLOGY AND TOXICOLOGY., vol. 17, no. 1, 1 April 1977 (1977-04-01), US, pages 575 - 604, XP093079458, ISSN: 0362-1642, DOI: 10.1146/annurev.pa.17.040177.003043 *
WYPYCH DOROTA ET AL: "P2Y1 nucleotide receptor silencing and its effect on glioma C6 calcium signaling.", vol. 59, no. 4, 31 December 2012 (2012-12-31), PL, XP093078925, ISSN: 0001-527X, Retrieved from the Internet <URL:https://ojs.ptbioch.edu.pl/index.php/abp/article/download/2115/751> DOI: 10.18388/abp.2012_2115 *
YANG NAN ET AL: "Olodaterol exerts anti-inflammatory effects on COPD airway epithelial cells", vol. 22, no. 1, 1 December 2021 (2021-12-01), XP093078843, Retrieved from the Internet <URL:https://respiratory-research.biomedcentral.com/counter/pdf/10.1186/s12931-021-01659-2.pdf> DOI: 10.1186/s12931-021-01659-2 *
YANG NAN ET AL: "Supplementary Information: Olodaterol exerts anti-inflammatory effects on COPD airway epithelial cells", RESPIRATORY RESEARCH, vol. 22, no. 1, 1 December 2021 (2021-12-01), pages S1 - S2, XP093078857 *
YU YIQUN ET AL: "The role of connexin 43 in mediating odor response", vol. 94, no. 6, 1 June 2015 (2015-06-01), DE, pages 267 - 275, XP093079129, ISSN: 0171-9335, Retrieved from the Internet <URL:https://www.sciencedirect.com/science/article/pii/S0171933515000369/pdfft?md5=66513c1b30a4e9ecf96d2c47e8afb78c&pid=1-s2.0-S0171933515000369-main.pdf> DOI: 10.1016/j.ejcb.2015.04.001 *

Similar Documents

Publication Publication Date Title
US10227594B2 (en) Antiperspirant composition
EP3403673B1 (fr) Composition pour empêcher ou améliorer la chute et le grisonnement des cheveux, et utilisation de cette dernière
JP2010150258A (ja) 保湿効果又は老化防止効果を有する少なくとも２つの浸透圧調節物質を含有する化粧品組成物
KR101938548B1 (ko) 마이크로 ｒｎａ를 포함하는 색소형성유전자 발현조절용 조성물
KR20060123256A (ko) 모발의 태모화 방법 및 조성물
FR2790757B1 (fr) Oligonucleotides contenant une sequence antisens stabilises par une structure secondaire et compositions pharmaceutiques les contenant.
JP2019523302A (ja) 腋臭を治療する方法
KR101849102B1 (ko) 마이크로 ｒｎａ를 포함하는 색소형성유전자 발현조절용 조성물
WO2024104663A1 (fr) Procédé de réduction des mauvaises odeurs
WO2021257630A2 (fr) Médicaments et procédés pour réduire l&#39;odeur corporelle et la transpiration
ES2322583T3 (es) Oligonucleotidos anti-androgenos utilizables en el tratamiento de trastornos dermatologicos relacionados con el metabolismo de los androgenos, sus composiciones farmaceuticas, sus usos y metodo de tratamiento.
KR20160016475A (ko) Tslp 발현을 억제하는 올리고뉴클레오타이드 및 이를 포함하는 미용 또는 약제학적 조성물
KR102541256B1 (ko) Lipa 억제를 통한 흑색종 예방 또는 치료제, 및 그 스크리닝 방법
EP4046635A9 (fr) Composition comprenant un inhibiteur de la kinase rip, pour prévenir la chute des cheveux ou pour favoriser la repousse des cheveux
KR20170057194A (ko) Tslp 발현을 억제하는 올리고뉴클레오타이드 및 이를 포함하는 미용 또는 약제학적 조성물
US20220168206A1 (en) Active agent for use in hair growth regulation
KR20180027157A (ko) 아멘토플라본을 포함하는 피지 과다분비 또는 지루성 습진의 억제 또는 개선용 조성물
KR101871920B1 (ko) 마이크로 ｒｎａ를 포함하는 조성물
KR101800243B1 (ko) 마이크로 ｒｎａ를 포함하는 색소형성유전자 발현조절용 조성물
EP3171879B1 (fr) Prévention et traitement des maladies inflammatoires cutanées
KR102475128B1 (ko) Entpd4 억제를 통한 흑색종 예방 또는 치료제, 및 그 스크리닝 방법
KR20200041599A (ko) Sh3bp4 억제를 통한 흑색종 예방 또는 치료제, 및 그 스크리닝 방법
KR20210045916A (ko) Rip 키나아제 억제제를 포함하는 탈모 방지 또는 발모 촉진용 조성물
KR20200042231A (ko) Linc00518 억제를 통한 베무라페닙 내성 흑색종 예방 또는 치료제, 및 그 스크리닝 방법
KR101852440B1 (ko) 듀옥스 2 ｍｉＲＮＡ를 포함하는 피부 세포 분화 조절용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23789896

Country of ref document: EP

Kind code of ref document: A1