WO2024096354A1 - Ifitm3 억제제를 포함하는 신장암 예방 또는 치료용 약학적 조성물 - Google Patents

Ifitm3 억제제를 포함하는 신장암 예방 또는 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2024096354A1
WO2024096354A1 PCT/KR2023/015507 KR2023015507W WO2024096354A1 WO 2024096354 A1 WO2024096354 A1 WO 2024096354A1 KR 2023015507 W KR2023015507 W KR 2023015507W WO 2024096354 A1 WO2024096354 A1 WO 2024096354A1
Authority
WO
WIPO (PCT)
Prior art keywords
ifitm3
kidney cancer
expression
cell line
protein
Prior art date
Application number
PCT/KR2023/015507
Other languages
English (en)
French (fr)
Inventor
조영미
이재련
박자민
윤선영
Original Assignee
재단법인 아산사회복지재단
울산대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020220142368A external-priority patent/KR20240068809A/ko
Application filed by 재단법인 아산사회복지재단, 울산대학교 산학협력단 filed Critical 재단법인 아산사회복지재단
Publication of WO2024096354A1 publication Critical patent/WO2024096354A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404—Indoles, e.g. pindolol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4412—Non condensed pyridines; Hydrogenated derivatives thereof having oxo groups directly attached to the heterocyclic ring
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/4439—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/4709—Non-condensed quinolines and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids

Definitions

  • It relates to a pharmaceutical composition for preventing or treating kidney cancer containing an IFITM3 inhibitor.
  • Tyrosine Kinase inhibitors are commonly used to treat advanced and metastatic clear cell renal cell carcinoma (ccRCC).
  • ccRCC metastatic clear cell renal cell carcinoma
  • One aspect is to provide a pharmaceutical composition for preventing or treating kidney cancer, including an inhibitor that inhibits the expression or activity of the IFITM3 (interferon induced transmembrane protein 3) gene or its protein.
  • IFITM3 interferon induced transmembrane protein 3
  • Another aspect includes contacting kidney cancer cells with a test agent; and measuring the expression or activity level of the IFITM3 gene or protein thereof in the contacted renal cancer cells. It is done.
  • Another aspect is to provide a health functional food for preventing or improving kidney cancer containing an inhibitor that inhibits the expression or activity of the IFITM3 gene or its protein.
  • One aspect provides a pharmaceutical composition for preventing or treating kidney cancer, including an inhibitor that inhibits the expression or activity of the IFITM3 (interferon induced transmembrane protein 3) gene or its protein.
  • IFITM3 interferon induced transmembrane protein 3
  • IFITM3 interferon induced transmembrane protein 3
  • IFITM3 interferon induced transmembrane protein 3
  • the IFITM3 gene may include all polynucleotides composed of any sequence known in the art, and may include variants having one or more substitutions, insertions, deletions, and combinations thereof that do not reduce its activity. These variants are 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94 with the IFITM3 gene sequence. %, 95%, 96%, 97%, 98%, 99% or more.
  • the IFITM3 protein may include a polypeptide consisting of any sequence known in the art, and may contain a different sequence due to deletion, insertion, substitution, or combination of amino acid residues, within the range that does not affect the function of the protein. It may be a variant or fragment of an amino acid having. In some cases, the IFITM3 protein may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, or farnesylation. These variants may have 80%, 90%, 95%, or more homology to the IFITM3 protein sequence.
  • the inhibitor that inhibits the expression or activity of IFITM3 may reduce the expression level of the gene encoding IFITM3 or the expression level of IFITM3 protein, or may inhibit the activity of IFITM3 protein.
  • the expression inhibitor of the IFITM3 gene may include any substance known in the art as long as it suppresses the mRNA of the gene encoding the IFITM3 protein, and may be manufactured by various methods, such as chemical synthesis or synthesis using in vitro transcription. You can.
  • the inhibitor includes antisense nucleotides, small interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA), ribozyme, A group consisting of nucleic acids, peptides, peptide mimetics, aptamers, antibodies, small molecule compounds, and antibody drug conjugates. It may be one or more selected from.
  • small interfering RNA siRNA
  • shRNA short hairpin RNA
  • miRNA micro RNA
  • ribozyme A group consisting of nucleic acids, peptides, peptide mimetics, aptamers, antibodies, small molecule compounds, and antibody drug conjugates. It may be one or more selected from.
  • the antisense nucleotide as defined by Watson-Click base pairing, binds (hybridizes) to the complementary base sequence of DNA, immature-mRNA, or mature mRNA, which may mean interfering with the flow of genetic information from DNA to protein. . Additionally, because the antisense nucleotide is a long chain of monomer units, it can be easily synthesized for the target RNA sequence.
  • the siRNA may refer to short double-stranded RNA that can induce RNA interference through cleavage of a specific mRNA.
  • the siRNA is not limited to complete pairing of the double-stranded RNA portions where RNAs are paired, and may have mismatches (corresponding bases are not complementary), bulges (corresponding bases are missing in one chain), etc. It may also include parts that do not form a pair.
  • the siRNA end structure can be either a blunt end or a protruding end as long as it can inhibit the expression of the target gene by RNA interference, and the sticky end structure can be either a 3' end protrusion structure or a 5' end protrusion structure.
  • the shRNA may refer to an RNA sequence that creates a strong hairpin turn, and may be used to silence gene expression through RNA interference.
  • the shRNA can be transferred to cells using a vector for cell introduction, and such vector is always transferred to daughter cells, so that gene silencing can be inherited.
  • the shRNA hairpin structure is degraded into siRNA by an intracellular mechanism and bound to an RNA-induced silencing complex, and the complex can bind to and degrade the mRNA corresponding to the siRNA.
  • the nucleotide sequence encoding the shRNA may include a nucleotide sequence represented by SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
  • the ribozyme may refer to an enzymatic RNA molecule capable of catalyzing specific RNA cleavage. Nucleic acid-soluble cleavage can be induced by specific hybridization of a target RNA complementary to the molecular sequence of the ribozyme, and the ribozyme contains a known sequence responsible for cleavage of one or more sequences complementary to the target RNA or a functional equivalent sequence. It can be included.
  • the ribozyme may be a hammer-head ribozyme or a Cech type ribozyme, which is an endoribonuclease RNA, and is formed by a modified oligonucleotide to ensure safety and targeting. etc. can be improved.
  • the ribozyme can be distributed to cells expressing the target gene in vivo, and has a strong constitutive polymerase enzyme such that the transfected cells produce a sufficient amount of ribozyme to destroy the endogenous target messenger and inhibit translation.
  • DNA constructs encoding the ribozyme under the control of a III or polymerase II promoter can be used. Because ribozymes have catalytic activity, unlike other antisense molecules, they may need to be maintained at low concentrations within the cell.
  • the peptides and peptide mimetics may inhibit the activity of the IFITM3 protein by inhibiting the binding of the IFITM3 protein to other proteins.
  • the peptide mimetics may be peptides or non-peptides and may be composed of amino acids linked by non-peptide bonds, such as psi bonds.
  • Non-hydrolyzable peptide mimetics can be prepared using a ⁇ -turn dipeptide core, keto-methylene pseudopeptides, azepines, benzodiazepines, ⁇ -aminoalcohols, or substituted gamma-lactam rings as key moieties.
  • the aptamer may refer to a single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) that has a stable tertiary structure and can bind to a target molecule with high affinity and specificity, and may be a molecular organic substance. , peptides, membrane proteins, etc., can bind to and block their functions, so they can be viewed as a type of chemical antibody that replaces single antibodies.
  • the aptamer can be obtained by isolating oligomers that bind to specific chemical or biological molecules with high affinity and selectivity using an oligonucleotide library called SELEX (systematic evolution of ligands by exponential enrichment). .
  • the antibody may be a monoclonal antibody, polyclonal antibody, or recombinant antibody.
  • Antibodies against specific proteins can be easily produced using techniques well known in the art if the sequence of the protein is known. Specifically, it can be produced using hybridoma method, or phage antibody library technology.
  • hybridoma cells secreting monoclonal antibodies can be created by fusing immune cells isolated from an immunologically suitable host animal, such as a mouse injected with an antigen protein, and a cancer cell line. These two groups of cells can be fused using polyethylene glycol, etc., and the antibody-producing cells can be proliferated by standard culture methods.
  • Antibodies prepared by the above method can be separated and purified using methods such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, and affinity chromatography.
  • the polyclonal antibody can be produced by injecting an immunogenic biomarker protein or its fragment into an external host.
  • the external host may be a mammal such as a mouse, rat, sheep, or rabbit.
  • the immunogen When the immunogen is injected by intramuscular, intraperitoneal or subcutaneous injection, it may be administered together with an adjuvant to increase antigenicity. Thereafter, blood can be collected regularly from an external host to obtain serum showing improved titer and specificity for the antigen, and the antibody can be isolated and purified therefrom.
  • the small molecule compound is not limited as long as it can inhibit the expression or activity of the IFITM3 gene or its protein. More specifically, the small molecule compound may be an mTOR inhibitor.
  • the mTOR inhibitor may include, but is not limited to, dactolisib, rapamycin, or everolimus.
  • the antibody-drug conjugate refers to a form in which a drug and an antibody are chemically linked without reducing the biological activities of the antibody and drug.
  • the antibody-drug conjugate may refer to a medicine used to identify tumor cells as targets using the specificity of antibodies and to select or destroy tumors by delivering toxic drugs into tumor cells.
  • the antibody-drug conjugate may refer to a therapeutic agent in the form of an immunoconjugate that can be used for targeted treatment of diseases consisting of an antibody linked to a drug or a fragment thereof.
  • the antibody allows the ADC to bind to the target cell, and sometimes flows into the target cell through the antibody, allowing the drug contained in the ADC to be secreted from the introduced cell. Since the ADC has a superior hit rate to target cells using antibodies compared to conventional therapeutic agents, it has low side effects and has a wide range of application.
  • the kidney cancer may be drug-resistant kidney cancer.
  • drug resistance may be used in the same sense as drug resistance, and “drug resistance” refers to resistance to a specific drug, that is, resistance, or when a specific drug is administered over a long period of time. This can mean that it occurs when cells acquire drug resistance and the treatment effect cannot be properly achieved.
  • the drug may be an anticancer agent.
  • the drug may be a tyrosine kinase inhibitor (TKI).
  • TKI tyrosine kinase inhibitor
  • the tyrosine kinase inhibitor is a group consisting of sunitinib, sorafenib, pazopanib, cabozantinib, axitinib, and tivozanib. It may be any one or more selected from.
  • prevention may refer to any action that suppresses cancer or delays its onset by administering the composition.
  • treatment may mean an action to improve cancer, such as delaying or stopping the growth or progression of cancer by administering the composition.
  • the term “pharmaceutical composition” may refer to a molecule or compound that imparts some beneficial effect upon administration to a subject. Beneficial effects include enabling diagnostic decisions; Improvement of a disease, symptom, disorder or condition; Reducing or preventing the onset of a disease, symptom, disorder or condition; and generally responding to a disease, symptom, disorder or condition.
  • the pharmaceutical composition may contain an inhibitor that inhibits the expression or activity of the IFITM3 gene or its protein in an amount of 0.0001 to 70% by weight based on the total weight of the composition, but is not limited thereto.
  • the pharmaceutical composition may further include pharmaceutically acceptable carriers, excipients, and diluents in addition to the active ingredients described above.
  • carriers, excipients and diluents include lactose, textose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, not determined.
  • Quality cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc. can be used, and target organ-specific antibodies can be used to specifically act on the target organ.
  • other ligands can be used in combination with the carrier.
  • the pharmaceutical composition can be prepared in various forms for parenteral or oral administration according to known methods.
  • Representative formulations for parenteral administration may include aerosol formulations and injectable formulations.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations contain the active ingredient plus at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. It is prepared by mixing. Additionally, in addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.
  • excipient such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. It is prepared by mixing.
  • lubricants such as magnesium stearate and talc may also be used.
  • Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups.
  • various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is.
  • Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories.
  • Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • As a base for suppositories wethepsol, macrogol, Tween 61, cacao, laurin, glycerogelatin, etc. can be used. However, it is not limited thereto, and the pharmaceutical composition can be formulated according to the purpose using any method known in the art without limitation.
  • the pharmaceutically effective amount and effective dosage of the pharmaceutical composition may vary depending on the formulation method, administration method, administration time, and/or administration route of the pharmaceutical composition.
  • the type and degree of response to be achieved by administration of the pharmaceutical composition may vary depending on various factors including drugs used together and components of other compositions, and similar factors well known in the pharmaceutical field.
  • a person skilled in the art can easily determine and prescribe an effective dosage for the desired treatment.
  • the pharmaceutical composition may be administered once a day, or may be administered in several divided doses.
  • the dosage of the pharmaceutical composition may be 1 ug/kg/day to 1,OOO mg/kg/day.
  • the subject may be a mammal, such as a human, cow, horse, pig, dog, sheep, goat, or cat.
  • the subject may be an individual in need of cure of kidney cancer, or a malignant or benign tumor with increased expression of IFITM3.
  • the malignant or benign tumor with increased expression of IFITM3 may be a kidney cancer-related tumor, but is not limited thereto.
  • administration may mean introducing a pharmaceutical composition according to one aspect to an individual by any suitable method, and administration may be performed through various routes, such as oral or parenteral, as long as it can reach the target tissue. You can.
  • Another aspect includes contacting kidney cancer cells with a test agent; and measuring the expression or activity level of the IFITM3 gene or protein thereof in the contacted kidney cancer cells.
  • the renal cancer cells may be tyrosine kinase inhibitor-resistant renal cancer cells.
  • the screening method is performed when the expression or activity level of the IFITM3 gene or its protein in kidney cancer cells in contact with the test substance is reduced compared to the control group not in contact with the test substance, and the test substance is used to prevent or prevent tyrosine kinase inhibitor-resistant kidney cancer. It may include the step of determining that the substance is a therapeutic substance.
  • the step of measuring the expression or activity level of the IFITM3 gene or its protein is reverse transcription polymerase chain reaction (RTPCR) or real-time polymerase chain reaction (real-time PCR).
  • RTPCR reverse transcription polymerase chain reaction
  • real-time polymerase chain reaction real-time PCR
  • western blot western blot
  • northern blot ELISA (enzyme linked immunosorbent assay)
  • radioimmunoassay radioimmunodiffusion
  • immunoprecipitation immunohistochemical analysis. analysis
  • FACS Fluorescence-activated cell sorting
  • Another aspect is to provide a health functional food for preventing or improving kidney cancer containing an inhibitor that inhibits the expression or activity of the IFITM3 gene or its protein.
  • the above health functional foods are foods manufactured using nutrients that are easily deficient in daily diet or raw materials or ingredients with useful functions for the human body (hereinafter referred to as ‘functional raw materials’), and are used to maintain health or prevent certain diseases or symptoms. /Or it can refer to any food that helps to improve, and there are no particular restrictions on the form of the final product.
  • the health functional food may have a dosage form selected from the group consisting of powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, leached teas, or health drinks. .
  • the content of the active ingredient contained in the health functional food for example, an expression inhibitor of the IFITM3 gene or an activity inhibitor of the IFITM3 protein, is not appropriately limited depending on the form of the food, the desired use, etc., and is, for example, the total weight of the food.
  • the health functional foods include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic or natural flavors, colorants, thickening agents (cheese, chocolate, etc.), pectic acid or its salt, alginic acid or its salt, It may additionally contain one or more selected from the group consisting of organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, and carbonating agents used in carbonated beverages.
  • the ratio of these additives may be selected in the range of 0.001 to about 20 parts by weight per 100 parts by weight of the total health functional food, but is not limited thereto.
  • Another aspect is to provide a method for preventing or treating kidney cancer, comprising administering an inhibitor that inhibits the expression or activity of the IFITM3 (interferon induced transmembrane protein 3) gene or its protein to an individual in need thereof.
  • IFITM3 interferon induced transmembrane protein 3
  • Another aspect provides the use of an inhibitor that inhibits the expression or activity of the IFITM3 (interferon induced transmembrane protein 3) gene or its protein for use in the manufacture of a medicine for preventing or treating kidney cancer.
  • IFITM3 interferon induced transmembrane protein 3
  • Another aspect provides the use of an inhibitor that inhibits the expression or activity of the IFITM3 (interferon induced transmembrane protein 3) gene or its protein for the prevention or treatment of kidney cancer.
  • IFITM3 interferon induced transmembrane protein 3
  • composition By suppressing the expression or activity of IFITM3, a tumorigenesis inhibition effect can be induced.
  • IFITM3 in treatment-resistant cancer cell lines, tumor formation, tumor cell invasion, and tumor cell survival can be suppressed, effectively improving treatment resistance. Accordingly, it can be used to prevent or treat treatment-resistant cancer.
  • Figure 1 is a graph and images measuring the expression level of IFITM3 in the 786-O/P cell line and 786-O/suR cell line: P is a TKI-sensitive cell line, and R is a TKI-resistant cell line.
  • Figure 2 is a graph showing the change in survival rate of kidney cancer cells according to IFITM3 mimicker treatment: R is 786-O/suR cell line; P is 786-O/P cell line; P + empty is the 786-O/P cell line into which the empty vector was inserted; P + IFITM3 is a 786-O/P cell line into which a vector containing an IFITM3 mimicker was inserted.
  • Figure 3 is an image comparing the tumorigenic ability of kidney cancer cells according to IFITM3 mimicker treatment: R is 786-O/suR cell line; P is 786-O/P cell line; P + empty is the 786-O/P cell line into which the empty vector was inserted; P + IFITM3 is a 786-O/P cell line into which a vector containing an IFITM3 mimicker was inserted.
  • Figure 4 is an image showing cell invasiveness of kidney cancer cells according to IFITM3 mimicker treatment: R is 786-O/suR cell line; P is 786-O/P cell line; P + empty is the 786-O/P cell line into which the empty vector was inserted; P + IFITM3 is a 786-O/P cell line into which a vector containing an IFITM3 mimicker was inserted.
  • Figure 5 is an image showing the cell migration ability of kidney cancer cells according to IFITM3 mimicker treatment: R is 786-O/suR cell line; P is 786-O/P cell line; P + empty is the 786-O/P cell line into which the empty vector was inserted; P + IFITM3 is a 786-O/P cell line into which a vector containing an IFITM3 mimicker was inserted.
  • Figure 6 is a graph showing the change in survival rate of kidney cancer cells according to treatment with IFITM3 shRNA: P is 786-O/P cell line; R is 786-O/suR cell line; R + empty refers to the 786-O/suR cell line with the empty vector inserted; R + shRNA IFITM3 sh4 is the 786-O/suR cell line inserted with a vector inserting shRNA4 for IFITM3; R + shRNA IFITM3 sh5 is the 786-O/suR cell line inserted with a vector inserting shRNA5 against IFITM3; R + shRNA IFITM3 sh6 is a 786-O/suR cell line in which a vector containing shRNA6 for IFITM3 was inserted.
  • Figure 7 is an image comparing the tumorigenic ability of kidney cancer cells according to treatment with IFITM3 shRNA: P is 786-O/P cell line; R is 786-O/suR cell line; R + empty refers to the 786-O/suR cell line with the empty vector inserted; R + IFITM3 shRNA is a 786-O/suR cell line in which a vector containing IFITM3 shRNA4 was inserted.
  • Figure 8 is an image showing cell invasiveness of renal cancer cells according to treatment with IFITM3 shRNA: P is 786-O/P cell line; R is 786-O/suR cell line; R + empty refers to the 786-O/suR cell line with the empty vector inserted; R + IFITM3 shRNA is a 786-O/suR cell line in which a vector containing IFITM3 shRNA4 was inserted.
  • Figure 9 is an image showing the cell migration ability of kidney cancer cells according to treatment with IFITM3 shRNA: P is 786-O/P cell line; R is 786-O/suR cell line; R + empty refers to the 786-O/suR cell line with the empty vector inserted; R + IFITM3 shRNA is a 786-O/suR cell line in which a vector containing IFITM3 shRNA4 was inserted.
  • Figure 10 is a graph showing the change in survival rate of kidney cancer cells according to treatment with Doctorisib: P is 786-O/P cell line; R is 786-O/suR cell line; R + DMSO for 786-O/suR cell line treated with dimethyl sulfoxide; R + DMSO for 786-O/suR cell line treated with dimethyl sulfoxide; R + TCN is the 786-O/suR cell line treated with Doctoriship.
  • Figure 11 is an image measuring the protein expression levels of IFITM3, TRAF6, MAPK (p-ERK), c-FOS, c-Myc, and Survivin in the 786-O/P cell line and 786-O/suR cell line.
  • Figure 12 shows the change in tumor size over time in mice transplanted with TKI-sensitive renal cancer cells in which IFITM3 gene expression was increased with an IFITM3 mimicker, or TKI-resistant renal cancer cells in which IFITM3 gene expression was suppressed with shRNA of the IFITM3 gene.
  • P + NCT is the 786-O/P cell line, which is a negative control group
  • P + IFITM3 is the 786-O/P cell line into which a vector containing an IFITM3 mimicker was inserted
  • R + NCT is the 786-O/suR cell line, which is a negative control group
  • R + IFITM3 shRNA is the 786-O/suR cell line into which a vector containing IFITM3 shRNA4 was inserted.
  • Sunitinib was added to the culture medium of kidney cancer cell lines (786-O, ACHN, Caki-1, 769-p, and A-704) and cultured for more than 6 months, and TKI-resistant kidney cancer cell lines were established.
  • human renal cell carcinoma cell lines 769-P, 786-O, ACHN, Caki-1 and A704 (American Type Culture Collection) were cultured in medium containing 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin (Gibco, Grand Island, NY) at 37°C and 5% CO 2 .
  • the A704 cell line was cultured in EMEM medium; RPMI-1640 medium for 769-P, 786-O, ACHN and Caki-1 cell lines.
  • sunitinib (Sutent, Pfizer Pharmaceutical, New York, NY) was treated at a concentration of 2.5 ⁇ M for 6 months, and for 786-O, Caki-1, 769-p, and A-704 cell lines, respectively.
  • TKI-resistant cell lines were established by treatment with increasing concentrations of sunitinib for 5 to 6 months at IC10 to a final concentration of 17 ⁇ M.
  • the kidney cancer cell line (786-O/P) and the TKI established therefrom were used.
  • the expression level of IFITM3 in -resistant kidney cancer cell line (786-O/suR) was measured through Western blot, and the results are shown in Figure 1.
  • total proteins were extracted from cultured 786-O/P cell lines and 786-O/suR cell lines using RIPA lysis and extraction buffer (Thermo Fisher Scientific) and separated through 12% SDS-PAGE polyacrylamide gels. did. At this time, the following antibodies were used as antibodies against the target protein: IFITM3 (ab109429, Abcam), ß-actin (A5441; Sigma-Aldrich).
  • TKI-sensitive kidney cancer cell line (786-O/P) was treated with IFITM3 mimicker (SEQ ID NO: 4) to increase the expression of the IFITM3 gene.
  • the cloning Myc-DDK-tagge vector (Origene, RC201635, IFITM3 (NM_021034) Human Tagged ORF Clone) with the IFITM3 ORF structure was inserted into a TKI-sensitive renal cancer cell line (786-O). Afterwards, the 786-0 cell line was treated with sunitinib, and the cell viability, colony-forming ability, cell migration ability, and cell invasion of the TKI-sensitive renal cancer cell line were confirmed.
  • 786-0 cells treated with sunitinib were seeded in a 96-well plate, and 1 mg/mL MTT was added to each well. And after incubation for 4 hours, MTT was removed. Afterwards, dimethyl sulfoxide (DMSO) was added to each well and absorbance was measured at 540 nm to analyze cell viability. And the results are shown in Figure 2.
  • DMSO dimethyl sulfoxide
  • Figure 2 is a graph showing the change in survival rate of kidney cancer cells according to IFITM3 mimicker treatment: R is 786-O/suR cell line; P is 786-O/P cell line; P + empty is the 786-O/P cell line into which the empty vector was inserted; P + IFITM3 is a 786-O/P cell line into which a vector containing an IFITM3 mimicker was inserted.
  • the cell viability of 786-O/P was only about 45% upon treatment with sunitinib, but 786-O/P had increased expression of IFITM3 by adding IFITM3 mimicker.
  • the survival rate was maintained at 101% despite treatment with sunitinib, confirming that it showed a survival rate similar to that of the TKI-resistant cell line.
  • a soft agar colony formation assay was used using agarose (A9539, Sigma-Aldrich, St. Louis, MO). Specifically, the 786-0 cells treated with sunitinib were plated in triplicate in a 6-well plate (300 cells/well). And after 7 to 14 days, cell colonies were stained with CrystalViolet (C1035, Biosesang), counted, and a colony formation assay was performed. And the results are shown in Figure 3.
  • Figure 3 is an image comparing the tumorigenic ability of kidney cancer cells according to IFITM3 mimicker treatment: R is 786-O/suR cell line; P is 786-O/P cell line; P + empty is the 786-O/P cell line into which the empty vector was inserted; P + IFITM3 is a 786-O/P cell line into which a vector containing an IFITM3 mimicker was inserted.
  • matrigel basement membrane matrix (Corning Inc., Corning, NY) was coated on a transwell of Falcon® Permeable Supports (Corning), and the 786 treated with sunitinib was applied to the transwell. -0 cells (2.5 ⁇ 10 5 cells) were plated. After culturing for 24 hours, the upper surface of the well was wiped with a cotton swab, the lower well was photographed under a microscope, and an atrigel migration assay was performed. And the results are shown in Figure 4.
  • Figure 4 is an image showing cell invasiveness of kidney cancer cells according to IFITM3 mimicker treatment: R is 786-O/suR cell line; P is 786-O/P cell line; P + empty is the 786-O/P cell line into which the empty vector was inserted; P + IFITM3 is a 786-O/P cell line into which a vector containing an IFITM3 mimicker was inserted.
  • Figure 5 is an image showing cell migration of kidney cancer cells according to IFITM3 mimicker treatment: R is 786-O/suR cell line; P is 786-O/P cell line; P + empty is the 786-O/P cell line into which the empty vector was inserted; P + IFITM3 is a 786-O/P cell line into which a vector containing an IFITM3 mimicker was inserted.
  • the TKI-resistant cell line (786-O) established in Example 1 was treated with IFITM3 shRNA to suppress the expression of the IFITM3 gene.
  • IFITM3 shRNA4 (SEQ ID NO: 1), IFITM3 shRNA5 (SEQ ID NO: 2), or IFITM3 shRNA6 (SEQ ID NO: 3) was cloned into the LKO.1-CMV-Neo vector (SHCLND, TRCN0000118024; Sigma-Aldrich, St. Louis, MO), and the vector was cloned into 786-O/sunitinib-resistant cell line (786-O/sunitinib-resistant: 786-O/suR) and 786-O/sunitinib-sensitive cell line (786-O/P) inserted into.
  • LKO.1-CMV-Neo vector LKO.1-CMV-Neo vector
  • shRNA sequence IFITM3 shRNA4 5 ⁇ - CCTCATGACCATTCTGCTCAT -3 ⁇ SEQ ID NO: 1
  • shRNA5 5 ⁇ - GCTTCATAGCATTCGCCTACT -3 ⁇
  • shRNA6 5 ⁇ - CCTGAACATCTGGGCCCTGAT -3 ⁇ SEQ ID NO: 3
  • Figure 6 is a graph showing the change in survival rate of kidney cancer cells according to treatment with IFITM3 shRNA: P is 786-O/P cell line; R is 786-O/suR cell line; R + empty refers to the 786-O/suR cell line with the empty vector inserted; R + shRNA IFITM3 sh4 is the 786-O/suR cell line inserted with a vector inserting shRNA4 for IFITM3; R + shRNA IFITM3 sh5 is the 786-O/suR cell line inserted with a vector inserting shRNA5 against IFITM3; R + shRNA IFITM3 sh6 is a 786-O/suR cell line in which a vector containing shRNA6 for IFITM3 was inserted.
  • Figure 7 is an image comparing the tumorigenic ability of kidney cancer cells according to treatment with IFITM3 shRNA: P is 786-O/P cell line; R is 786-O/suR cell line; R + empty refers to the 786-O/suR cell line with the empty vector inserted; R + IFITM3 shRNA is a 786-O/suR cell line in which a vector containing IFITM3 shRNA4 was inserted.
  • Figure 8 is an image showing the cell invasion ability of kidney cancer cells according to treatment with IFITM3 shRNA: P is 786-O/P cell line; R is 786-O/suR cell line; R + empty refers to the 786-O/suR cell line with the empty vector inserted; R + IFITM3 shRNA is a 786-O/suR cell line in which a vector containing IFITM3 shRNA4 was inserted.
  • Figure 9 is an image showing cell migration of kidney cancer cells according to treatment with IFITM3 shRNA: P is 786-O/P cell line; R is 786-O/suR cell line; R + empty refers to the 786-O/suR cell line with the empty vector inserted; R + IFITM3 shRNA is a 786-O/suR cell line in which a vector containing IFITM3 shRNA4 was inserted.
  • the cell viability of 786-O/suR, a TKI-resistant cell line increased to 181% despite treatment with sunitinib, but the expression of IFITM3 was suppressed by introducing IFITM3 shRNA.
  • the survival rate decreased by 29% upon treatment with sunitinib, confirming that the survival rate was similar to that of TKI-sensitive cell lines.
  • tumor cell invasion actively progressed in 786-O/suR, a TKI-resistant cell line, despite treatment with sunitinib, but the expression of IFITM3 was suppressed by injecting IFITM3 shRNA.
  • the cell invasion ability was significantly reduced by treatment with sunitinib, and it was confirmed that the cell invasion ability was similar to that of the TKI-sensitive cell line.
  • 786-O/suR a TKI-resistant cell line, actively migrated tumor cells despite treatment with sunitinib.
  • 786-O/suR suppressed the expression of IFITM3 by introducing IFITM3 shRNA.
  • the migration ability of tumor cells was significantly reduced upon treatment with sunitinib, and it was confirmed that cell migration was similar to that of TKI-sensitive cell lines.
  • mTOR inhibitor can inhibit the expression of IFITM3, and therefore, the TKI-resistant cell line (786-O) established in Example 1 was treated with mTOR inhibitor to inhibit the expression of IFITM3 gene.
  • Figure 10 is a graph showing the change in survival rate of kidney cancer cells according to treatment with Doctorisib: P is 786-O/P cell line; R is 786-O/suR cell line; R + DMSO for 786-O/suR cell line treated with dimethyl sulfoxide; R + DMSO for 786-O/suR cell line treated with dimethyl sulfoxide; R + TCN is the 786-O/suR cell line treated with Doctoriship.
  • the cell viability of 786-O/suR, a TKI-resistant cell line increased to 227% despite treatment with sunitinib, but 786-O/suR, which suppressed the expression of IFITM3 by treatment with dactorisib,
  • the survival rate decreased by about half (52%) upon treatment with sunitinib, confirming that it showed a survival rate similar to that of the TKI-sensitive cell line.
  • TRAF6/MAPK signaling pathway activity was confirmed as a TKI resistance mechanism in kidney cancer.
  • total protein was measured in 786-O/P cell line and 786-O/suR cell line cultured using RIPA lysis and extraction buffer (Thermo Fisher Scientific). was extracted and separated through a 12% SDS-PAGE polyacrylamide gel.
  • IFITM3 (ab109429, Abcam), TRAF6 (sc-8409, Santa Cruz Biotechnology), p-ERK (MAPK, #4370, Cell Signaling Technology), c-FOS ((#2250, Cell Signaling Technology), c-Myc (395R16, Cell Marque), Survivin (#2808, Cell Signaling Technology), ß-actin (A5441; Sigma-Aldrich).
  • kidney cancer cells that increased IFITM3 gene expression with an IFITM3 mimicker and TKI-resistant cells that suppressed IFITM3 gene expression with shRNA (shRNA4) of the IFITM3 gene.
  • Kidney cancer cells were each xenografted. At this time, 786-O cells were used as kidney cancer cells.
  • mice transplanted with the 786-O/P cell line were reduced to 50 mm 3 and maintained upon treatment with sunitinib.
  • the size of the tumor decreased to a certain level with treatment with sunitinib, but the size of the tumor increased again and treatment with sunitinib was performed on the 46th day. It was confirmed that the size of the tumor increased by approximately 1.5 times compared to immediately after treatment.
  • mice transplanted with the 786-O/suR cell line the size of the tumor increased with time despite treatment with sunitinib.
  • the size of the tumor gradually decreased over time, and after treatment with sunitinib, the size of the tumor decreased to 50 mm 3, and the size of the tumor decreased to 50 mm 3 with time. It was confirmed that the size remained constant even after this period, showing similar results to mice transplanted with the 786-O/P cell line.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Mycology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Polymers & Plastics (AREA)
  • Biophysics (AREA)
  • Nutrition Science (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

IFITM3 억제제를 포함하는 신장암 예방 또는 치료용 약학적 조성물에 관한 것으로, 일 양상에 따른 조성물에 의하면. IFITM3의 발현 또는 활성을 억제시켜 종양 생성 억제 효과를 유도할 수 있다. 특히, 치료 저항성 암 세포주에서 IFITM3의 발현 또는 활성 억제를 통해, 종양 생성, 종양세포 침윤, 및 종양세포 생존을 억제할 수 있어, 치료 저항성을 효과적으로 개선할 수 있는 효과가 있다. 이에 따라, 치료저항성 암의 예방 또는 치료에 사용할 수 있는 효과가 있다.

Description

IFITM3 억제제를 포함하는 신장암 예방 또는 치료용 약학적 조성물
IFITM3 억제제를 포함하는 신장암 예방 또는 치료용 약학적 조성물에 관한 것이다.
진행성 및 전이성 투명 세포 신세포 암종(clear cell renal cell carcinoma: ccRCC)의 치료에는 티로신 키나제 억제제(Tyrosine Kinase inhibitor: TKI)가 통상적으로 사용되고 있다. 그러나 TKI 단독 요법을 이용한 치료의 경우, 거의 모든 환자가 TKI에 대한 후천적인 내성을 지니게 되는 문제가 있다.
최근에는 신세포 암종의 치료를 위해, 면역관문억제제(Immune checkpoint inhibitor) 및 TKI를 조합하여 사용하는 치료방법이 사용되고 있으나, 면역관문억제제의 경우 잠재적인 독성의 위험 등 때문에, 이를 활용한 치료에 대한 접근이 제한되는 문제가 있다. 따라서, 면역관문억제제를 통한 치료가 불가능 한 환자들의 경우, 여전히 수니티닙과 같은 TKI를 이용한 치료가 사용되고 있다.
따라서, TKI를 통한 치료에 있어서, TKI 저항성을 효과적으로 완화 및 개선시킬 수 있는 치료제의 개발이 필요한 실정이다.
일 양상은 IFITM3(interferon induced transmembrane protein 3) 유전자 또는 이의 단백질의 발현 또는 활성을 억제하는 억제제를 포함하는 신장암 예방 또는 치료용 약학적 조성물 제공하는 것이다.
다른 양상은 신장암 세포를 시험 물질과 접촉시키는 단계; 및 상기 접촉된 신장암 세포의 IFITM3 유전자 또는 이의 단백질의 발현 또는 활성 수준을 측정하는 단계를 포함하는 티로신 키나제 억제제(Tyrosine Kinase inhibitor: TKI) 저항성 신장암 예방 또는 치료용 후보물질을 스크리닝하는 방법을 제공하는 것이다.
또 다른 양상은 IFITM3 유전자 또는 이의 단백질의 발현 또는 활성을 억제하는 억제제를 포함하는 신장암 예방 또는 개선용 건강기능식품을 제공하는 것이다.
일 양상은 IFITM3(interferon induced transmembrane protein 3) 유전자 또는 이의 단백질의 발현 또는 활성을 억제하는 억제제를 포함하는 신장암 예방 또는 치료용 약학적 조성물 제공한다.
본 명세서에서 용어, "IFITM3(interferon induced transmembrane protein 3)"는 IFITM3 유전자에 의해 암호화되는 단백질을 의미할 수 있다.
상기 IFITM3 유전자는 당업계에 알려진 어떠한 서열로 구성되는 폴리뉴클레오티드를 모두 포함할 수 있고, 그 활성을 저하시키지 않는 하나 또는 그 이상의 치환, 삽입, 결실 및 그 조합을 갖는 변이체를 포함할 수 있다. 이러한 변이체는 IFITM3 유전자 서열과 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 또는 그 이상의 상동성을 가질 수 있다.
또한, 상기 IFITM3 단백질은 당업계에 알려진 어떠한 서열로 구성되는 폴리펩티드를 포함할 수 있고, 단백질의 기능에 영향을 미치지 않는 범위 내에서, 아미노산 잔기의 결실, 삽입, 치환 또는 이들의 조합에 의해서 상이한 서열을 가지는 아미노산의 변이체 또는 단편일 수 있다. 경우에 따라서는 상기 IFITM3 단백질은 인산화(phosphorylation), 황화(sulfation), 아크릴화(acrylation), 당화(glycosylation), 메틸화(methylation) 또는 파네실화(farnesylation) 등으로 수식(modification)될 수 있다. 이러한 변이체는 IFITM3 단백질 서열과 80％, 90％, 95％, 또는 그 이상의 상동성을 가질 수 있다.
상기 IFITM3의 발현 또는 활성을 억제하는 억제제는 IFITM3를 암호화하는 유전자의 발현 수준 또는 IFITM3 단백질의 발현 수준을 감소시키거나 IFITM3 단백질의 활성을 억제하는 것일 수 있다.
상기 IFITM3 유전자의 발현 억제제는 IFITM3 단백질을 암호화하는 유전자의 mRNA를 억제하는 것이면 당업계에 알려진 어떠한 물질도 포함할 수 있고, 화학적으로 합성하거나, 인 비트로 전사를 이용하여 합성하는 등 다양한 방법으로 제조될 수 있다.
일 구체예에 따르면, 상기 억제제는 안티센스 뉴클레오티드(antisense nucleotide), 작은 간섭 RNA(short interfering RNA, siRNA), 짧은 헤어핀 RNA(short hairpin RNA, shRNA), 마이크로 RNA(miRNA), 리보자임(ribozyme), 핵산(nucleic acid), 펩티드(peptide), 펩티드 미메틱스(mimetics), 앱타머(aptamer), 항체(antibody), 저분자 화합물(small molecule compound) 및 항체-약물 결합체(antibody drug conjuate)로 이루어진 군으로부터 선택되는 하나 이상일 수 있다.
상기 안티센스 뉴클레오티드는 왓슨-클릭 염기쌍에 정의된 바에 따라, DNA, 미성숙-mRNA 또는 성숙된 mRNA의 상보적 염기서열에 결합(혼성화)하여 DNA에서 단백질로서 유전정보의 흐름을 방해하는 것을 의미할 수 있다. 또한, 상기 안티센스 뉴클레오티드는 모노머 단위의 긴 사슬이기 때문에 표적 RNA 서열에 대해 쉽게 합성될 수 있다.
상기 siRNA는 특정 mRNA의 절단을 통하여 RNA의 간섭을 유도할 수 있는 짧은 이중가닥 RNA를 의미할 수 있다. 또한, 상기 siRNA는 RNA끼리 짝을 이루는 이중가닥 RNA 부분이 완전히 쌍을 이루는 것에 한정되지 않고, 미스매치(대응하는 염기가 상보적이지 않음), 벌지(일방의 사슬에 대응하는 염기가 없음) 등에 의하여 쌍을 이루지 않는 부분도 포함할 수 있다. siRNA 말단 구조는 표적 유전자의 발현을 RNA 간섭 효과에 의하여 억제할 수 있는 것이면 평활 말단 또는 돌출 말단 모두 가능하며, 점착 말단 구조는 3' 말단 돌출 구조와 5' 말단 돌출 구조 모두 가능하다.
상기 shRNA는 견고한 헤어핀 턴을 만드는 RNA의 서열을 의미할 수 있으며, 이는 RNA 간섭을 통해 유전자 발현을 침묵 (silence)시키는 데 이용될 수 있다. 또한, 상기 shRNA는 세포 도입용 벡터를 이용하여 세포로 전달될 수 있으며, 이러한 벡터는 항상 딸세포로 전달되어 유전자 침묵이 유전될 수 있다. shRNA 헤어핀 구조는 세포 내 기작에 의해 siRNA로 분해되어 RNA-유도 침묵 복합체(RNA-induced silencing complex)에 결합되고, 상기 복합체가 siRNA에 상응하는 mRNA에 결합하여 이를 분해시킬 수 있다.
일 구체예에 따르면, 상기 shRNA를 암호화하는 염기서열은 서열번호 1, 서열번호 2, 또는 서열번호 3로 표시되는 염기서열을 포함할 수 있다.
상기 리보자임은 특이적 RNA 절단을 촉매할 수 있는 효소 RNA 분자를 의미할 수 있다. 리보자임의 분자 서열과 상보적인 표적 RNA의 특이적 혼성화에 의해 핵산내부용해성 절단이 유도될 수 있고, 리보자임은 표적 RNA에 상보적인 하나 이상의 서열 또는 기능적 등가 서열의 절단을 담당하는 공지된 서열을 포함할 수 있다. 또한, 상기 리보자임은 햄머-헤드(hammer-head) 리보자임 또는 리보핵산내부분 해효소(endoribonuclease) RNA인 체크형(Cech type)리보자임일 수 있고, 변경된 올리고뉴클레오티드에 의해 형성되어 안전성, 표적화 등이 개선될 수 있다. 한편, 상기 리보자임은 생체내에서 표적 유전자를 발현하는 세포에 분포될 수 있고, 형질감염된 세포가 내생성 표적 메신저를 파괴하고 번역을 억제하기에 충분한 양의 리보자임을 생성하도록 강한 항시성 중합효소 III 또는 중합효소 II 프로모터의 조절 하에서 리보자임을 코딩하는 DNA 구축물이 사용될 수 있다. 리보자임은 촉매활성을 갖기 때문에, 다른 안티센스 분자와 달리 세포내에서 낮은 농도로 유지되어야 할 수 있다.
상기 펩티드 및 펩티드 미메틱스는 IFITM3 단백질이 다른 단백질과 결합하는 것을 억제함으로써 IFITM3 단백질의 활성을 억제하는 것일 수 있다. 상기 펩티드 미메틱스는 펩티드 또는 비펩티드일 수 있고, psi 결합과 같은 비펩티드 결합에 의해 결합된 아미노산으로 구성될 수 있다. 비가수분해성 펩티드 미메틱스는 주요 잔기로서 β-턴 디펩티드 코어, 케토-메틸렌 슈도펩티드류, 아제핀, 벤조디아제핀, β-아미노알콜 또는 치환 감마락탐환을 사용하여 제조할 수 있다.
상기 앱타머(Aptamer)는 그 자체로 안정된 삼차구조를 가지면서 표적분자에 높은 친화성과 특이성으로 결합할 수 있는 특징을 가진 단일가닥 핵산(DNA, RNA 또는 변형핵산)을 의미할 수 있고, 분자 유기물, 펩타이드, 막 단백질등에 결합하여 그 기능을 차단할 수 있으므로 단일 항체를 대체하는 일종의 화학 항체로 볼 수 있다. 또한, 상기 앱타머는 SELEX(systematic evolution of ligands by exponential enrichment)라 불리는 올리고뉴클레오타이드(oligonucleotide) 라이브러리를 이용하여, 특정 화학 분자나 생물학적 분자에 높은 친화력과 선별력을 갖고 결합하는 올리고머를 분리함으로써 수득할 수 있다.
상기 항체는 단일클론항체, 다클론항체 또는 재조합항체일 수 있다. 특정 단백질에 대한 항체는 단백질의 서열이 공지되어 있다면 당업계에 잘 알려진 기술을 이용하여 용이하게 제조할 수 있다. 구체적으로, 하이브리도마 방법, 또는 파지 항체 라이브러리 기술을 이용하여 제조될 수 있다. 일반적으로, 단일클론항체를 분비하는 하이브리도마 세포는 항원 단백질을 주사한 마우스와 같이 면역학적으로 적합한 숙주 동물로부터 분리된 면역 세포와 암 세포주를 융합하여 만들 수 있다. 이런 두 집단의 세포 융합은 폴리에틸렌글리콜 등을 이용하여 융합시키고 항체 생산 세포를 표준적인 배양 방법에 의해 증식시킬 수 있다. 한계 희석법을 이용하여 서브 클로닝을 실시하고, 균일한 세포 집단을 수득한 뒤 항원에 특이적인 항체를 생산할 수 있는 하이브리도마 세포를 시험관 또는 생체 내에서 대량으로 배양하여 제조할 수 있다. 상기 방법으로 제조된 항체는 겔 전기영동, 투석, 염 침전, 이온교환 크로마토그래피, 친화성 크로마토그래피 등의 방법을 이용하여 분리 및 정제될 수 있다.
상기 다클론항체는 면역원인 바이오마커 단백질 또는 그 단편을 외부 숙주에 주사함으로써 제조될 수 있다. 외부 숙주는 마우스, 래트, 양, 토끼와 같은 포유동물일 수 있다. 상기 면역원이 근내, 복강내 또는 피하 주사 방법으로 주사되는 경우, 항원성을 증가시키기 위한 보조제(adjuvant)와 함께 투여될 수 있다. 이후, 외부 숙주로부터 정기적으로 혈액을 채취하여 향상된 역가 및 항원에 대한 특이성을 보이는 혈청을 수득하고 이로부터 항체를 분리 및 정제하여 제조될 수 있다.
상기 저분자 화합물은 IFITM3 유전자 또는 이의 단백질의 발현 또는 활성을 억제할 수 있으면 제한되지 않는다. 보다 구체적으로 상기 저분자 화합물은 mTOR 억제제(inhibitor)일 수 있다.
일 구체예에 따르면, 상기 mTOR 억제제는 닥토리십(dactolisib), 라파마이신(rapamycin), 또는 에베로리무스(everolimus)를 포함할 수 있으나, 이에 제한되지 않는다.
상기 항체-약물 결합체(antibody drug conjuate)는 항체와 약물의 생물학적 활성을 저하시키지 않으면서 약물과 항체를 화학적으로 연결한 형태를 지칭한다. 상기 항체-약물 결합체는 항체의 특이성을 이용하여 종양 세포를 표적으로 식별하고, 종양 세포 내로 독성 약물을 전달하여 종양을 골라내거나 파괴하는 데 사용되는 의약품을 의미할 수 있다. 구체적으로, 상기 항체-약물 결합체는 약물과 연결된 항체 또는 그의 단편으로 구성되는 질환의 표적치료에 사용될 수 있는 면역결합체(immunoconjugate) 형태의 치료제를 의미할 수 있다. 상기 항체는 ADC가 표적세포에 결합할 수 있게 하고, 때로는 상기 항체를 통하여 표적세포의 내부로 유입되어 상기 ADC에 포함된 약물이 상기 유입된 세포로부터 분비되도록 할 수 있다. 상기 ADC는 종래의 치료제에 비하여 항체를 이용하여 목적하는 세포에 대한 적중율이 우수하기 때문에 부작용이 낮고, 적용범위가 광범위하다.
상기 신장암은 약물 저항성 신장암일 수 있다.
본 명세서에서 용어 "약물 저항성(drug resistance)"은 약물 내성과 동일한 의미로 사용될 수 있으며, "약물 저항성"은 특정한 약물에 대하여 저항성, 즉 내성을 갖고 있거나, 또는 장기적으로 특정 약물을 투여할 때, 세포가 약물 내성을 획득하여 치료 효과를 제대로 볼 수 없게 되는 경우에 발생되는 것을 의미할 수 있다. 상기 약물은 항암제일 수 있다.
일 구체예에 따르면, 상기 약물은 티로신 키나제 억제제(tyrosine kinase inhibitor: TKI)일 수 있다.
상기 티로신 키나제 억제제는 수니티닙(sunitinib), 소라페니브(sorafenib), 파조파닙(pazopanib), 카보잔티닙(cabozantinib), 엑시티닙(axitinib), 및 티보자닙(tivozanib)으로 이루어진 군으로부터 선택되는 어느 하나 이상일 수 있다.
본 명세서에서 용어, "예방"은 상기 조성물의 투여로 암을 억제시키거나 발병을 지연시키는 모든 행위를 의미할 수 있다.
본 명세서에서 용어 "치료"는 상기 조성물의 투여로 암의 성장 또는 진행을 지연 또는 중지시키는 등 암을 호전시키거는 행위를 의미할 수 있다.
본 명세서에서 용어, "약학적 조성물"은, 대상체로의 투여 시에 몇몇 유리한 효과를 부여하는 분자 또는 화합물을 지칭할 수 있다. 유리한 효과는 진단적 결정을 가능하게 하는 것; 질병, 증상, 장애 또는 병태의 개선; 질병, 증상, 장애 또는 질환의 발병의 감소 또는 예방; 및 일반적으로 질병, 증상, 장애 또는 병태의 대응을 포함할 수 있다.
상기 약학적 조성물은 조성물 총 중량에 대하여 IFITM3 유전자 또는 이의 단백질의 발현 또는 활성을 억제하는 억제제를 0.0001 내지 70 중량%로 포함할 수 있으나, 이에 제한되는 것은 아니다.
상기 약학적 조성물은 투여를 위해서 상기 기재한 유효성분 외에 추가로 약학적으로 허용 가능한 담체, 부형제 및 희석제를 더 포함할 수 있다.
예를 들어, 담체, 부형제 및 희석제로는 락토오스, 텍스트로오스, 수크로오스, 소르비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로오스, 메틸셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트, 광물유 등을 사용할 수 있으며, 표적 기관에 특이적으로 작용할 수 있도록 표적 기관 특이적 항체 또는 기타 리간드를 상기 담체와 결합시켜 사용할 수 있다.
상기 약학적 조성물은 공지의 방법에 따라 다양한 비경구 또는 경구 투여용 형태로 제조될 수 있다. 비경구 투여용 제형의 대표적인 것으로는 에어로졸 제형, 주사용 제형이 있을 수 있다.
경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 유효 성분에 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘 카보네이트, 수크로오스 또는 락토오스, 젤라틴 등을 혼합하여 조제된다. 또한, 단순한 부형제 이외에도 마그네슘 스테아레이트, 탈크와 같은 윤활제들도 사용될 수 있다.
경구투여를 위한 액상제제에는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데, 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러가지 부형제, 예를 들면, 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브오일과 같은 식물성 오일, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔, 마크로골, 트윈 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다. 그러나, 이에 제한되는 것은 아니며, 상기 약학적 조성물은 당해 기술분야의 공지된 방법이라면 제한 없이 사용하여 목적에 맞게 제제화할 수 있다.
상기 약학적 조성물의 약학적 유효량, 유효 투여량은 약학적 조성물의 제제화 방법, 투여 방식, 투여시간 및/또는 투여 경로 등에 의해 다양할 수 있다. 또한, 상기 약학 조성물의 투여로 달성하고자 하는 반응의 종류와 정도, 투여 대상이 되는 개체의 종류, 연령, 체중, 일반적인 건강 상태, 질병의 증세나 정도, 성별, 식이, 배설, 해당 개체에 동시 또는 이시에 함께 사용되는 약물 기타 조성물의 성분 등을 비롯한 여러 인자 및 의약 분야에서 잘 알려진 유사 인자에 따라 다양해질 수 있다. 당해 기술 분야에서 통상의 지식을 가진 자는 목적하는 치료에 효과적인 투여량을 용이하게 결정하고 처방할 수 있다. 상기 약학 조성물의 투여는 하루에 1회 투여될 수 있고, 수회에 나누어 투여될 수 있다. 상기 약학적 조성물의 투여량은 1일 1 ug/kg/일 내지 1,OOO mg/kg/일일 수 있다.
상기 개체는 포유동물, 예를 들면, 사람, 소, 말, 돼지, 개, 양, 염소, 또는 고양이일 수 있다. 상기 개체는 신장암, 또는 IFITM3의 발현이 증가된 악성 또는 양성 종양의 치유를 필요로 하는 개체일 수 있다. 상기 IFITM3의 발현이 증가된 악성 또는 양성 종양은 신장암 관련 종양일 수 있으나, 이에 제한되지 않는다.
본 명세서에서 용어 "투여"는 어떠한 적절한 방법으로 개체에게 일 양상에 따른 약학적 조성물을 도입하는 것을 의미할 수 있으며, 투여는 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 수행될 수 있다.
다른 양상은 신장암 세포를 시험 물질과 접촉시키는 단계; 및 상기 접촉된 신장암 세포의 IFITM3 유전자 또는 이의 단백질의 발현 또는 활성 수준을 측정하는 단계를 포함하는 티로신 키나제 억제제 저항성 신장암 예방 또는 치료용 후보물질을 스크리닝하는 방법을 제공한다.
일 구체예에 따르면, 상기 신장암 세포는 티로신 키나제 억제제 저항성 신장암 세포일 수 있다.
상기 스크리닝하는 방법은 시험 물질과 접촉된 신장암 세포의 IFITM3 유전자 또는 이의 단백질의 발현 또는 활성 수준이 시험 물질을 접촉하지 않은 대조군에 비해 감소하는 경우, 상기 시험 물질을 티로신 키나제 억제제 저항성 신장암 예방 또는 치료용 물질로 판단하는 단계를 포함할 수 있다.
상기 단계 IFITM3 유전자 또는 이의 단백질의 발현 또는 활성 수준을 측정하는 단계는 역전사 중합효소 연쇄반응(Reverse Transcription Polymerase Chain Reaction: RTPCR), 실시간 중합효소 연쇄반응(eal-time polymerase chain reaction: real-time PCR), 웨스턴 블롯(western blot), 노던 블롯(northern blot), ELISA(enzyme linked immunosorbent assay), 방사선면역분석(radioimmunoassay), 방사 면역 확산법(radioimmunodiffusion), 면역침강법(immunoprecipitation), 면역조직화학적 분석(immunohistochemical analysis) 및 유세포 분석법(Fluorescence-activated cell sorting: FACS)으로 이루어진 군으로부터 선택되는 어느 하나 이상의 방법으로 수행될 수 있으나, 이에 제한되지 않는다.
또 다른 양상은 IFITM3 유전자 또는 이의 단백질의 발현 또는 활성을 억제하는 억제제를 포함하는 신장암 예방 또는 개선용 건강기능식품을 제공하는 것이다.
상기 건강기능식품은 일상 식사에서 결핍되기 쉬운 영양소나 인체에 유용한 기능을 가진 원료나 성분 (이하, '기능성 원료')을 사용하여 제조한 식품으로, 건강을 유지하거나 소정의 질병 또는 증상을 예방 및/또는 개선하는데 도움을 주는 모든 식품을 의미할 수 있으며, 최종 제품 형태에는 특별한 제한이 없다. 예를 들면, 상기 건강기능식품은 산제, 과립제, 정제, 캡슐제, 환제, 겔, 젤리, 현탁액, 에멀젼, 시럽제, 티백제, 침출차, 또는 건강 음료로 이루어진 군으로부터 선택되는 제형을 갖는 것일 수 있다.
상기 건강기능식품에 함유된 유효성분, 예를 들면, IFITM3 유전자의 발현 억제제 또는 IFITM3 단백질의 활성 억제제의 함량은 식품의 형태, 소망하는 용도 등에 따라 적절하게 특별한 제한이 없으며, 예컨대, 전체 식품 중량의 0.0001 내지 99 중량%, 0.0001 내지 95 중량%, 0.0001 내지 90 중량%, 0.0001 내지 80 중량%, 0.0001 내지 50 중량%, 0.001 내지 99 중량%, 0.001 내지 95 중량%, 0.001 내지 90 중량%, 0.001 내지 80 중량%, 0.001 내지 50 중량%, 0.01 내지 99 중량%, 0.01 내지 95 중량%, 0.01 내지 90 중량%, 0.01 내지 80 중량%, 0.01 내지 50 중량%, 0.1 내지 99 중량%, 0.1 내지 95 중량%, 0.1 내지 90 중량%, 0.1 내지 80 중량%, 0.1 내지 50 중량%, 0.1 내지 30 중량%, 0.1 내지 10 중량%, 1 내지 99 중량%, 1 내지 95 중량%, 1 내지 90 중량%, 1 내지 80 중량%, 1 내지 50 중량%, 1 내지 30 중량%, 1 내지 10 중량%, 10 내지 99 중량%, 10 내지 95 중량%, 10 내지 90 중량%, 10 내지 80 중량%, 10 내지 50 중량%, 10 내지 30 중량%, 25 내지 99 중량%, 25 내지 95 중량%, 25 내지 90 중량%, 25 내지 80 중량%, 25 내지 50 중량%, 25 내지 30 중량%, 40 내지 99 중량%, 40 내지 95 중량%, 40 내지 90 중량%, 40 내지 80 중량%, 40 내지 50 중량%, 50 내지 99 중량%, 50 내지 95 중량%, 50 내지 90 중량%, 50 내지 80 중량%, 60 내지 99 중량%, 60 내지 95 중량%, 60 내지 90 중량%, 또는 60 내지 80 중량%일 수 있으나, 이에 제한되는 것은 아니다.
상기 건강기능식품은 여러 가지 영양제, 비타민, 광물 (전해질), 합성 풍미제 또는 천연 풍미제 등의 풍미제, 착색제, 중진제 (치즈, 초콜릿등), 펙트산 또는 그의 염, 알긴산 또는 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등으로 이루어진 군에서 선택된 1종 이상을 추가로 함유할 수 있다. 이러한 첨가제의 비율은 전체 건강 기능성 식품 100 중량부 당 0.001 내지 약 20 중량부의 범위에서 선택될 수 있으나, 이에 제한되는 것은 아니다.
또 다른 양상은 IFITM3(interferon induced transmembrane protein 3) 유전자 또는 이의 단백질의 발현 또는 활성을 억제하는 억제제를 이를 필요로 하는 개체에 투여하는 단계를 포함하는 신장암의 예방 또는 치료 방법을 제공하는 것이다.
또 다른 양상은 신장암의 예방 또는 치료용 의약의 제조에 사용하기 위한 IFITM3(interferon induced transmembrane protein 3) 유전자 또는 이의 단백질의 발현 또는 활성을 억제하는 억제제의 용도를 제공하는 것이다.
또 다른 양상은 IFITM3(interferon induced transmembrane protein 3) 유전자 또는 이의 단백질의 발현 또는 활성을 억제하는 억제제의 신장암의 예방 또는 치료 용도를 제공한다.
상기 발명에 대해 기술한 용어 및 방법 등은 각 발명들 간에 동일하게 적용된다.
일 양상에 따른 조성물에 의하면. IFITM3의 발현 또는 활성을 억제시켜 종양 생성 억제 효과를 유도할 수 있다. 특히, 치료 저항성 암 세포주에서 IFITM3의 발현 또는 활성 억제를 통해, 종양 생성, 종양세포 침윤, 및 종양세포 생존을 억제할 수 있어, 치료 저항성을 효과적으로 개선할 수 있는 효과가 있다. 이에 따라, 치료저항성 암의 예방 또는 치료에 사용할 수 있는 효과가 있다.
도 1은 786-O/P 세포주 및 786-O/suR 세포주에서 IFITM3의 발현 정도를 측정한 그래프 및 이미지이다: P는 TKI 민감성 세포주이고, R은 TKI 저항성 세포주이다.
도 2는 IFITM3 mimicker 처리에 따른 신장암 세포의 생존율 변화를 나타낸 그래프이다: R은 786-O/suR 세포주; P는 786-O/P 세포주; P + empty는 empty 벡터를 삽입한 786-O/P 세포주; P + IFITM3는 IFITM3 mimicker가 삽입된 벡터를 삽입한 786-O/P 세포주.
도 3은 IFITM3 mimicker 처리에 따른 신장암 세포의 종양생성능력을 비교한 이미지이다: R은 786-O/suR 세포주; P는 786-O/P 세포주; P + empty는 empty 벡터를 삽입한 786-O/P 세포주; P + IFITM3는 IFITM3 mimicker가 삽입된 벡터를 삽입한 786-O/P 세포주.
도 4는 IFITM3 mimicker 처리에 따른 신장암 세포의 세포침윤성을 나타낸 이미지이다: R은 786-O/suR 세포주; P는 786-O/P 세포주; P + empty는 empty 벡터를 삽입한 786-O/P 세포주; P + IFITM3는 IFITM3 mimicker가 삽입된 벡터를 삽입한 786-O/P 세포주.
도 5는 IFITM3 mimicker 처리에 따른 신장암 세포의 세포이동능력을 나타낸 이미지이다: R은 786-O/suR 세포주; P는 786-O/P 세포주; P + empty는 empty 벡터를 삽입한 786-O/P 세포주; P + IFITM3는 IFITM3 mimicker가 삽입된 벡터를 삽입한 786-O/P 세포주.
도 6은 IFITM3 shRNA의 처리에 따른 신장암 세포의 생존율 변화를 나타낸 그래프이다: P는 786-O/P 세포주; R은 786-O/suR 세포주; R + empty는 empty 벡터를 삽입한 786-O/suR 세포주; R + shRNA IFITM3 sh4는 IFITM3에 대한 shRNA4가 삽입된 벡터를 삽입한 786-O/suR 세포주; R + shRNA IFITM3 sh5는 IFITM3에 대한 shRNA5가 삽입된 벡터를 삽입한 786-O/suR 세포주; R + shRNA IFITM3 sh6은 IFITM3에 대한 shRNA6이 삽입된 벡터를 삽입한 786-O/suR 세포주.
도 7은 IFITM3 shRNA의 처리에 따른 신장암 세포의 종양생성능력을 비교한 이미지이다: P는 786-O/P 세포주; R은 786-O/suR 세포주; R + empty는 empty 벡터를 삽입한 786-O/suR 세포주; R + IFITM3 shRNA는 IFITM3 shRNA4가 삽입된 벡터를 삽입한 786-O/suR 세포주.
도 8은 IFITM3 shRNA의 처리에 따른 신장암 세포의 세포침윤성을 나타낸 이미지이다: P는 786-O/P 세포주; R은 786-O/suR 세포주; R + empty는 empty 벡터를 삽입한 786-O/suR 세포주; R + IFITM3 shRNA는 IFITM3 shRNA4가 삽입된 벡터를 삽입한 786-O/suR 세포주.
도 9는 IFITM3 shRNA의 처리에 따른 신장암 세포의 세포이동능력을 나타낸 이미지이다: P는 786-O/P 세포주; R은 786-O/suR 세포주; R + empty는 empty 벡터를 삽입한 786-O/suR 세포주; R + IFITM3 shRNA는 IFITM3 shRNA4가 삽입된 벡터를 삽입한 786-O/suR 세포주.
도 10은 닥토리십의 처리에 따른 신장암 세포의 생존율 변화를 나타낸 그래프이다: P는 786-O/P 세포주; R은 786-O/suR 세포주; R + DMSO는 다이메틸설폭사이드(dimethyl sulfoxide)를 처리한 786-O/suR 세포주; R + DMSO는 다이메틸설폭사이드를 처리한 786-O/suR 세포주; R + TCN은 닥토리십을 처리한 786-O/suR 세포주.
도 11은 786-O/P 세포주 및 786-O/suR 세포주에서 IFITM3, TRAF6, MAPK (p-ERK), c-FOS, c-Myc, Survivin의 단백발현 정도를 측정한 이미지이다.
도 12는 IFITM3의 mimicker로 IFITM3 유전자 발현을 증가시킨 TKI-민감성 신장암세포, 또는 IFITM3 유전자의 shRNA로 IFITM3 유전자 발현을 억제시킨 TKI-저항성 신장암세포를 이식한 마우스에서 종양의 크기 변화를 시간의 흐름에 따라 관측한 그래프이다: P + NCT는 음성 대조군(negative control group)인 786-O/P 세포주; P + IFITM3는 IFITM3 mimicker가 삽입된 벡터를 삽입한 786-O/P 세포주; R + NCT는 음성 대조군(negative control group)인 786-O/suR 세포주, R + IFITM3 shRNA는 IFITM3 shRNA4가 삽입된 벡터를 삽입한 786-O/suR 세포주.
이하 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1. TKI-저항성 신장암 세포주 수립
신장암 세포주(786-O, ACHN, Caki-1, 769-p, 및 A-704) 배양액에 수니티닙을 첨가하여 6 개월 이상 배양하고, TKI-저항성 신장암 세포주를 수립하였다.
보다 구체적으로, 수니티닙 저항성 신세포암종 세포주(Sunitinib-resistant renal cell carcinoma cell lines: suR)을 수립하기 위해, 인간 신세포암(renal cell carcinoma) 세포주인 769-P, 786-O, ACHN, Caki-1 및 A704(American Type Culture Collection)를 37 ℃ 및 5% CO2 조건에서 10% 소태아혈청(FBS, Gibco) 및 1% 페니실린/스트렙토마이신을 포함하는 배지(Gibco, Grand Island, NY)에서 배양하였다: A704 세포주는 EMEM 배지; 769-P, 786-O, ACHN 및 Caki-1 세포주는 RPMI-1640 배지.
그리고 ACHN 세포주에 대해서는 6 개월 동안 2.5 μM 농도의 수니티닙(Sutent, Pfizer Pharmaceutical, New York, NY)을 처리하고, 786-O, Caki-1, 769-p, 및 A-704세포주 각각에 대해서는 수니티닙의 농도를 5 내지 6개월 동안 IC10에서 최종 농도를 17 μM까지 단계적으로 증가시켜 처리하여 TKI-저항성 세포주를 수립하였다.
실시예 2. TKI-저항성 신장암 세포주에서 IFITM3 발현 변화 확인
상기 실시예 1에서 수립한 TKI-저항성 세포주의 수니티닙에 대한 세포 생존력을 TKI-저항성에 따른 IFITM3의 발현 변화를 확인하기 위해, 신장암 세포주(786-O/P) 및 이로부터 수립한 TKI-저항성 신장암 세포주(786-O/suR)에서 IFITM3의 발현 정도를 웨스턴 블랏을 통해 측정하고 그 결과를 도 1에 나타내었다.
보다 구체적으로, RIPA 용해 및 추출 완충액(Thermo Fisher Scientific)을 사용하여 배양된 786-O/P 세포주 및 786-O/suR 세포주에서 총 단백질을 추출하고 12% SDS-PAGE 폴리아크릴아미드 겔을 통해 분리하였다. 이 때, 타겟 단백질 단백질에 대한 항체로는 다음의 항체를 사용하였다: IFITM3 (ab109429, Abcam), ß-actin (A5441; Sigma-Aldrich).
도 1에 나타낸 바와 같이, 786-O/suR 세포주에서 IFITM3 단백질 발현량이 786-O/P 세포주 대비 현저히 증가된 것을 확인하였다.
실시예 3. 신장암 세포에서 IFITM3 발현 변화에 따른 결과 확인
3.1 IFITM3의 발현 증가가 TKI-저항성에 미치는 영향 확인
신장암 세포에서 IFITM3와 TKI-저항성 간의 관계를 확인하기 위해, TKI-민감성 신장암 세포주(786-O/P)에 IFITM3 mimicker(서열번호 4)를 처리하여, IFITM3 유전자의 발현을 증가시켰다.
- sequence 서열번호
IFITM3 mimicker TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGAATCACACTGTCCAAACCTTCTTCTCTCCTGTCAACAGTGGCCAGCCCCCCAACTATGAGATGCTCAAGGAGGAGCACGAGGTGGCTGTGCTGGGGGCGCCCCACAACCCTGCTCCCCCGACGTCCACCGTGATCCACATCCGCAGCGAGA
CCTCCGTGCCCGACCATGTCGTCTGGTCCCTGTTCAACACCCTCTTCATGAACCCCTGC
TGCCTGGGCTTCATAGCATTCGCCTACTCCGTGAAGTCTAGGGACAGGAAGATGGTTGG
CGACGTGACCGGGGCCCAGGCCTATGCCTCCACCGCCAAGTGCCTGAACATCTGGGCCC
TGATTCTGGGCATCCTCATGACCATTCTGCTCATCGTCATCCCAGTGCTGATCTTCCAGGCCTATGGAACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA		 서열번호 4
보다 구체적으로, IFITM3 ORF 구조로 클로닝 Myc-DDK-tagge벡터(Origene, RC201635, IFITM3 (NM_021034) Human Tagged ORF Clone)를 TKI-민감성 신장암 세포주(786-O)에 삽입하였다. 그 후 상기 786-0 세포주에 수니티닙을 처리하고, TKI-민감성 신장암 세포주의 세포 생존능력, 종양생성능력(colony-forming), 세포이동능력, 및 세포침윤성을 확인하였다.
세포 생존능력을 확인하기 위해서, 수니티닙이 처리된 상기 786-0 세포를 96-웰 플레이트에 접종하고, 1 mg/mL MTT를 각 웰에 첨가하였다. 그리고 4시간 동안 인큐베이션을 한 후, MTT를 제거하였다. 그 후, 디메틸 설폭사이드(Dimethyl sulfoxide: DMSO)를 각 웰에 첨가하고 540 nm에서 흡광도를 측정하여 세포 생존능력을 분석하였다. 그리고 그 결과를 도 2에 나타내었다.
도 2는 IFITM3 mimicker 처리에 따른 신장암 세포의 생존율 변화를 나타낸 그래프이다: R은 786-O/suR 세포주; P는 786-O/P 세포주; P + empty는 empty 벡터를 삽입한 786-O/P 세포주; P + IFITM3는 IFITM3 mimicker가 삽입된 벡터를 삽입한 786-O/P 세포주.
도 2에 나타낸 바와 같이, TKI 민감성 세포주인 786-O/P는 수니티닙의 처리에 따라 세포 생존능이 약 45%에 불과하였으나, IFITM3 mimicker를 투입하여 IFITM3의 발현이 증가된 786-O/P 세포주의 경우 수니티닙의 처리에도 불구하고 생존율이 101%를 유지하여 TKI 저항성 세포주와 유사한 생존율을 보임을 확인하였다.
종양생성능력을 분석하기 위해, 아가로스(agarose; A9539, Sigma-Aldrich, St. Louis, MO)를 사용하여 소프트 한천 콜로니 형성 어세이(soft agar colony formation assay)을 사용하였다. 구체적으로, 수니티닙이 처리된 상기 786-0 세포를 6-웰 플레이트에 3중으로 플레이팅(300개 세포/웰)하였다. 그리고 7 내지 14일 경과 후, 세포 콜로니를 CrystalViolet(C1035, Biosesang)으로 염색하고 계수하여 콜로니 형성 어세이를 수행하였다. 그리고 그 결과를 도 3에 나타내었다.
도 3은 IFITM3 mimicker 처리에 따른 신장암 세포의 종양생성능력을 비교한 이미지이다: R은 786-O/suR 세포주; P는 786-O/P 세포주; P + empty는 empty 벡터를 삽입한 786-O/P 세포주; P + IFITM3는 IFITM3 mimicker가 삽입된 벡터를 삽입한 786-O/P 세포주.
도 3에 나타낸 바와 같이, TKI 민감성 세포주인 786-O/P는 수니티닙의 처리에 따라 종양이 거의 관측되지 않았으나, IFITM3 mimicker를 투입하여 IFITM3의 발현이 증가된 786-O/P 세포주의 경우 수니티닙의 처리에도 불구하고 종양생성능력이 현저히 증가하여, TKI 저항성 세포주와 유사한 종양생성능력을 보임을 확인하였다.
세포침윤성을 확인하기 위해, 매트리겔(matrigel) 기저막 매트릭스(Corning Inc., Corning, NY)를 Falcon® Permeable Supports(Corning)의 트랜스웰에 코팅하고, 상기 트렌스웰에 수니티닙이 처리된 상기 786-0 세포(2.5 Х 105 세포)를 플레이팅하였다. 그리고 24 시간 동안 배양한 후, 웰의 윗면을 면봉으로 닦고 아랫 웰을 현미경 사진으로 촬영하여 매트리겔 이동 어세이(atrigel migration assay)를 수행하였다. 그리고 그 결과를 도 4에 나타내었다.
도 4는 IFITM3 mimicker 처리에 따른 신장암 세포의 세포침윤성을 나타낸 이미지이다: R은 786-O/suR 세포주; P는 786-O/P 세포주; P + empty는 empty 벡터를 삽입한 786-O/P 세포주; P + IFITM3는 IFITM3 mimicker가 삽입된 벡터를 삽입한 786-O/P 세포주.
도 4에 나타낸 바와 같이, TKI 민감성 세포주인 786-O/P는 수니티닙의 처리에 따라 세포 침윤이 거의 관측되지 않았으나, IFITM3 mimicker를 투입하여 IFITM3의 발현이 증가된 786-O/P 세포주의 경우 수니티닙의 처리에도 불구하고 세포침윤능력이 현저히 증가하여, TKI 저항성 세포주와 유사한 세포침윤능력을 보임을 확인하였다.
세포이동능력을 확인하기 위해, 스크래치 분석(scratch assay)을 수행하였다. 보다 구체적으로, 수니티닙이 처리된 상기 786-0 세포를 플레이팅하고, 10 μL 피펫 팁으로 선형 스크래치를 형성하였다. 그 후, 상기 786-0 세포를 세척하고 배양하고 이동 활성을 분석하였다. 그리고 그 결과를 도 5에 나타내었다.
도 5는 IFITM3 mimicker 처리에 따른 신장암 세포의 세포이동성을 나타낸 이미지이다: R은 786-O/suR 세포주; P는 786-O/P 세포주; P + empty는 empty 벡터를 삽입한 786-O/P 세포주; P + IFITM3는 IFITM3 mimicker가 삽입된 벡터를 삽입한 786-O/P 세포주.
도 5에 나타낸 바와 같이, TKI 민감성 세포주인 786-O/P는 수니티닙의 처리에 따라 세포이동성이 거의 관측되지 않았으나, IFITM3 mimicker를 투입하여 IFITM3의 발현이 증가된 786-O/P 세포주의 경우 수니티닙의 처리에도 불구하고 세포이동성이 현저히 증가하여 TKI 저항성 세포주와 유사한 세포이동성을 보임을 확인하였다.
3.2 IFITM3 발현 억제가 TKI-저항성에 미치는 영향 확인
3.2.1 shRNA를 통한 IFITM3 발현 억제
실시예 1에서 수립한 TKI-저항성 세포주(786-O)에 IFITM3 shRNA를 처리하여, IFITM3 유전자의 발현을 억제시켰다.
보다 구체적으로, IFITM3 shRNA4(서열번호 1), IFITM3 shRNA5(서열번호 2), 또는 IFITM3 shRNA6(서열번호 3)를 LKO.1-CMV-Neo 벡터(SHCLND, TRCN0000118024; Sigma-Aldrich, St. Louis, MO)에 클로닝하고, 상기 벡터를 786-O/수니티닙 저항성 세포주(786-O/sunitinib-resistant: 786-O/suR) 및 786-O/수니티닙 민감성 세포주(786-O/P)에 삽입하였다.
유전자 shRNA sequence
IFITM3 shRNA4 5`- CCTCATGACCATTCTGCTCAT -3` 서열번호 1
shRNA5 5`- GCTTCATAGCATTCGCCTACT -3` 서열번호 2
shRNA6 5`- CCTGAACATCTGGGCCCTGAT -3` 서열번호 3
그리고, 상기 786-0/suR 세포주 및 786-O/P 세포주 각각에 수니티닙을 처리하고, 세포생존능력, 종양생성능력, 세포이동능력, 및 세포침윤성을 확인하였다. 이 때, 세포생존능력, 종양생성능력, 세포이동능력, 및 세포침윤성을 측정하기 위한 실험은 상기 실시예 3.1에서와 동일하게 수행하였다. 그리고 그 결과를 도 6 내지 9에 나타내었다.
도 6은 IFITM3 shRNA의 처리에 따른 신장암 세포의 생존율 변화를 나타낸 그래프이다: P는 786-O/P 세포주; R은 786-O/suR 세포주; R + empty는 empty 벡터를 삽입한 786-O/suR 세포주; R + shRNA IFITM3 sh4는 IFITM3에 대한 shRNA4가 삽입된 벡터를 삽입한 786-O/suR 세포주; R + shRNA IFITM3 sh5는 IFITM3에 대한 shRNA5가 삽입된 벡터를 삽입한 786-O/suR 세포주; R + shRNA IFITM3 sh6은 IFITM3에 대한 shRNA6이 삽입된 벡터를 삽입한 786-O/suR 세포주.
도 7은 IFITM3 shRNA의 처리에 따른 신장암 세포의 종양생성능력을 비교한 이미지이다: P는 786-O/P 세포주; R은 786-O/suR 세포주; R + empty는 empty 벡터를 삽입한 786-O/suR 세포주; R + IFITM3 shRNA는 IFITM3 shRNA4가 삽입된 벡터를 삽입한 786-O/suR 세포주.
도 8은 IFITM3 shRNA의 처리에 따른 신장암 세포의 세포침윤능력을 나타낸 이미지이다: P는 786-O/P 세포주; R은 786-O/suR 세포주; R + empty는 empty 벡터를 삽입한 786-O/suR 세포주; R + IFITM3 shRNA는 IFITM3 shRNA4가 삽입된 벡터를 삽입한 786-O/suR 세포주.
도 9는 IFITM3 shRNA의 처리에 따른 신장암 세포의 세포이동성을 나타낸 이미지이다: P는 786-O/P 세포주; R은 786-O/suR 세포주; R + empty는 empty 벡터를 삽입한 786-O/suR 세포주; R + IFITM3 shRNA는 IFITM3 shRNA4가 삽입된 벡터를 삽입한 786-O/suR 세포주.
도 6에 나타낸 바와 같이, TKI 저항성 세포주인 786-O/suR는 수니티닙의 처리에도 불구하고 세포 생존능이 181%까지 증가하였으나, IFITM3 shRNA를 투입하여 IFITM3의 발현을 억제시킨 786-O/suR 세포주의 경우 수니티닙의 처리에 따라 생존율이 29% 감소하여, TKI 민감성 세포주와 유사한 생존율을 보임을 확인하였다.
도 7에 나타낸 바와 같이, TKI 저항성 세포주인 786-O/suR는 수니티닙의 처리 불구하고 종양생성이 활발하게 진행되었으나, IFITM3 shRNA를 투입하여 IFITM3의 발현을 억제시킨 786-O/suR 세포주의 경우 수니티닙의 처리에 따라 종양이 거의 생성되지 않아, TKI 민감성 세포주와 유사한 종양생성능력을 보임을 확인하였다.
도 8에 나타낸 바와 같이, TKI 저항성 세포주인 786-O/suR는 수니티닙의 처리 불구하고 종양세포침윤이 활발하게 진행되었으나, IFITM3 shRNA를 투입하여 IFITM3의 발현을 억제시킨 786-O/suR 세포주의 경우 수니티닙의 처리에 따라 세포침윤능력이 현저히 감소하여, TKI 민감성 세포주와 유사한 세포침윤능력을 보임을 확인하였다.
도 9에 나타낸 바와 같이, TKI 저항성 세포주인 786-O/suR는 수니티닙의 처리 불구하고 종양세포의 이동이 활발하게 진행되었으나, IFITM3 shRNA를 투입하여 IFITM3의 발현을 억제시킨 786-O/suR 세포주의 경우 수니티닙의 처리에 따라 종양세포의 이동 능력이 현저히 감소하여, TKI 민감성 세포주와 유사한 세포이동성을 보임을 확인하였다.
3.2.2 mTOR inhibitor를 통한 IFITM3 발현 억제
mTOR inhibitor는 IFITM3의 발현을 억제할 수 있으며, 이에 실시예 1에서 수립한 TKI-저항성 세포주(786-O)에 mTOR inhibitor를 처리하여, IFITM3 유전자의 발현을 억제시켰다.
보다 구체적으로, PI3K/mTOR inhibitor인 닥토리십(dactolisib; TCN; NVP-BEZ235) 및 수니티닙을 786-O/suR 세포주에 처리하고 세포생존능력을 확인하였다. 이 때, 세포생존능력을 측정하기 위한 실험은 상기 실시예 3.1에서와 동일하게 수행하였다. 그리고 그 결과를 도 10에 나타내었다.
도 10은 닥토리십의 처리에 따른 신장암 세포의 생존율 변화를 나타낸 그래프이다: P는 786-O/P 세포주; R은 786-O/suR 세포주; R + DMSO는 다이메틸설폭사이드(dimethyl sulfoxide)를 처리한 786-O/suR 세포주; R + DMSO는 다이메틸설폭사이드를 처리한 786-O/suR 세포주; R + TCN은 닥토리십을 처리한 786-O/suR 세포주.
도 10에 나타낸 바와 같이, TKI 저항성 세포주인 786-O/suR는 수니티닙의 처리에도 불구하고 세포 생존능이 227%까지 증가하였으나, 닥토리십을 처리하여 IFITM3의 발현을 억제시킨 786-O/suR 세포주의 경우 수니티닙의 처리에 따라 생존율이 약 절반(52%)으로 감소하여, TKI 민감성 세포주와 유사한 생존율을 보임을 확인하였다.
실시예 4. TKI 저항성 신장암 세포주에서 TRAF6/MAPK 경로와 IFITM3의 관계 확인
신장암에서 TKI 저항성 메커니즘으로 TRAF6/MAPK 신호전달체계 활성을 확인하기 위하여, RIPA 용해 및 추출 완충액(Thermo Fisher Scientific)을 사용하여 배양된 786-O/P 세포주 및 786-O/suR 세포주에서 총 단백질을 추출하고 12% SDS-PAGE 폴리아크릴아미드 겔을 통해 분리하였다. 이 때, 타겟 단백질 단백질에 대한 항체로는 다음의 항체를 사용하였다: IFITM3 (ab109429, Abcam), TRAF6 (sc-8409, Santa Cruz Biotechnology), p-ERK (MAPK, #4370, Cell Signaling Technology), c-FOS ((#2250, Cell Signaling Technology), c-Myc (395R16, Cell Marque), Survivin (#2808, Cell Signaling Technology), ß-actin (A5441; Sigma-Aldrich).
도 11에 나타낸 바와 같이, 786-O/suR 세포주에서 IFITM3과 TRAF-6 단백질의 발현이 증가함을 확인하였고, 또한 MAPK 신호전달체계 단백들인 MAPK (p-ERK), c-FOS, c-Myc, Survivin의 발현량이 786-O/P 세포주 대비 현저히 증가된 것을 확인하였다.
실시예 5. TKI-저항성 신장암 마우스 모델을 통한 IFITM3 억제를 통한 TKI-저항성 개선 효과 확인
수컷 NSG 마우스(6 주령, Orient, 대한민국)의 허벅지의 피하조직에 IFITM3의 mimicker로 IFITM3 유전자 발현을 증가시킨 TKI-민감성 신장암세포와 IFITM3 유전자의 shRNA(shRNA4)로 IFITM3 유전자 발현을 억제시킨 TKI-저항성 신장암세포를 각각 이종이식하였다. 이 때, 신장암 세포로는 786-O 세포를 사용하였다.
보다 구체적으로, TKI-민감성 신장암세포(1 Х 107 세포) 및 TKI-저항성 신장암세포(1 Х 107 세포) 각각을 100 μl의 매트리겔(Matrigel, Corning, NY 14831 USA) 및 100 μl의 PBS와 혼합하고, 상기 혼합물을 상기 NSG 마우스의 오른쪽 허벅지의 등쪽에 피하 접종하였다. 그 후, 수니티닙(20mg/kg)을 이식 후 31일째부터 3일마다 위관영양법으로 투여하면서, 종양의 크기를 이식 후 일주일에 두 번 캘리퍼스로 측정하고 그 결과를 도 12에 나타내었다. 46일 때 종양의 크기 측정한 후 마우스를 희생시켰다. 이 때, 이종이식 종양을 절개하여 10% 완충 포르말린에 고정 및 파라핀에 포매하고, 4 μm 두께로 절단하였다.
그 결과, 도 12에 나타낸 바와 같이, 786-O/P 세포주를 이식받은 마우스는 수니티닙의 처리에 따라 종양의 크기가 50 mm3 수준으로 감소하여 유지되는 것을 확인하였다. 반면, IFITM3-과발현 786-O/P 세포주를 이식받은 마우스에서는 수니티닙의 처리에 따라 종양의 크기가 일정 수준으로 감소하였으나, 다시 종양의 크기가 증가하여 46일째 되는 날에는 수니티닙을 처리한 직후 대비 약 1.5 배 이상 종양의 크기가 증가하는 것을 확인하였다.
또한 786-O/suR 세포주를 이식받은 마우스에서는 수니티닙의 처리에도 불구하고 종양의 크기가 시간이 증가함에 따라 증가함을 확인하였다. 반면, IFITM3 발현이 억제된 786-O/suR세포주를 이식받은 마우스에서는 시간이 지날수록 종양의 크기가 점차 감소하였으며, 수니티닙의 처리 후에는 종양의 크기가 50 mm3 수준으로 감소하였으며, 시간이 경과하여도 크기가 일정하게 유지되어, 786-O/P 세포주를 이식받은 마우스와 유사한 결과를 나타냄을 확인하였다.
상기와 같은 결과는, TKI 저항성 신장암 마우스, 특히, IFITM3의 발현이 증가한 TKI 저항성 신장암 마우스에서 IFITM3의 발현을 억제하는 경우 TKI에 대한 저항성을 효과적으로 감소시킬 수 있음을 의미한다.

Claims (14)

  1. IFITM3(interferon induced transmembrane protein 3) 유전자 또는 이의 단백질의 발현 또는 활성을 억제하는 억제제를 포함하는 신장암 예방 또는 치료용 약학적 조성물.
  2. 청구항 1에 있어서,
    상기 억제제는 안티센스 뉴클레오티드(antisense nucleotide), 작은 간섭 RNA(short interfering RNA, siRNA), 짧은 헤어핀 RNA(short hairpin RNA, shRNA), 마이크로 RNA(miRNA), 리보자임(ribozyme), 핵산(nucleic acid), 펩티드(peptide), 펩티드 미메틱스(mimetics), 앱타머(aptamer), 항체(antibody), 저분자 화합물(small molecule compound) 및 항체-약물 결합체(antibody drug conjuate)로 이루어진 군으로부터 선택되는 하나 이상인 것인, 약학적 조성물.
  3. 청구항 1에 있어서,
    상기 신장암은 약물 저항성 신장암인 것인, 약학적 조성물.
  4. 청구항 3에 있어서,
    상기 약물은 티로신 키나제 억제제(tyrosine kinase inhibitor: TKI)인 것인, 약학적 조성물.
  5. 청구항 4에 있어서,
    상기 티로신 키나제 억제제는 수니티닙(sunitinib), 소라페니브(sorafenib), 파조파닙(pazopanib), 카보잔티닙(cabozantinib), 엑시티닙(axitinib), 및 티보자닙(tivozanib)으로 이루어진 군으로부터 선택되는 어느 하나 이상인 것인, 약학적 조성물.
  6. 청구항 1에 있어서,
    상기 조성물은 TRAF6(tumor necrosis factor receptor-associated factor 6)의 발현 또는 활성을 억제하는 것인, 약학적 조성물.
  7. 청구항 1에 있어서,
    상기 조성물은 MAPK(mitogen activated protein kinase) 신호 경로를 억제하는 것인, 약학적 조성물.
  8. 신장암 세포를 시험 물질과 접촉시키는 단계; 및
    상기 접촉된 신장암 세포의 IFITM3(interferon induced transmembrane protein 3) 유전자 또는 이의 단백질의 발현 또는 활성 수준을 측정하는 단계를 포함하는 티로신 키나제 억제제(Tyrosine Kinase inhibitor: TKI) 저항성 신장암 예방 또는 치료용 후보물질을 스크리닝하는 방법.
  9. 청구항 8에 있어서,
    상기 신장암 세포는 티로신 키나제 억제제 저항성 신장암 세포인 것인, 스크리닝하는 방법.
  10. 청구항 8에 있어서,
    상기 방법은 시험 물질과 접촉된 신장암 세포의 IFITM3 유전자 또는 이의 단백질의 발현 또는 활성 수준이 시험 물질을 접촉하지 않은 대조군에 비해 감소하는 경우, 상기 시험 물질을 티로신 키나제 억제제 저항성 신장암 예방 또는 치료용 물질로 판단하는 단계를 포함하는 것인, 스크리닝하는 방법.
  11. IFITM3(interferon induced transmembrane protein 3) 유전자 또는 이의 단백질의 발현 또는 활성을 억제하는 억제제를 포함하는 신장암 예방 또는 개선용 건강기능식품.
  12. IFITM3(interferon induced transmembrane protein 3) 유전자 또는 이의 단백질의 발현 또는 활성을 억제하는 억제제를 이를 필요로 하는 개체에 투여하는 단계를 포함하는 신장암의 예방 또는 치료 방법.
  13. 신장암의 예방 또는 치료용 의약의 제조에 사용하기 위한 IFITM3(interferon induced transmembrane protein 3) 유전자 또는 이의 단백질의 발현 또는 활성을 억제하는 억제제의 용도.
  14. IFITM3(interferon induced transmembrane protein 3) 유전자 또는 이의 단백질의 발현 또는 활성을 억제하는 억제제의 신장암의 예방 또는 치료 용도.
PCT/KR2023/015507 2022-10-31 2023-10-10 Ifitm3 억제제를 포함하는 신장암 예방 또는 치료용 약학적 조성물 WO2024096354A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020220142368A KR20240068809A (ko) 2022-10-31 Ifitm3 억제제를 포함하는 신장암 예방 또는 치료용 약학적 조성물
KR10-2022-0142368 2022-10-31

Publications (1)

Publication Number Publication Date
WO2024096354A1 true WO2024096354A1 (ko) 2024-05-10

Family

ID=90930881

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/015507 WO2024096354A1 (ko) 2022-10-31 2023-10-10 Ifitm3 억제제를 포함하는 신장암 예방 또는 치료용 약학적 조성물

Country Status (1)

Country Link
WO (1) WO2024096354A1 (ko)

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
"Government Project Final Report", 17 May 2018, UNIVERSITY OF ULSAN, Korea, article CHO, YONG MEE: "Development of an integrative predictive model and identification of resistance mechanism of VEGF-targeted therapy in metastatic renal cell carcinoma", pages: 1 - 38, XP009554354 *
CHENG SU: "Single-Cell RNA Sequencing in Multiple Pathologic Types of Renal Cell Carcinoma Revealed Novel Potential Tumor-Specific Markers", FRONTIERS IN ONCOLOGY, FRONTIERS MEDIA S.A., vol. 11, 14 October 2021 (2021-10-14), XP093166991, ISSN: 2234-943X, DOI: 10.3389/fonc.2021.719564 *
HEE SANG HWANG: "Involvement of the TNF-α Pathway in TKI Resistance and Suggestion of TNFR1 as a Predictive Biomarker for TKI Responsiveness in Clear Cell Renal Cell Carcinoma", JOURNAL OF KOREAN MEDICAL SCIENCES, XMLINK, SEOUL, KR, vol. 35, no. 5, 1 January 2020 (2020-01-01), SEOUL, KR , XP093166993, ISSN: 1011-8934, DOI: 10.3346/jkms.2020.35.e31 *
PEI-YI CHU: "IFITM3 promotes malignant progression, cancer stemness and chemoresistance of gastric cancer by targeting MET/AKT/FOXO3/c-MYC axis", CELL & BIOSCIENCE, BIOMED CENTRAL LTD, LONDON, UK, vol. 12, no. 1, 1 January 2022 (2022-01-01), London, UK , XP093166992, ISSN: 2045-3701, DOI: 10.1186/s13578-022-00858-8 *
YANG NANYAN; LIU ZHIHONG; PANG SHIYU; WU JINGJING; LIANG JUNGUANG; SUN LI: "Predicative value of IFITM2 in renal clear cell carcinoma: IFITM2 is associated with lymphatic metastasis and poor clinical outcome", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ELSEVIER, AMSTERDAM NL, vol. 534, 9 December 2020 (2020-12-09), Amsterdam NL , pages 157 - 164, XP086429373, ISSN: 0006-291X, DOI: 10.1016/j.bbrc.2020.11.124 *
YING XU: "Overexpressing IFITM family genes predict poor prognosis in kidney renal clear cell carcinoma", TRANSLATIONAL ANDROLOGY AND UROLOGY, vol. 10, no. 10, 1 October 2021 (2021-10-01), pages 3837 - 3851, XP093166989, ISSN: 2223-4683, DOI: 10.21037/tau-21-848 *

Similar Documents

Publication Publication Date Title
WO2012005550A2 (ko) 담낭암 치료용 약제학적 조성물 및 이를 이용한 담낭암의 성장, 전이 억제 및 치료 방법
US20120322857A1 (en) Methods of inhibiting tumor cell aggressiveness using the microenvironment of human embryonic stem cells
WO2012064146A9 (ko) Ｇｋｎ １을 함유하는 항암용 조성물
WO2020080861A1 (ko) Syt11 억제제를 유효성분으로 포함하는 위암 치료용 조성물
WO2024096354A1 (ko) Ifitm3 억제제를 포함하는 신장암 예방 또는 치료용 약학적 조성물
WO2015009094A1 (ko) PPAR-ν의 네딜화 억제제를 포함하는 지방세포분화 억제용 조성물 및 그 용도
KR101401891B1 (ko) 테모졸로미드 및 발프로산을 함께 이용하는 항암적 용도
WO2016159575A2 (ko) 만성 골수성 백혈병 암 줄기세포의 성장 또는 증식 억제용 조성물 및 이의 스크리닝 방법
WO2021137506A1 (ko) Wdr34 억제제를 포함하는 암줄기세포 성장 억제용 조성물 및 그 용도
KR20240068809A (ko) Ifitm3 억제제를 포함하는 신장암 예방 또는 치료용 약학적 조성물
WO2022146025A1 (ko) 암전이 억제 및 항암제 감수성 증진용 조성물
WO2018128429A1 (ko) 이노시톨 다인산 멀티키나아제 억제제를 유효성분으로 함유하는 염증성 질환의 예방 또는 치료용 약학적 조성물
KR102612000B1 (ko) Glis1 발현 또는 활성 억제제를 포함하는 난소암 전이 억제용 약학적 조성물
WO2013165061A1 (ko) Ｓｃｆ 또는 이의 수용체를 억제하는 물질을 포함하는 혈관 투과성 관련 질환의 치료 또는 예방용 조성물
WO2021002664A1 (ko) 암의 예방, 개선 또는 치료용 조성물
Kawabori et al. Existence of c-kit receptor-positive, tryptase-negative, IgE-negative cells in human allergic nasal mucosa: a candidate for mast cell progenitor
WO2015056970A1 (ko) 프로그래뉼린 억제제를 유효성분으로 함유하는 골다공증 예방 또는 치료용 조성물
KR101951550B1 (ko) 라이실-tRNA 합성효소 억제제를 유효성분으로 함유하는 골대사성 질환 예방 또는 치료용 약학적 조성물
WO2021075853A1 (ko) Emp3 억제제를 포함하는 암 줄기세포 성장 억제용 조성물 및 그 용도
WO2022005012A1 (ko) Sirt7 억제제를 포함하는 알레르기 질환 예방 또는 치료용 약학적 조성물
WO2019139429A1 (en) Novel use of kirrel2 and kirrel2 inhibitor
US11155820B2 (en) Target of VGSC β3 protein for prevention, treatment and diagnostic detection of cancers
WO2023121394A1 (ko) 환자-유래 엑소좀을 포함하는 항암 조성물 및 이의 용도
WO2022124626A1 (ko) 자가유지능이 향상된 중간엽줄기세포를 선별하는 방법 및 그에 의해 선별된 중간엽줄기세포
WO2023055023A1 (ko) Dna 손상 복구 효율 조절용 조성물