WO2024035035A1 - Pad 저해제를 포함하는 퇴행성 판막 질환의 예방 또는 치료용 조성물 - Google Patents

Pad 저해제를 포함하는 퇴행성 판막 질환의 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2024035035A1
WO2024035035A1 PCT/KR2023/011582 KR2023011582W WO2024035035A1 WO 2024035035 A1 WO2024035035 A1 WO 2024035035A1 KR 2023011582 W KR2023011582 W KR 2023011582W WO 2024035035 A1 WO2024035035 A1 WO 2024035035A1
Authority
WO
WIPO (PCT)
Prior art keywords
pad
valve
preventing
disease
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2023/011582
Other languages
English (en)
French (fr)
Inventor
이사민
지은혜
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Asan Foundation
University of Ulsan Foundation for Industry Cooperation
Original Assignee
Asan Foundation
University of Ulsan Foundation for Industry Cooperation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Asan Foundation, University of Ulsan Foundation for Industry Cooperation filed Critical Asan Foundation
Publication of WO2024035035A1 publication Critical patent/WO2024035035A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system

Definitions

  • the present invention relates to a composition for preventing or treating degenerative valve disease containing a PAD inhibitor.
  • valve diseases caused by degenerative changes in the valve eg, calcification or osteogenic differentiation, fibrosis, and/or inflammation, etc.
  • calcification or osteogenic differentiation e.g., calcification or osteogenic differentiation, fibrosis, and/or inflammation, etc.
  • fibrosis e.g., fibrosis, and/or inflammation, etc.
  • Aortic stenosis is a disease in which the diameter of the aortic valve narrows mainly due to calcification of the valve, preventing sufficient blood flow from the left ventricle to the aorta. It is commonly found in modern society where the proportion of the aging population is increasing. It is a valvular heart disease. Aortic valve stenosis is caused by inflammation due to endothelial cell damage due to mechanical stress, leaflet fibrosis, thickening, and calcification due to lipid penetration, especially Aortic valve calcification is the main pathological mechanism.
  • aortic valve stenosis In mild cases, aortic valve stenosis is often asymptomatic and therefore has a long subclinical period, but when it progresses to a more severe level, blood does not flow smoothly throughout the body, causing dizziness, chest pain, and fainting, and is fatal. It is known that if the aortic valve is left untreated, the annual mortality rate reaches 25%, and the average survival period is only 2 to 3 years.
  • a drug that fundamentally improves aortic valve stenosis has not yet been developed, so treatment of aortic valve stenosis usually consists of artificial valve replacement, which involves removing the damaged valve and inserting an artificial valve.
  • artificial valve replacement which involves removing the damaged valve and inserting an artificial valve.
  • open heart surgery is required to open the heart.
  • an artificial heart-lung machine must be used to replace cardiopulmonary function, which is a burden on the patient.
  • cardiopulmonary function which is a burden on the patient.
  • transcatheter aortic valve implantation a non-surgical treatment, has been performed on patients with high surgical risk.
  • the present invention was devised to solve the above problems, and when the activity or expression of PAD (protein-arginine deiminase), a protein involved in citrullination of proteins, is inhibited, calcification or osteogenic differentiation, fibrosis, and It was completed after confirming that inflammation, etc., was effectively suppressed.
  • PAD protein-arginine deiminase
  • the purpose of the present invention is to provide a pharmaceutical composition for preventing or treating degenerative valve disease, which contains a protein-arginine deiminase (PAD) inhibitor as an active ingredient.
  • PAD protein-arginine deiminase
  • Another object of the present invention is to provide a kit for preventing or treating degenerative valve disease, which includes a protein-arginine deiminase (PAD) inhibitor as an active ingredient.
  • PLD protein-arginine deiminase
  • the present invention provides a pharmaceutical composition for preventing or treating degenerative valve disease, comprising a protein-arginine deiminase (PAD) inhibitor as an active ingredient.
  • PLD protein-arginine deiminase
  • the present invention provides a kit for preventing or treating degenerative valve disease, comprising a PAD inhibitor or a pharmaceutical composition containing the same.
  • the present invention provides a method for preventing or treating degenerative valve disease, comprising administering a PAD inhibitor to an individual in need thereof.
  • the present invention provides a use of a PAD inhibitor for the prevention or treatment of degenerative valve disease.
  • the present invention provides the use of a PAD inhibitor for the manufacture of a medicament for the treatment of degenerative valve diseases.
  • the inhibitor may be an inhibitor of PAD protein activity or an expression inhibitor of the PAD gene, but is not limited thereto.
  • the activity inhibitor is one selected from the group consisting of a compound that specifically binds to a PAD protein or a pharmaceutically acceptable salt thereof, a peptide, a peptidomimetic, a substrate analog, an aptamer, and an antibody. It may be more than this, but is not limited to this.
  • the expression inhibitor is an antisense nucleotide, antisense oligonucleotide, small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), which binds complementary to the mRNA of the PAD gene. and RNA interference (RNAi) molecules, but is not limited thereto.
  • the siRNA may include one or more base sequences selected from the group consisting of SEQ ID NOs: 1 to 8, but is not limited thereto.
  • the valve may be the aortic valve, but is not limited thereto.
  • the degenerative valve disease includes valvular heart disease, aortic stenosis, aortic insufficiency, mitral stenosis, and mitral valve disease. It may be one or more selected from the group consisting of mitral insufficiency, but is not limited thereto.
  • the composition may satisfy one or more characteristics selected from the group consisting of, but is not limited to:
  • the composition may be for treating degenerative valve disease in a patient with increased levels of one or more selected from the group consisting of MCP1, CTGF, COL1A1, COL3A1, ⁇ -SMA, RUNX2, and BMP6.
  • MCP1, CTGF, COL1A1, COL3A1, ⁇ -SMA, RUNX2, and BMP6 are selected from the group consisting of MCP1, CTGF, COL1A1, COL3A1, ⁇ -SMA, RUNX2, and BMP6.
  • MCP1A1A1, COL3A1, ⁇ -SMA, RUNX2, and BMP6 selected from the group consisting of MCP1, CTGF, COL1A1, COL3A1, ⁇ -SMA, RUNX2, and BMP6.
  • the present invention relates to a pharmaceutical composition for the prevention or treatment of degenerative valve diseases, including aortic valve stenosis.
  • PAD protein-arginine deiminase
  • Figures 1a and 1b show the results of confirming the PAD2 protein level by Western blot after treating valve stromal cells isolated from aortic valve stenosis patients with the siRNA to confirm the effect of suppressing PAD expression by PAD2 target siRNA (Figure 1a), and The quantitative results (Figure 1b) are shown.
  • Figures 2a and 2b show the results of comparing the levels of calcification or osteogenic differentiation markers after treating valvular stromal cells isolated from patients with aortic valve stenosis with PAD inhibitors at various concentrations (DISEASE CONT: untreated control).
  • Figures 3a and 3b show the results of comparing the levels of inflammatory markers after treating valvular stromal cells isolated from patients with aortic valve stenosis with various concentrations of PAD inhibitors.
  • Figures 4a and 4b show the results of comparing the levels of fibrosis markers after treating valvular stromal cells isolated from patients with aortic valve stenosis with various concentrations of PAD inhibitors.
  • the present invention relates to a pharmaceutical composition for the prevention or treatment of degenerative valve disease.
  • PAD protein-arginine deiminase
  • the present invention provides a pharmaceutical composition for preventing or treating degenerative valve disease, comprising a protein-arginine deiminase (PAD) inhibitor as an active ingredient.
  • PLD protein-arginine deiminase
  • PAD protein-arginine deiminase
  • PAD protein-arginine deiminase refers to a hydrolytic enzyme that catalyzes arginine deimination and citrullination, which are post translational modifications of proteins. Abnormalities in PAD protein are known to be related to some autoimmune diseases and arthritis, but there is no known relationship between PAD protein and valve disease. PAD protein has five isozymes: PAD1, PAD2, PAD3, PAD4, and PAD6. Preferably, in the present invention, PAD may refer to PAD2.
  • PAD proteins or genes can be found in public databases such as Uniprot, for example under accession numbers Q9ULC6 (PAD1), Q9Y2J8 (PAD2), Q9ULW8 (PAD3), Q9UM07 (PAD4), Q6TGC4 (PAD6), etc. there is.
  • PAD inhibitors refers to substances that inhibit the activity of PAD protein or the expression of PAD genes.
  • the PAD inhibitor may act directly on the PAD gene, its mRNA, and/or PAD protein to inhibit the level or activity of the PAD protein, or indirectly through other mediators on the PAD gene, its mRNA, and/or PAD protein. It includes substances that act and consequently inhibit their level or activity.
  • PAD protein is an enzyme that induces citrullination of proteins, and the PAD inhibitor can reduce citrullination of proteins by inhibiting the activity or level of PAD.
  • the PAD inhibitor of the present invention can ultimately reduce the level of citrullinated proteins through PAD inhibition, thereby achieving the effect of preventing, improving, and/or treating degenerative valve disease.
  • the present inventors have confirmed in a previous study that increased levels of citrullinated proteins and anti-citrullinated peptide antibodies can worsen the prognosis of aortic valve stenosis.
  • activity of the PAD protein refers to the activity of the PAD protein produced through the translation process or the PAD protein already produced and present in the cell.
  • inhibiting the activity of the PAD protein means preventing the PAD protein from performing its original function normally, which causes chemical and/or structural modification of the PAD protein or the active site of the PAD protein ( This can be achieved by blocking the active site.
  • inhibition of the activity of the PAD protein includes a decrease in the activity of the PAD protein through processes such as post translational modification or through the activation/inactivation of proteins that interact together.
  • the inhibitor of PAD protein activity may be one or more selected from the group consisting of compounds that specifically bind to PAD protein, peptides, peptidomimetics, substrate analogs, aptamers, and antibodies, but is not limited thereto. No.
  • the inhibitor of PAD protein activity may be a compound or a pharmaceutically acceptable salt thereof that binds to the active site of the PAD protein and blocks its function.
  • the compound or a pharmaceutically acceptable salt thereof may be Cl-amidine or a pharmaceutically acceptable salt thereof.
  • the Cl-amidine is an irreversible inhibitor of PAD and deactivates it by modifying the active site of PAD. It is known that Cl-amidine can inhibit PAD1, PAD2, PAD3, and PAD4. Cl-amidine may have a structure represented by the following formula (1), but is not limited thereto.
  • the Cl-amidine has various variants.
  • BB-Cl amidine is a Cl-amidine variant in which the C-terminus is replaced with a benzimidazole group to limit proteolysis of the C-terminal amide while retaining the functional elements of Cl-amidine. am.
  • the BB-Cl amidine may have a structure represented by the following formula (2), but is not limited thereto.
  • the term “pharmaceutically acceptable” means that the benefit/risk ratio is reasonable for use in contact with tissue of a subject (e.g., a human) without undue toxicity, irritation, allergic reaction, or other problems or complications. It refers to a compound or composition that is suitable for the following and is within the scope of sound medical judgment.
  • acids examples include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, citric acid, methanesulfonic acid, formic acid. , benzoic acid, malonic acid, gluconic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid, etc.
  • Acid addition salts can be prepared by conventional methods, for example, by dissolving the compound in an excessive amount of aqueous acid and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone, or acetonitrile. It can also be prepared by heating equimolar amounts of the compound and an acid or alcohol in water and then evaporating the mixture to dryness, or suction filtering the precipitated salt.
  • a water-miscible organic solvent such as methanol, ethanol, acetone, or acetonitrile.
  • Salts derived from suitable bases may include, but are not limited to, alkali metals such as sodium and potassium, alkaline earth metals such as magnesium, and ammonium.
  • the alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving the compound in an excessive amount of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate.
  • an appropriate silver salt eg, silver nitrate
  • the scope of the compound of the present invention may include not only pharmaceutically acceptable salts, but also all isomers, hydrates, and solvates that can be prepared by conventional methods.
  • suppressing the expression of the PAD gene includes all phenomena that ultimately reduce the level of the PAD protein, such as suppressing the expression of mRNA at the transcription stage of the PAD coding gene or translation of the mRNA. ) is meant to include everything that suppresses.
  • inhibition of mRNA expression refers to the activation of an action mechanism capable of suppressing transcription of the PAD gene in the upstream action mechanism of the PAD coding gene, or, conversely, the inhibition of the upstream action mechanism capable of increasing transcription of the PAD gene.
  • concepts that can directly or indirectly reduce PAD expression such as methylation of the PAD gene promoter region or modification of histone proteins related to PAD gene expression, are all included in the present invention.
  • the reduction in the translation of PAD mRNA may include all mechanisms that can reduce the translation of the produced PAD mRNA, such as inhibiting the expression or activity of other proteins or nucleic acid molecules that promote the translation of PAD mRNA, or suppressing the expression or activity of PAD mRNA. It may reduce the activity of translation-related enzymes, but is not limited to this.
  • the expression inhibitor of the PAD gene is an antisense nucleotide, antisense oligonucleotide, small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), which binds complementary to the mRNA of the PAD gene. and RNA interference (RNAi) molecules, but is not limited thereto.
  • siRNA refers to a sense strand (e.g., a sequence corresponding to the mRNA sequence of a PAD gene) and an antisense strand (e.g., a sequence complementary to the mRNA sequence of a PAD gene). It may have a structure that is located on the opposite side and forms a double chain. Additionally, siRNA molecules that can be used in the present invention may have a single-stranded structure with self-complementary sense and antisense strands. siRNA is not limited to complete pairing of double-stranded RNA portions of RNA, but does not pair due to mismatch (corresponding bases are not complementary), bulge (corresponding base is missing in one chain), etc. Parts that are not included may be included. Specifically, the total length is 10 to 100 bases, more specifically 15 to 80 bases, and even more specifically 20 to 70 bases.
  • siRNA that inhibits the expression of the PAD gene may include one or more base sequences selected from the group consisting of SEQ ID NOs: 1 to 8, but is not limited thereto.
  • the PAD target siRNA may refer to a single siRNA molecule containing any one of the base sequences of SEQ ID NOs: 1 to 8, or may refer to a combination of the siRNA single molecules.
  • a polynucleotide consisting of a nucleic acid sequence represented by a specific sequence number is not limited to the nucleic acid sequence, and variants of the nucleic acid sequence are included within the scope of the present invention.
  • the polynucleotide molecule of the nucleic acid sequence of the present invention is a functional equivalent of the polynucleotide molecule constituting it, for example, some base sequences of the polynucleotide molecule are modified by deletion, substitution, or insertion. However, it is a concept that includes variants that can perform the same functional function as the corresponding polynucleotide.
  • the polynucleotide disclosed in the present invention has a sequence sequence of at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% of the nucleic acid sequence represented by a specific sequence number. It may contain an amino acid sequence (nucleic acid sequence) having homology. For example, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85. %, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence homology.
  • the “% sequence homology” for a polynucleotide is determined by comparing a comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is a reference sequence (additions or deletions) for the optimal alignment of the two sequences. may contain additions or deletions (i.e. gaps) compared to those that do not contain .
  • the PAD inhibitor according to the present invention may satisfy one or more characteristics selected from the group consisting of:
  • the valve tissue may preferably be aortic valve tissue. Additionally, the valve cells may preferably be aortic valve interstitial cells.
  • degenerative valve diseases includes all diseases caused by degenerative changes in the valve.
  • Degenerative change refers to the deterioration of the function or structure of body organs due to repeated use or aging.
  • degenerative valve disease refers to the deterioration of the structure or function of the valve due to aging, etc., damage to the heart valve due to congenital valve abnormalities, rheumatic fever, etc. (i.e., rheumatic valve disease), and valve damage due to bacterial infection (e.g. It is a distinct concept from septic valve damage caused by sepsis or septic shock.
  • the degenerative valve disease is a degenerative valve disease induced by accumulation of calcification, osteogenic differentiation, fibrosis, and inflammation in the valve tissue due to aging, etc. It can mean.
  • the degenerative valve disease according to the present invention is one in which structural and functional abnormalities occur in the valve as calcification, osteocytosis, fibrosis, inflammation, etc. accumulate in the valve, and is caused by fibrosis, calcification, inflammation, etc. of blood vessels. It must be distinguished from diseases caused by it (e.g., atherosclerosis).
  • atherosclerosis e.g., atherosclerosis
  • degenerative valve disease and atherosclerosis are separate diseases with clear differences although some histopathological characteristics and clinical factors are similar.
  • atherosclerosis is mainly associated with abnormalities in smooth muscle cells, but degenerative valvular disease is associated with abnormalities in fibroblasts and myofibroblasts, a subtype of differentiated fibroblasts.
  • atherosclerosis is known to be highly related to clinical factors such as gender and diabetes, but degenerative valve disease is not closely related to gender or diabetes (Circulation. 2005;111:3316-3326).
  • aortic valve stenosis the most significant contributing factor to degenerative valve diseases such as aortic valve stenosis is a high level of calcification that occurs along with a gradual increase in valve thickness and outflow obstruction.
  • Calcification is a major pathological mechanism observed from the beginning of the progression of aortic valve disease, and therefore degenerative valve disease is also referred to as calcific valve disease.
  • atherosclerosis is characterized by rupture of plaque associated with thrombosis and vascular occlusion, and occurs acutely. Therefore, in the treatment of atherosclerosis, plaque stabilization and antithrombotic treatment are mainly used, but this approach cannot be expected to have a significant therapeutic effect in valve diseases whose main cause is calcification.
  • the aortic valve is made up of three collagenous leaflets attached to the fibrous ring at the left ventricular outlet. All three layers are made up of valve interstitial cells, and the valve as a whole is composed of valve interstitial cells. Covered with valve endothelial cells. On the other hand, in blood vessels such as the aorta, smooth muscle cells are the main cells.
  • PAD inhibitors can treat degenerative valve disease by inhibiting the representative pathological mechanisms of degenerative valve disease.
  • the “cardiac valve” is preferably the aortic valve.
  • the valve is a membrane located within the heart that prevents blood from flowing back and helps ensure a steady flow. It consists of the tricuspid valve, mitral valve, pulmonary valve, and aortic valve.
  • the aortic valve is a valve located between the left ventricle and the aorta and consists of three leaflets, and unlike the tricheon valve or mitral valve, it does not contain ligaments or papillary muscles.
  • the aortic valve serves to prevent backflow of blood from the left ventricle to the aorta. Therefore, when degenerative changes in the aortic valve occur, the aortic valve may not perform its function normally and blood from the aorta may reflux into the left ventricle.
  • the degenerative valve disease according to the present invention includes without limitation any clinical symptom or disease induced by degenerative changes in the valve, and is not limited to specific types, such as valvular heart disease and aortic stenosis. , aortic insufficiency, mitral stenosis, and mitral insufficiency.
  • the degenerative valve disease may be improved or treated by specifically suppressing calcification or osteogenic differentiation, fibrosis, and/or inflammation of the valve tissue.
  • the degenerative valve disease according to the present invention is particularly characterized by MCP1 (monocyte chemoattractant protein-1), CTGF (connective tissue growth factor), COL1A1 (collagen type I alpha 1 chain), COL3A1 (collagen type III alpha 1 chain), ⁇ - It may indicate degenerative valve disease in patients with increased levels of one or more selected from the group consisting of SMA ( ⁇ -smooth muscle actin), RUNX2 (runt-related transcription factor 2), and BMP6 (bone morphogenetic protein 6).
  • SMA ⁇ -smooth muscle actin
  • RUNX2 runt-related transcription factor 2
  • BMP6 bone morphogenetic protein 6
  • the PAD inhibitor according to the present invention is particularly effective in suppressing calcification or osteogenic differentiation, fibrosis, and/or inflammation of valve tissue, and is therefore composed of MCP1, CTGF, COL1A1, COL3A1, ⁇ -SMA, RUNX2, and BMP6. It may show a particularly excellent therapeutic effect for degenerative valve disease in patients with increased levels of one or more selected from the group.
  • degenerative valve disease preferably aortic stenosis
  • aortic stenosis refers to a disease in which the aortic valve does not open well when the left ventricle contracts. Patients with aortic valve stenosis experience chest pain, fainting, and difficulty breathing because blood flow is not sufficient from the left ventricle to the aorta.
  • the main causes of aortic valve stenosis include aging, valve calcification (degeneration), rheumatism, congenital/structural abnormalities, and infective endocarditis.
  • aortic valve stenosis is preferably degenerative aortic valve stenosis.
  • Aortic valve stenosis causes a disorder of blood flow throughout the body, which can lead to cardiac hypertrophy as the contractility of the heart increases excessively. If excessive cardiac contraction continues, the contractility of the heart muscle may decrease and symptoms of heart failure may appear.
  • the content of the PAD inhibitor in the composition of the present invention can be appropriately adjusted depending on the symptoms of the disease, the degree of progression of the symptoms, the patient's condition, etc., for example, 0.0001 to 99.9% by weight, or 0.001 to 50% by weight, based on the total weight of the composition. It may be, but is not limited to this.
  • the content ratio is a value based on the dry amount with the solvent removed.
  • the pharmaceutical composition according to the present invention may further include appropriate carriers, excipients, and diluents commonly used in the preparation of pharmaceutical compositions.
  • the excipient may be, for example, one or more selected from the group consisting of diluents, binders, disintegrants, lubricants, adsorbents, humectants, film-coating materials, and controlled-release additives.
  • the pharmaceutical composition according to the present invention can be prepared as powder, granules, sustained-release granules, enteric-coated granules, solutions, eye drops, ellipsis, emulsions, suspensions, spirits, troches, perfumes, and limonadese according to conventional methods.
  • Carriers, excipients, and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, and calcium. These include phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • Additives to tablets, powders, granules, capsules, pills, and troches according to the present invention include corn starch, potato starch, wheat starch, lactose, white sugar, glucose, fructose, di-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, and phosphoric acid.
  • Excipients such as cellulose (HPMC) 1928, HPMC 2208, HPMC 2906, HPMC 2910, propylene glycol, casein, calcium lactate, and Primogel; Gelatin, gum arabic, ethanol, agar powder, cellulose acetate phthalate, carboxymethyl cellulose, calcium carboxymethyl cellulose, glucose, purified water, sodium caseinate, glycerin, stearic acid, sodium carboxymethyl cellulose, sodium methyl cellulose, methyl cellulose, microcrystalline cellulose, dextrin.
  • binders can be used, Hydroxypropyl methyl cellulose, corn starch, agar powder, methyl cellulose, bentonite, hydroxypropyl starch, sodium carboxymethyl cellulose, sodium alginate, calcium carboxymethyl cellulose, calcium citrate, sodium lauryl sulfate, silicic acid anhydride, 1-hydroxy Propylcellulose, dextran, ion exchange resin, polyvinyl acetate, formaldehyde-treated casein and gelatin, alginic acid, amylose, guar gum, sodium bicarbonate, polyvinylpyrrolidone, calcium phosphate, gelled starch, gum arabic, Disintegrants such as amylopectin, pectin, sodium polyphosphate, ethyl
  • soybean oil (Lubri wax), aluminum stearate, zinc stearate, sodium lauryl sulfate, magnesium oxide, Macrogol, synthetic aluminum silicate, silicic anhydride, higher fatty acids, higher alcohol, silicone oil, paraffin oil, polyethylene glycol fatty acid ether, Lubricants such as starch, sodium chloride, sodium acetate, sodium oleate, dl-leucine, and light anhydrous silicic acid may be used.
  • Additives for the liquid according to the present invention include water, dilute hydrochloric acid, dilute sulfuric acid, sodium citrate, sucrose monostearate, polyoxyethylene sorbitol fatty acid esters (twin esters), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, etc. can be used.
  • a solution of white sugar, other sugars, or sweeteners, etc. may be used in the syrup according to the present invention, and if necessary, flavoring agents, colorants, preservatives, stabilizers, suspending agents, emulsifiers, thickening agents, etc. may be used.
  • Purified water can be used in the emulsion according to the present invention, and emulsifiers, preservatives, stabilizers, fragrances, etc. can be used as needed.
  • Suspensions according to the present invention include acacia, tragacantha, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC), HPMC 1828, HPMC 2906, HPMC 2910, etc. Topics may be used, and surfactants, preservatives, stabilizers, colorants, and fragrances may be used as needed.
  • Injections according to the present invention include distilled water for injection, 0.9% sodium chloride injection, IV solution, dextrose injection, dextrose + sodium chloride injection, PEG, lactated IV solution, ethanol, propylene glycol, non-volatile oil - sesame oil.
  • solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristic acid, and benzene benzoate
  • Solubilizers such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, Tween, nicotinic acid amide, hexamine, and dimethylacetamide
  • Weak acids and their salts acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, albumin, peptone, and buffering agents such as gums
  • Isotonic agents such as sodium chloride
  • Stabilizers such as sodium bisulfite (NaHSO 3 ) carbon dioxide gas, sodium metabisulfite (Na 2 S 2 O 5 ), sodium sulfite (Na 2 SO 3 ), nitrogen gas (N 2 ),
  • Suppositories according to the present invention include cacao oil, lanolin, witepsol, polyethylene glycol, glycerogelatin, methylcellulose, carboxymethylcellulose, a mixture of stearic acid and oleic acid, Subanal, cottonseed oil, peanut oil, palm oil, cacao butter + Cholesterol, lecithin, Lanet wax, glycerol monostearate, Tween or Span, Imhausen, monolene (propylene glycol monostearate), glycerin, Adeps solidus, Buytyrum Tego -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydrocote SP, S-70-XXA, S-70-XX75(S-70-XX95), Hydro Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium (A, AS, B, C, D, E, I, T), Massa-MF, Massaupol, Masupol-15, Neosupostal-
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations include the extract with at least one excipient, such as starch, calcium carbonate, and sucrose. ) or prepared by mixing lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium styrate talc are also used.
  • Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups.
  • various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included.
  • Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate.
  • composition according to the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, activity of the drug, and the type and severity of the patient's disease. It can be determined based on factors including sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, drugs used simultaneously, and other factors well known in the medical field.
  • the pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve the maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art to which the present invention pertains.
  • the pharmaceutical composition of the present invention can be administered to an individual through various routes. All modes of administration are contemplated, including oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, intrarectal injection, vaginal injection. It can be administered by internal insertion, ocular administration, ear administration, nasal administration, inhalation, spraying through the mouth or nose, dermal administration, transdermal administration, etc.
  • the pharmaceutical composition of the present invention is determined depending on the type of drug as the active ingredient along with various related factors such as the disease to be treated, the route of administration, the patient's age, gender, weight, and severity of the disease.
  • the effective amount of the composition according to the present invention may vary depending on the patient's age, gender, and body weight, and is generally administered at 0.001 to 150 mg, preferably 0.01 to 100 mg, per kg of body weight every day or every other day, or 1 It can be administered in divided doses 1 to 3 times a day.
  • the above dosage does not limit the scope of the present invention in any way.
  • “individual” refers to a subject in need of treatment for a disease, and more specifically, human or non-human primates, mice, rats, dogs, cats, horses, cows, etc. refers to mammals of
  • “administration” means providing a given composition of the present invention to an individual by any appropriate method.
  • prevention refers to any action that suppresses or delays the onset of the desired disease
  • treatment refers to the improvement or improvement of the desired disease and its associated metabolic abnormalities by administration of the pharmaceutical composition according to the present invention. It refers to all actions that are beneficially changed, and “improvement” refers to all actions that reduce parameters related to the target disease, such as the degree of symptoms, by administering the composition according to the present invention.
  • the present invention provides a kit for preventing or treating degenerative valve disease comprising the PAD inhibitor according to the present invention.
  • kit is not limited to the specific form or type, and kits commonly used in the industry can be used.
  • the kit according to the present invention may further include, in addition to the PAD inhibitor, a storage solution, administration tool, suspension for administration, etc. of the PAD inhibitor, and may further include instructions regarding the characteristics of the PAD inhibitor.
  • BB-Cl amidine (BB-Cl) and PAD2 siRNA were used as representative examples of PAD inhibitors.
  • the sequence of PAD2 siRNA is shown in Table 1 below.
  • PAD2 siRNA_1 Sense GACGTATCTTGAACTGCCATT One Antisense TGGCAGTTCAAGATACGTCTA 2
  • PAD2 siRNA_2 Sense CGTTTCTTCGGCCAACGCTATT 3
  • PAD2 siRNA_3 Sense CGGCGTTGGGCTCTGCAAATT 5
  • PAD2 siRNA_4 Sense AGGTCACCGTCAACTACTATT 7 Antisense TAGTAGTTGACGGTGACCTTG 8
  • PAD2 siRNA_2 or PAD2 siRNA_3 were treated with the PAD2 siRNA (PAD2 siRNA_2 or PAD2 siRNA_3), and then Western blotting for PAD2 protein was performed. As shown in Figures 1A and 1B, it was confirmed that the protein expression of PAD2 was significantly reduced by the siRNA.
  • Aortic valve tissue from patients with aortic stenosis was obtained when aortic valve replacement surgery was performed.
  • the embodiments of the present invention complied with the Declaration of Helsinki, and the Institutional Review Board (IRB) of Asan Medical Center approved the research protocol for obtaining human samples, and written consent was obtained from all patients. .
  • Example 2 One leaflet of the human aortic valve obtained in Example 2 was cut into 4 to 5 pieces and reacted with collagenase at 37°C for 30 minutes to remove aortic valve endothelial cells. Subsequently, the tissue was cut into smaller pieces and further reacted at 37°C for 1.5 hours to obtain aortic valve interstitial cells (AVICs). Isolated human AVIC was cultured in DMEM/F12 containing 1% antibacterial-antifungal agent and 10% FBS. Only cells with 2 to 5 passages were used for experiments such as Western blot.
  • the aortic valve stromal cells obtained and cultured in Example 3 were exposed to a medium without serum and antibiotics for 1 hour before the experiment, and then the cells were treated with a complex of Lipofectamin 3000 and siRNA. After 6 hours, it was replaced with a medium containing only serum without antibiotics, and after 24 hours, it was replaced with a medium containing both antibiotics and serum, and cultured for an additional 24 hours before being used in the next experiment.
  • the obtained aortic valve interstitial cells were homogenized with 1X RIPA solution mixed with protease inhibitors, and then the lysate was loaded on an SDS-PAGE gel.
  • the separated protein was transferred to a PVDF membrane, and then the PVDF membrane was blocked with 5% BSA for 1 hour at room temperature. This was followed by detection using PAD2 protein antibody (proteintech, 12110-1-AP, 1:000 dilution) and HRP-conjugated anti-rabbit IgG antibody.
  • AVICs cDNA was produced by mixing the separated mRNA with random hexamer, dNTP, RNAse inhibitor, and reverse transcriptase and reacting at 37°C for 1 hour.
  • PCR was performed with primers for calcification marker (BMP6, Runx2, COL1a1), inflammation marker (MCP1, IL6), and fibrosis marker (CTGF, ⁇ -SMA, COL3a1) genes. At this time, the expression level was determined by the fluorescence value. Changes in the expression level of each gene were measured using SYBR, which can measure .
  • Calcification refers to a condition in which calcium is deposited in the aortic valve.
  • the valve thickens and becomes hard, causing aortic valve stenosis.
  • changes in calcification marker levels according to PAD inhibitor treatment were measured to determine whether PAD inhibitors could improve calcification, a representative pathological mechanism of aortic valve stenosis.
  • an experiment was performed by treating compound BB-Cl and siRNA as PAD inhibitors, respectively.
  • valve stromal cells isolated from patients with aortic valve stenosis were treated with BB-Cl, a compound among PAD inhibitors, at a concentration of 1 ⁇ M, 3 ⁇ M, or 5 ⁇ M, and the expression levels of calcification markers were checked after 24 or 48 hours. .
  • the levels of BMP6 and COL1A1 were decreased in the group treated with BB-Cl compared to the untreated control group, and in particular, the group treated with the PAD inhibitor at a concentration of 3 ⁇ M or more had a lower level of calcification markers compared to the control group. It was confirmed that it had decreased to less than half of this level. This shows that PAD inhibitors can improve calcification of valve tissue.
  • valve stromal cells were treated with PAD-targeting siRNA for 48 hours, and then the expression levels of valve calcification markers RUNX2 and COL1A1 were confirmed.
  • Aortic valve stenosis is caused by a complex accumulation of tissue fibrosis, calcification, and inflammation. Therefore, in order to confirm whether the PAD inhibitor of the present invention exerts an anti-inflammatory effect on aortic valve tissue, valve tissue cells isolated from aortic valve stenosis patients were treated with the PAD inhibitor of the present invention to determine whether there was a change in the level of inflammatory factors. did. At this time, the experiment was performed by treating compound BB-Cl and siRNA as PAD inhibitors, respectively.
  • the level of MCP1, an inflammatory marker was significantly decreased in the group treated with the PAD inhibitor compound BB-Cl compared to the untreated control group, and the group treated with the PAD inhibitor at a concentration of 3 ⁇ M or more was significantly lower than the control group. It was found that levels of inflammatory markers were reduced by more than half. In other words, the above results mean that the PAD inhibitor of the present invention has an anti-inflammatory effect.
  • MCP1 is a chemokine that induces immune cells and performs the function of inducing tissue infiltration of immune cells. Therefore, the effect of MCP1 inhibition by PAD inhibitors suggests that the PAD inhibitors can also reduce tissue infiltration of immune cells.
  • PAD inhibitors can improve or treat valve degenerative diseases, including aortic valve stenosis, by suppressing inflammation in aortic valve tissue.
  • Fibrosis is one of the representative symptoms of aortic valve stenosis and refers to the phenomenon in which part of the organ hardens due to excessive formation of fibrous connective tissue within the organ.
  • PAD inhibitors could inhibit fibrosis of valve tissue cells.
  • the experiment was performed by treating compound BB-Cl and siRNA as PAD inhibitors, respectively.
  • valve cells isolated from aortic valve stenosis patients were treated with 1 ⁇ M, 3 ⁇ M, or 5 ⁇ M of the PAD inhibitor compound BB-Cl for 24 or 72 hours, and then the valve fibrosis markers CTGF, COL3A1, and ⁇ - The expression level of SMA was confirmed.
  • the level of fibrosis markers in valve tissue cells treated with the PAD inhibitor of the present invention decreased compared to the untreated control group, and this trend was dependent on the concentration of the PAD inhibitor (FIG. 4a).
  • the group treated with the PAD inhibitor at a concentration of 5 ⁇ M showed that the levels of all fibrosis markers were reduced to levels below 10%.
  • Aortic valve stenosis is a disease whose main clinical symptoms are calcification or osteogenesis, fibrosis, and inflammation. To treat it, all calcification, fibrosis, and inflammation of the aortic valve tissue must be improved.
  • PAD inhibitors regardless of their type, can suppress calcification or osteogenic differentiation, fibrosis, and inflammation in cells derived from patients with aortic valve stenosis by suppressing the expression or activity of PAD.
  • the PAD inhibitor according to the present invention is expected to be used as a treatment for various degenerative valve diseases, including aortic valve stenosis, and as an agent for improving prognosis by suppressing calcification or osteogenic differentiation, fibrosis, and inflammation, which are major pathological mechanisms in aortic valve tissue. .
  • the present invention relates to a pharmaceutical composition for the prevention or treatment of degenerative valve diseases, including aortic valve stenosis.
  • PAD protein-arginine deiminase
  • calcification or osteogenic differentiation, fibrosis It was completed after confirming that inflammation, etc., was effectively suppressed.
  • the present invention simultaneously suppresses calcification or osteogenic differentiation, fibrosis, and inflammation of valve tissue, which are the main pathological mechanisms of degenerative valve disease, so that it is possible to fundamentally treat or prevent the progression of degenerative valve disease and improve the prognosis. It is expected that it can be used as a treatment for various diseases caused by degenerative deformation of valves.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 대동맥판막 협착증을 비롯한 퇴행성 판막 질환의 예방 내지 치료를 위한 약학적 조성물에 관한 것으로서, 대동맥판막 환자 유래 판막세포에서 PAD (protein-arginine deiminase) 단백질을 억제하였을 때, 석회화 또는 골분화, 섬유화, 염증 등이 효과적으로 억제되는 것을 확인하여 완성된 것이다. 즉, 본 발명은 퇴행성 판막 질환의 주요 병리기전인 판막 조직의 석회화 또는 골분화, 섬유화, 및 염증을 동시에 억제하므로 퇴행성 판막 질환의 근본적인 치료 또는 진행의 예방이 가능한 바, 판막의 퇴행성 변형으로 유발되는 다양한 질환의 치료제로 활용 가능할 것으로 기대된다.

Description

PAD 저해제를 포함하는 퇴행성 판막 질환의 예방 또는 치료용 조성물
본 발명은 PAD 저해제를 포함하는 퇴행성 판막 질환의 예방 또는 치료용 조성물 등에 관한 것이다.
본 출원은 2022년 08월 08일에 출원된 한국특허출원 제10-2022-0098653호에 기초한 우선권을 주장하며, 해당 출원의 명세서 및 도면에 개시된 모든 내용은 본 출원에 원용된다.
최근 인구의 고령화가 급격히 진행되면서 판막의 퇴행성 변화 (예컨대, 석회화 또는 골분화, 섬유화, 및/또는 염증 등)에 의한 판막 질환이 증가하고 있다. 정상적으로 기능하던 판막에 구조적 이상이 발생하면 판막의 개폐 기능이 저하되므로, 혈액 순환이 원활히 일어나지 못하고 심장을 포함한 다양한 기관에 2차적인 기능 이상을 초래할 수 있다.
퇴행성 판막 질환의 대표예인 대동맥판막 협착증 (Aortic stenosis, AS)은 주로 판막의 석회화로 인하여 대동맥판막의 직경이 좁아져 좌심실에서 대동맥으로 혈류가 충분히 나가지 못하는 질환으로, 고령화 인구 비율이 높아지는 현대 사회에서 흔히 발견되는 판막성 심장 질환이다. 대동맥판막 협착증은 기계적 스트레스 (mechanical stress)로 인한 내피세포의 손상에 따른 염증, 지질 침투 (lipid penetration)으로 인한 엽 (leaflet) 섬유화, 비후 (thickening), 및 석회화 (calcification) 등에 의해 발생하며, 특히 대동맥판막 석회화를 주된 병리기전으로 한다. 대동맥판막 협착증은 경도인 경우에는 무증상인 경우가 많고 따라서 무증상 기간 (subclinical period)이 길지만, 중증도 이상으로 진행되고 나면 전신으로 혈액이 순조롭게 나가지 못하므로 현기증, 흉통, 실신 등을 유발하며 치명적이다. 대동맥판막을 치료하지 않고 방치하는 경우 연간 사망률은 25%에 달하며, 평균 생존 기간은 2 내지 3년에 불과한 것으로 알려져 있다.
대동맥판막 협착증을 근본적으로 개선해주는 약물은 아직까지 개발되지 않았으며, 따라서 대동맥판막 협착증의 치료는 대개 손상된 판막을 제거하고 인공판막을 삽입하는 인공판막 치환술로 이루어진다. 그러나 판막 치환을 위해서는 심장을 여는 개심술을 시행해야 하며, 특히 개심술을 받는 동안에는 심장을 정지시키고 심폐 기능을 대신하는 인공 심폐기를 사용하여야 하므로 환자에게 부담이 된다. 또한 기계 판막으로 치환하는 경우 혈액 응고를 막기 위해 항응고제를 평생 복용해야 하는 문제가 있다. 최근에는 수술 위험도가 높은 환자를 대상으로 비수술적 치료인 경피적 대동맥판막 삽입술을 시행하고 있으나, 인위적으로 제조한 조직 판막을 삽입하는 것으로서, 결국 대동맥판막 협착증의 근본적인 치료는 여전히 불가능한 실정이다. 따라서, 대동맥판막 협착증의 발병 기전을 개선하여 상기 질환을 근본적으로 치료하거나 중증으로의 진행을 예방하기 위한 새로운 치료법의 발굴이 필요하다.
본 발명은 상기 문제점을 해결하기 위해 안출된 것으로서, 단백질의 시트룰린화 (citrullination)에 관여하는 단백질인 PAD (protein-arginine deiminase)의 활성 혹은 발현을 억제하였을 때 대동맥판막의 석회화 또는 골분화, 섬유화, 및 염증 등이 효과적으로 억제되는 것을 확인하여 완성된 것이다.
따라서, 본 발명의 목적은 PAD (protein-arginine deiminase) 저해제를 유효성분으로 포함하는, 퇴행성 판막 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 PAD (protein-arginine deiminase) 저해제를 유효성분으로 포함하는, 퇴행성 판막 질환의 예방 또는 치료용 키트를 제공하는 것이다.
그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야의 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
본 발명은 PAD (protein-arginine deiminase) 저해제를 유효성분으로 포함하는, 퇴행성 판막 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 PAD 저해제 또는 이를 포함하는 약학적 조성물을 포함하는, 퇴행성 판막 질환의 예방 또는 치료용 키트를 제공한다.
또한, 본 발명은 PAD 저해제를 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 퇴행성 판막 질환의 예방 또는 치료방법을 제공한다.
또한, 본 발명은 PAD 저해제의 퇴행성 판막 질환의 예방 또는 치료 용도를 제공한다.
또한, 본 발명은 퇴행성 판막 질환 치료용 약제의 제조를 위한 PAD 저해제의 용도를 제공한다.
본 발명의 일 구현예에서, 상기 저해제는 PAD 단백질의 활성 억제제 또는 PAD 유전자의 발현 억제제일 수 있으나, 이에 한정되지 않는다.
본 발명의 다른 구현예에서, 상기 활성 억제제는 PAD 단백질에 특이적으로 결합하는 화합물 또는 이의 약학적으로 허용 가능한 염, 펩티드, 펩티드모방체, 기질유사체, 앱타머, 및 항체로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되지 않는다.
본 발명의 또 다른 구현예에서, 상기 발현 억제제는 PAD 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 안티센스 올리고뉴클레오티드, 작은 간섭 RNA (siRNA), 짧은 헤어핀 RNA (shRNA), 마이크로RNA (miRNA), 및 RNA 간섭 (RNAi) 분자로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되지 않는다.
본 발명의 또 다른 구현예에서, 상기 siRNA는 서열번호 1 내지 8로 이루어진 군에서 선택된 하나 이상의 염기 서열을 포함할 수 있으나, 이에 한정되지 않는다.
본 발명의 또 다른 구현예에서, 상기 판막은 대동맥판막일 수 있으나, 이에 한정되지 않는다.
본 발명의 또 다른 구현예에서, 상기 퇴행성 판막 질환은 심장판막질환 (valvular heart disease), 대동맥판막 협착증 (aortic stenosis), 대동맥판막 폐쇄부전증 (aortic insufficiency), 승모판막 협착증 (mitral stenosis), 및 승모판 기능부전 (mitral insufficiency)으로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되지 않는다.
본 발명의 또 다른 구현예에서, 상기 조성물은 하기로 이루어진 군에서 선택된 하나 이상의 특징을 만족할 수 있으나, 이에 한정되지 않는다:
(a) 판막 조직의 석회화 또는 골분화를 억제함;
(b) 판막 조직의 섬유화를 억제함; 및
(c) 판막 조직의 염증을 억제함.
본 발명의 또 다른 구현예에서, 상기 조성물은 MCP1, CTGF, COL1A1, COL3A1, α-SMA, RUNX2, 및 BMP6로 이루어진 군에서 선택된 하나 이상의 수준이 증가된 환자의 퇴행성 판막 질환을 치료하기 위한 것일 수 있으나, 이에 한정되지 않는다.
본 발명은 대동맥판막 협착증을 비롯한 퇴행성 판막 질환의 예방 내지 치료를 위한 약학적 조성물에 관한 것으로서, 대동맥판막 환자 유래 판막세포에서 PAD (protein-arginine deiminase) 단백질을 억제하였을 때, 석회화 또는 골분화, 섬유화, 및/또는 염증 등이 효과적으로 억제되는 것을 확인하여 완성된 것이다. 즉, 본 발명은 퇴행성 판막 질환의 주요 병리기전인 판막 조직의 석회화 (또는 골분화), 섬유화, 및 염증을 동시에 억제하므로 퇴행성 판막 질환의 근본적인 치료가 가능한 바, 판막의 퇴행성 변형으로 유발되는 다양한 질환의 치료제로 활용 가능할 것으로 기대된다.
도 1a 및 1b는 PAD2 타겟 siRNA에 의한 PAD 발현 억제 효과를 확인하기 위해, 대동맥판막 협착증 환자로부터 분리된 판막간질세포에 상기 siRNA를 처리한 후 PAD2 단백질 수준을 웨스턴 블롯으로 확인한 결과 (도 1a) 및 이의 정량 결과 (도 1b)를 나타낸다.
도 2a 및 2b는 대동맥판막 협착증 환자로부터 분리된 판막간질세포에 PAD 저해제를 다양한 농도로 처리한 후 석회화 또는 골분화 마커의 수준을 비교한 결과를 나타낸다 (DISEASE CONT: 미처리 대조군).
도 3a 및 3b는 대동맥판막 협착증 환자로부터 분리된 판막간질세포에 PAD 저해제를 다양한 농도로 처리한 후 염증 마커의 수준을 비교한 결과를 나타낸다.
도 4a 및 4b은 대동맥판막 협착증 환자로부터 분리된 판막간질세포에 PAD 저해제를 다양한 농도로 처리한 후 섬유화 마커의 수준을 비교한 결과를 나타낸다.
본 발명은 퇴행성 판막 질환의 예방 또는 치료용 약학적 조성물 등에 관한 것으로서, 단백질 시트룰린화에 관여하는 단백질인 PAD (protein-arginine deiminase)의 발현 또는 활성을 억제하였을 때 퇴행성 판막 질환의 주요 병리기전인 석회화 또는 골분화, 섬유화, 및 염증 등이 현저하게 감소하는 것을 확인하여 완성된 것이다.
따라서, 본 발명은 PAD (protein-arginine deiminase) 저해제를 유효성분으로 포함하는, 퇴행성 판막 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명에 있어서, “PAD (protein-arginine deiminase)”은 단백질의 번역 후 변형 (post translational modification)인 아르기닌 탈이미네이션 (arginine deimination) 및 시트룰린화 (citrullination)를 촉매하는 가수분해효소를 지칭한다. PAD 단백질의 이상은 일부 자가면역질환이나 관절염 등과 연관이 있는 것으로 알려져 있으나, PAD 단백질과 판막 질환의 연관성에 대해서는 알려진 바가 없다. PAD 단백질은 PAD1, PAD2, PAD3, PAD4, 및 PAD6의 5가지 아이소자임 (isozymes)을 갖는다. 바람직하게는, 본 발명에 있어서 PAD는 PAD2를 지칭할 수 있다. PAD 단백질 또는 유전자에 대한 구체적인 정보는 Uniprot과 같은 공개 데이터베이스에서 확인할 수 있으며, 예컨대 등록번호 Q9ULC6 (PAD1), Q9Y2J8 (PAD2), Q9ULW8 (PAD3), Q9UM07 (PAD4), Q6TGC4 (PAD6) 등으로 확인할 수 있다.
본 발명에 있어서, “PAD 저해제 (PAD inhibitors)”란 PAD 단백질의 활성을 억제하거나 혹은 PAD 유전자의 발현을 억제하는 물질을 지칭한다. 상기 PAD 저해제는 PAD 유전자, 이의 mRNA, 및/또는 PAD 단백질에 직접 작용하여 PAD 단백질의 수준 혹은 활성을 저해할 수도 있고, 다른 매개인자를 통해 간접적으로 PAD 유전자, 이의 mRNA, 및/또는 PAD 단백질에 작용함으로써 결과적으로 이들의 수준 혹은 활성을 저해하는 물질을 포함한다. 또한, 상술한 바와 같이 PAD 단백질은 단백질의 시트룰린화을 유도하는 효소인 바, 상기 PAD 저해제는 PAD의 활성 혹은 수준을 억제함으로써 단백질들의 시트룰린화를 감소시킬 수 있다. 즉, 본 발명의 PAD 저해제는 PAD 억제를 통해 결과적으로 시트룰린화 단백질들의 수준도 감소시킬 수 있으며, 이를 통해 퇴행성 판막 질환의 예방, 개선, 및/또는 치료 효과를 달성하는 것일 수 있다. 실제로, 본 발명자들은 이전 연구에서 시트룰린화 단백질 및 항-시트룰린화 펩티드 항체의 수준의 증가가 대동맥판막 협착증의 예후를 악화시킬 수 있음을 확인한 바 있다.
본 발명에 있어서, “PAD 단백질의 활성”은 번역과정을 통해 생산된 PAD 단백질 혹은 이미 세포 내에 생산되어 존재하는 PAD 단백질의 활성을 의미한다. 본 발명에 있어서, PAD 단백질의 활성을 억제한다는 것은 PAD 단백질이 본래의 기능을 정상적으로 수행하지 못하도록 방해하는 것을 의미하며, 이는 PAD 단백질의 화학적 및/또는 구조적 변형을 일으키거나, PAD 단백질의 활성부위 (active site)를 차단함으로써 이루어질 수 있다. 또한, PAD 단백질의 활성 억제는 번역 후 변형 (post translational modification) 등의 과정을 거치거나 혹은 함께 상호작용하는 단백질들의 활성/불활성에 의해 PAD 단백질의 활성이 감소하는 것을 모두 포함한다.
구체적으로, 본 발명에 있어서 PAD 단백질의 활성 억제제는 PAD 단백질에 특이적으로 결합하는 화합물, 펩티드, 펩티드모방체, 기질유사체, 앱타머, 및 항체로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되지 않는다.
바람직하게는, 본 발명에 있어서 PAD 단백질의 활성 억제제는 PAD 단백질의 활성부위에 결합하여 이의 기능을 차단하는 화합물 또는 이의 약학적으로 허용 가능한 염일 수 있다. 예컨대, 상기 화합물 또는 이의 약학적으로 허용 가능한 염은 Cl-아미딘 (Cl-amidine) 또는 이의 약학적으로 허용 가능한 염일 수 있다. 상기 Cl-아미딘은 PAD의 비가역적 억제제로, PAD의 활성부위를 변형시켜 이를 불활성화시킨다. Cl-아미딘은 PAD1, PAD2, PAD3, 및 PAD4를 억제할 수 있는 것으로 알려져 있다. Cl-아미딘은 하기 화학식 1로 표시되는 구조를 가질 수 있으나, 이에 한정되는 것은 아니다.
[화학식 1]
Figure PCTKR2023011582-appb-img-000001
상기 Cl-아미딘은 다양한 변이체가 종류한다. 예컨대, BB-Cl 아미딘은 Cl-아미딘의 기능적 요소들을 유지하면서 C-말단 아미드의 단백질 분해를 제한하기 위해 C-말단이 벤즈이미다졸 그룹 (benzimidazole group)으로 대체되어 있는 Cl-아미딘 변이체이다. 상기 BB-Cl 아미딘은 하기 화학식 2로 표시되는 구조를 가질 수 있으나, 이에 한정되는 것은 아니다.
[화학식 2]
Figure PCTKR2023011582-appb-img-000002
본 명세서에서 사용된 용어, “약학적으로 허용 가능한”이라는 용어는 과도한 독성, 자극, 알러지 반응 또는 기타 문제점이나 합병증 없이 이득/위험 비가 합리적이어서 대상체 (예를 들어, 인간)의 조직과 접촉하여 사용하기에 적합하며, 건전한 의학적 판단의 범주 이내인 화합물 또는 조성물을 의미한다.
적합한 산의 예로는 염산, 브롬산, 황산, 질산, 과염소산, 푸마르산, 말레산, 인산, 글리콜산, 락트산, 살리실산, 숙신산, 톨루엔-p-설폰산, 타르타르산, 아세트산, 시트르산, 메탄설폰산, 포름산, 벤조산, 말론산, 글루콘산, 나프탈렌-2-설폰산, 벤젠설폰산 등을 들 수 있다. 산부가염은 통상의 방법, 예를 들면 화합물을 과량의 산 수용액에 용해시키고, 이 염을 메탄올, 에탄올, 아세톤 또는 아세토니트릴과 같은 수혼화성 유기 용매를 사용하여 침전시켜서 제조할 수 있다. 또한, 동몰량의 화합물 및 물 중의 산 또는 알코올을 가열하고 이어서 상기 혼합물을 증발시켜서 건조시키거나, 또는 석출된 염을 흡인 여과시켜 제조할 수 있다.
적합한 염기로부터 유도된 염은 나트륨, 칼륨 등의 알칼리 금속, 마그네슘 등의 알칼리 토금속, 및 암모늄 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. 알칼리 금속 또는 알칼리 토금속염은, 예를 들면 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리토 금속 수산화물 용액 중에 용해하고, 비용해 화합물염을 여과한 후 여액을 증발, 건조시켜 얻을 수 있다. 이 때, 금속염으로서는 특히 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하며, 또한 이에 대응하는 은염은 알칼리 금속 또는 알칼리토 금속염을 적당한 은염 (예, 질산은)과 반응시켜 얻을 수 있다.
본 발명의 화합물의 범위에는 약학적으로 허용 가능한 염뿐만 아니라, 통상의 방법에 의해 제조될 수 있는 모든 이성질체, 수화물 및 용매화물이 모두 포함될 수 있다.
본 발명에 있어서, PAD 유전자의 발현을 억제한다는 것은 최종적으로 PAD 단백질의 수준을 감소시키는 모든 현상을 포함하는 것으로서, PAD 코딩 유전자의 전사 단계에서 mRNA의 발현을 억제하거나, 또는 상기 mRNA의 번역 (translation)을 억제하는 것을 모두 포함하는 의미이다. 본 발명에 있어서, mRNA의 발현 억제는 PAD 코딩 유전자의 상위 작용기전에서 PAD 유전자의 전사를 억제할 수 있는 작용기전이 활성화되거나, 반대로 PAD 유전자의 전사를 증가시킬 수 있는 상위 작용기전이 억제되는 것일 수 있고, 또한, PAD 유전자 프로모터 부위의 메틸화 (methylation), 또는 PAD 유전자 발현과 관련된 히스톤 단백질의 변형 (histone modification) 등 직간접적으로 PAD 발현을 감소시킬 수 있는 개념이 모두 본 발명에 포함된다. 본 발명에서 PAD mRNA의 번역 감소는 생산된 PAD mRNA의 번역을 감소시킬 수 있는 모든 기전들이 포함될 수 있으며, 예컨대 PAD mRNA의 번역을 촉진시키는 기타 단백질 혹은 핵산분자의 발현 또는 활성을 억제하거나, PAD mRNA의 번역 관련 효소들의 활성을 감소시키는 것일 수 있으나, 이에 제한되지 않는다.
구체적으로, 본 발명에 있어서 PAD 유전자의 발현 억제제는 PAD 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 안티센스 올리고뉴클레오티드, 작은 간섭 RNA (siRNA), 짧은 헤어핀 RNA (shRNA), 마이크로RNA (miRNA), 및 RNA 간섭 (RNAi) 분자로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되지 않는다.
본 명세서에서 사용된 용어 “siRNA”는 센스 가닥 (예를 들어, PAD 유전자의 mRNA 서열에 상응하는 (corresponding) 서열)과 안티센스 가닥 (예를 들어, PAD 유전자의 mRNA 서열에 상보적인 서열)이 서로 반대쪽에 위치하여 이중쇄를 이루는 구조를 가질 수 있다. 또한, 본 발명에서 이용될 수 있는 siRNA 분자는, 자기-상보성 (self-complementary) 센스 및 안티센스 가닥을 가지는 단일쇄 구조를 가질 수 있다. siRNA는 RNA끼리 짝을 이루는 이중사슬 RNA 부분이 완전히 쌍을 이루는 것에 한정되지 않고 미스매치 (대응하는 염기가 상보적이지 않음), 벌지 (일방의 사슬에 대응하는 염기가 없음) 등에 의하여 쌍을 이루지 않는 부분이 포함될 수 있다. 구체적으로는, 전체 길이는 10 내지 100 염기, 보다 구체적으로는 15 내지 80 염기, 그리고 보다 더 구체적으로는 20 내지 70 염기이다.
본 발명에 있어서, PAD 유전자의 발현을 억제하는 siRNA, 즉, PAD 타겟 siRNA는 서열번호 1 내지 8로 이루어진 군에서 선택된 하나 이상의 염기서열을 포함할 수 있으나, 이에 한정되지 않는다. 예컨대, 상기 PAD 타겟 siRNA는 서열번호 1 내지 8 중 어느 하나의 염기서열을 포함하는 siRNA 단일 분자를 지칭할 수도 있고, 혹은 상기 siRNA 단일 분자들의 조합을 지칭할 수도 있다.
본 발명에 있어서 특정 서열번호로 표시되는 핵산 서열로 이루어진 폴리뉴클레오티드는 해당 핵산 서열에만 제한되지 않으며, 상기 핵산 서열의 변이체가 본 발명의 범위 내에 포함된다. 본 발명의 핵산 서열의 폴리뉴클레오티드 분자는 이를 구성하는 폴리뉴클레오티드 분자의 작용성 등가물, 예를 들어, 폴리뉴클레오티드 분자의 일부 염기 서열이 결실(deletion), 치환(substitution) 또는 삽입(insertion)에 의해 변형되었지만, 해당 폴리뉴클레오티드와 기능적으로 동일한 작용을 할 수 있는 변이체 (variants)를 포함하는 개념이다. 구체적으로, 본 발명에 개시된 폴리뉴클레오티드는 특정 서열번호로 표시되는 핵산 서열과 각각 70% 이상, 더욱 바람직하게는 80% 이상, 더 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 아미노산 서열(핵산 서열)을 포함할 수 있다. 예를 들면, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%의 서열 상동성을 갖는 폴리뉴클레오티드를 포함한다. 폴리뉴클레오티드에 대한 “서열 상동성의 %”는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열 (추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제 (즉, 갭)를 포함할 수 있다.
바람직하게는, 본 발명에 따른 PAD 억제제는 하기로 이루어진 군에서 선택된 하나 이상의 특징을 만족할 수 있다:
(a) 판막 조직의 석회화 또는 골분화를 억제함;
(b) 판막 조직의 섬유화를 억제함; 및
(c) 판막 조직의 염증을 억제함.
상기 판막 조직은 바람직하게는 대동맥판막 조직일 수 있다. 또한, 상기 판막 세포는 바람직하게는 대동맥판막 간질세포일 수 있다.
본 발명에 있어서, “퇴행성 판막 질환 (degenerative valve diseases)”은 판막의 퇴행성 변화로 인해 발생하는 모든 질환을 포함한다. 퇴행성 변화란 몸의 기관 등이 반복적으로 사용되거나 노화하여 그 기능이나 구조가 퇴화한 것을 의미한다. 즉, 퇴행성 판막 질환은 노화 등으로 인해 판막의 구조나 기능이 퇴화하는 것으로서, 선천적인 판막 이상이나 류마티스 열 등에 의한 심장 판막의 손상 (즉, 류마티스성 판막 질환), 세균감염에 의한 판막 손상 (예컨대 패혈증 혹은 패혈성 쇼크 등으로 유발되는 패혈성 판막 손상) 등과는 구별되는 개념이다. 바람직하게는, 본 발명에 있어서 퇴행성 판막 질환은 특히 노화 등으로 인해 판막 조직에서 석회화 (calcification) 또는 골분화 (osteogenic differentiation), 섬유화 (fibrosis), 및 염증 (inflammation)이 축적되면서 유도되는 퇴행성 판막 질환을 의미할 수 있다.
이와 같이, 본 발명에 따른 퇴행성 판막 질환은 판막의 석회화 또는 골세포화, 섬유화, 염증 등이 축적되면서 판막에 구조적, 기능적 이상이 발생하는 것으로서, 혈관 (blood vessels)의 섬유화, 석회화, 염증 등으로 인해 발생하는 질환 (예컨대, 죽상동맥경화증)과는 구별되어야 한다. 실제로, 퇴행성 판막 질환 및 죽상동맥경화증은 조직병리학적 특징 및 임상적 요인들이 일부 일치하기도 하지만, 명확한 차이가 존재하는 별개의 질환이다. 예를 들어, 죽상동맥경화증은 주로 평활근 세포의 이상과 관련이 있으나, 퇴행성 판막 질환은 분화된 섬유모세포 (differentiated fibroblasts)의 아형인 섬유모세포 (fibroblasts) 및 근섬유모세포 (myofibroblasts)의 이상과 연관이 있다. 또한, 죽상동맥경화증은 성별이나 당뇨와 같은 임상적 요인과도 관련이 높은 것으로 알려져 있으나, 퇴행성 판막 질환은 성별이나 당뇨 등과는 연관성이 크지 않다 (Circulation. 2005;111:3316-3326).
특히, 대동맥판막 협착증과 같은 퇴행성 판막 질환에 가장 크게 기여하는 인자는 판막 두께의 점진적인 증가 및 유출 폐색 (outflow obstruction)과 함께 일어나는 높은 수준의 석회화이다. 석회화는 대동맥판막 질환의 진행 초기부터 관찰되는 주요 병리기전이며, 따라서 퇴행성 판막 질환은 석회화 판막 질환 (calcific valve disease)으로 지칭되기도 한다. 반면, 죽상동맥경화증은 혈전증, 혈관 폐색 등과 관련된 플라크 (plaque)의 파열을 특징으로 하며, 급성으로 발생한다. 따라서, 죽상동맥경화증의 치료에서는 플라크의 안정화 및 항혈전 치료가 주로 사용되지만, 이와 같은 접근 방식은 석회화를 주요 원인으로 하는 판막 질환에는 큰 치료 효과를 기대할 수 없다.
대동맥판막은 좌심실 출구 (outlet)의 섬유성 고리 (fibrous ring)에 부착된 3개의 콜라겐성 소엽 (collagenous leaflets)으로 이루어져 있으며, 3개 층 모두 판막간질세포 (valve interstitial cells)로 이루어지고, 전체적으로는 판막내피세포 (valve endothelial cells)로 덮여있다. 반면, 대동맥과 같은 혈관의 경우 평활근 세포를 주요 세포로 한다. 본 발명자들은 구체적인 실시예를 통해 대동맥판막 협착증 환자로부터 분리된 판막간질세포에서의 PAD 저해제의 석회화 또는 골분화, 섬유화, 및 염증 억제 효과를 확인하였다. 즉, 상기 결과는 PAD 저해제가 퇴행성 판막 질환의 대표적인 병리기전들을 억제하여 퇴행성 판막 질환을 치료할 수 있음을 보여주는 것이다.
본 발명에 있어 상기 “판막 (cardiac valve)”은, 바람직하게는 대동맥판막이다. 판막은 심장 내에 위치하여 피가 역류하는 것을 막고, 일정하게 흘러갈 수 있도록 도와주는 역할을 하는 막으로서, 삼첨판막, 승모판막, 폐동맥판막, 및 대동맥판막으로 구성된다. 이 중 대동맥판막은 좌심실과 대동맥 사이에 위치하는 판막으로 3개의 첨판으로 이루어져 있으며, 삼천판막 혹은 승모판막과 달리 인대나 유두근을 포함하지 않는다. 대동맥판막은 좌심실에서 대동맥으로 흐르는 혈액의 역류를 막는 역할을 한다. 따라서, 대동맥판막의 퇴행성 변화가 발생하는 경우, 대동맥판막이 기능을 정상적으로 수행하지 못해 대동맥의 혈액이 좌심실로 역류할 수 있다.
본 발명에 따른 퇴행성 판막 질환에는 판막의 퇴행성 변화로 인해 유도되는 임상증상 내지 질환이라면 제한 없이 포함되고, 구체적인 종류로 제한되는 것은 아니나, 심장판막질환 (valvular heart disease), 대동맥판막 협착증 (aortic stenosis), 대동맥판막 폐쇄부전증 (aortic insufficiency), 승모판막 협착증 (mitral stenosis), 및 승모판 기능부전 (mitral insufficiency) 등으로부터 선택될 수 있다. 바람직하게는, 상기 퇴행성 판막 질환은 특히 판막 조직의 석회화 또는 골분화, 섬유화, 및/또는 염증 등을 억제함으로써 개선 내지 치료되는 것일 수 있다.
또한, 본 발명에 따른 퇴행성 판막 질환은 특히 MCP1 (monocyte chemoattractant protein-1), CTGF (connective Tissue Growth Factor), COL1A1 (collagen type I alpha 1 chain), COL3A1 (collagen type III alpha 1 chain), α-SMA (α-smooth muscle actin), RUNX2 (runt-related transcription factor 2), 및 BMP6 (bone morphogenetic protein 6)로 이루어진 군에서 선택된 하나 이상의 수준이 증가된 환자의 퇴행성 판막 질환을 의미할 수 있다. 즉, 본 발명에 따른 PAD 억제제는 특히 판막 조직의 석회화 또는 골분화, 섬유화, 및/또는 염증 등의 억제 효과가 우수하므로, MCP1, CTGF, COL1A1, COL3A1, α-SMA, RUNX2, 및 BMP6로 이루어진 군에서 선택된 하나 이상의 수준이 증가된 환자의 퇴행성 판막 질환에 대해 특히 우수한 치료 효과를 보일 수 있다.
본 발명에 있어서, 퇴행성 판막 질환은, 바람직하게는 대동맥판막 협착증 (aortic stenosis)은 대동맥판막이 좌심실이 수축할 때 잘 열리지 않는 질환을 의미한다. 대동맥판막 협착증 환자는 좌심실에서 대동맥으로 혈류가 충분히 나가지 못하므로 흉통, 실신, 호흡 곤란 등을 겪는다. 대동맥판막 협착증의 주요 원인으로는 노화, 판막 석회화 (퇴행), 류마티스, 선천적/구조적 이상, 및 감염성 심내막염 등이 있으나, 본 발명에 있어서 대동맥판막 협착증은 바람직하게는 퇴행성 (degenerative) 대동맥판막 협착증이다. 대동맥판막 협착증은 전신의 혈류의 장애를 유발하므로 이로 인해 심장의 수축력이 과하게 증가하면서 심비대로 이어질 수 있으며, 과도한 심장 수축이 지속되면 오히려 심장 근육의 수축력이 저하되어 심부전 증세가 나타날 수 있다.
본 발명의 조성물 내의 상기 PAD 억제제의 함량은 질환의 증상, 증상의 진행 정도, 환자의 상태 등에 따라서 적절히 조절 가능하며, 예컨대, 전체 조성물 중량을 기준으로 0.0001 내지 99.9중량%, 또는 0.001 내지 50중량%일 수 있으나, 이에 한정되는 것은 아니다. 상기 함량비는 용매를 제거한 건조량을 기준으로 한 값이다.
본 발명에 따른 약학적 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 상기 부형제는 예를 들어, 희석제, 결합제, 붕해제, 활택제, 흡착제, 보습제, 필름-코팅 물질, 및 제어방출첨가제로 이루어진 군으로부터 선택된 하나 이상일 수 있다.
본 발명에 따른 약학적 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 서방형 과립제, 장용과립제, 액제, 점안제, 엘실릭제, 유제, 현탁액제, 주정제, 트로키제, 방향수제, 리모나아데제, 정제, 서방형정제, 장용정제, 설하정, 경질캅셀제, 연질캅셀제, 서방캅셀제, 장용캅셀제, 환제, 틴크제, 연조엑스제, 건조엑스제, 유동엑스제, 주사제, 캡슐제, 관류액, 경고제, 로션제, 파스타제, 분무제, 흡입제, 패취제, 멸균주사용액, 또는에어로졸 등의 외용제 등의 형태로 제형화하여 사용될 수 있으며, 상기 외용제는 크림, 젤, 패치, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제 등의 제형을 가질 수 있다.
본 발명에 따른 약학적 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.
본 발명에 따른 정제, 산제, 과립제, 캡슐제, 환제, 트로키제의 첨가제로 옥수수전분, 감자전분, 밀전분, 유당, 백당, 포도당, 과당, 디-만니톨, 침강탄산칼슘, 합성규산알루미늄, 인산일수소칼슘, 황산칼슘, 염화나트륨, 탄산수소나트륨, 정제 라놀린, 미결정셀룰로오스, 덱스트린, 알긴산나트륨, 메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 카올린, 요소, 콜로이드성실리카겔, 히드록시프로필스타치, 히드록시프로필메칠셀룰로오스(HPMC) 1928, HPMC 2208, HPMC 2906, HPMC 2910, 프로필렌글리콜, 카제인, 젖산칼슘, 프리모젤 등 부형제; 젤라틴, 아라비아고무, 에탄올, 한천가루, 초산프탈산셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스칼슘, 포도당, 정제수, 카제인나트륨, 글리세린, 스테아린산, 카르복시메칠셀룰로오스나트륨, 메칠셀룰로오스나트륨, 메칠셀룰로오스, 미결정셀룰로오스, 덱스트린, 히드록시셀룰로오스, 히드록시프로필스타치, 히드록시메칠셀룰로오스, 정제쉘락, 전분호, 히드록시프로필셀룰로오스, 히드록시프로필메칠셀룰로오스, 폴리비닐알코올, 폴리비닐피롤리돈 등의 결합제가 사용될 수 있으며, 히드록시프로필메칠셀룰로오스, 옥수수전분, 한천가루, 메칠셀룰로오스, 벤토나이트, 히드록시프로필스타치, 카르복시메칠셀룰로오스나트륨, 알긴산나트륨, 카르복시메칠셀룰로오스칼슘, 구연산칼슘, 라우릴황산나트륨, 무수규산, 1-히드록시프로필셀룰로오스, 덱스트란, 이온교환수지, 초산폴리비닐, 포름알데히드처리 카제인 및 젤라틴, 알긴산, 아밀로오스, 구아르고무(Guar gum), 중조, 폴리비닐피롤리돈, 인산칼슘, 겔화전분, 아라비아고무, 아밀로펙틴, 펙틴, 폴리인산나트륨, 에칠셀룰로오스, 백당, 규산마그네슘알루미늄, 디-소르비톨액, 경질무수규산 등 붕해제; 스테아린산칼슘, 스테아린산마그네슘, 스테아린산, 수소화식물유(Hydrogenated vegetable oil), 탈크, 석송자, 카올린, 바셀린, 스테아린산나트륨, 카카오지, 살리실산나트륨, 살리실산마그네슘, 폴리에칠렌글리콜(PEG) 4000, PEG 6000, 유동파라핀, 수소첨가대두유(Lubri wax), 스테아린산알루미늄, 스테아린산아연, 라우릴황산나트륨, 산화마그네슘, 마크로골(Macrogol), 합성규산알루미늄, 무수규산, 고급지방산, 고급알코올, 실리콘유, 파라핀유, 폴리에칠렌글리콜지방산에테르, 전분, 염화나트륨, 초산나트륨, 올레인산나트륨, dl-로이신, 경질무수규산 등의 활택제;가 사용될 수 있다.
본 발명에 따른 액제의 첨가제로는 물, 묽은 염산, 묽은 황산, 구연산나트륨, 모노스테아린산슈크로스류, 폴리옥시에칠렌소르비톨지방산에스텔류(트윈에스텔), 폴리옥시에칠렌모노알킬에텔류, 라놀린에텔류, 라놀린에스텔류, 초산, 염산, 암모니아수, 탄산암모늄, 수산화칼륨, 수산화나트륨, 프롤아민, 폴리비닐피롤리돈, 에칠셀룰로오스, 카르복시메칠셀룰로오스나트륨 등이 사용될 수 있다.
본 발명에 따른 시럽제에는 백당의 용액, 다른 당류 혹은 감미제 등이 사용될 수 있으며, 필요에 따라 방향제, 착색제, 보존제, 안정제, 현탁화제, 유화제, 점조제 등이 사용될 수 있다.
본 발명에 따른 유제에는 정제수가 사용될 수 있으며, 필요에 따라 유화제, 보존제, 안정제, 방향제 등이 사용될 수 있다.
본 발명에 따른 현탁제에는 아카시아, 트라가칸타, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 미결정셀룰로오스, 알긴산나트륨, 히드록시프로필메칠셀룰로오스(HPMC), HPMC 1828, HPMC 2906, HPMC 2910 등 현탁화제가 사용될 수 있으며, 필요에 따라 계면활성제, 보존제, 안정제, 착색제, 방향제가 사용될 수 있다.
본 발명에 따른 주사제에는 주사용 증류수, 0.9% 염화나트륨주사액, 링겔주사액, 덱스트로스주사액, 덱스트로스+염화나트륨주사액, 피이지(PEG), 락테이티드 링겔주사액, 에탄올, 프로필렌글리콜, 비휘발성유-참기름, 면실유, 낙화생유, 콩기름, 옥수수기름, 올레인산에칠, 미리스트산 이소프로필, 안식향산벤젠과 같은 용제; 안식향산나트륨, 살리실산나트륨, 초산나트륨, 요소, 우레탄, 모노에칠아세트아마이드, 부타졸리딘, 프로필렌글리콜, 트윈류, 니정틴산아미드, 헥사민, 디메칠아세트아마이드와 같은 용해보조제; 약산 및 그 염(초산과 초산나트륨), 약염기 및 그 염(암모니아 및 초산암모니움), 유기화합물, 단백질, 알부민, 펩 톤, 검류와 같은 완충제; 염화나트륨과 같은 등장화제; 중아황산나트륨(NaHSO3) 이산화탄소가스, 메타중아황산나트륨(Na2S2O5), 아황산나트륨(Na2SO3), 질소가스(N2), 에칠렌디아민테트라초산과 같은 안정제; 소디움비설파이드 0.1%, 소디움포름알데히드 설폭실레이트, 치오우레아, 에칠렌디아민테트라초산디나트륨, 아세톤소디움비설파이트와 같은 황산화제; 벤질알코올, 클로로부탄올, 염산프로카인, 포도당, 글루콘산칼슘과 같은 무통화제; 시엠시나트륨, 알긴산나트륨, 트윈 80, 모노스테아린산알루미늄과 같은 현탁화제를 포함할 수 있다.
본 발명에 따른 좌제에는 카카오지, 라놀린, 위텝솔, 폴리에틸렌글리콜, 글리세로젤라틴, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 스테아린산과 올레인산의 혼합물, 수바날(Subanal), 면실유, 낙화생유, 야자유, 카카오버터+콜레스테롤, 레시틴, 라네트왁스, 모노스테아린산글리세롤, 트윈 또는 스판, 임하우젠(Imhausen), 모놀렌(모노스테아린산프로필렌글리콜), 글리세린, 아뎁스솔리두스(Adeps solidus), 부티룸 태고-G(Buytyrum Tego-G), 세베스파마 16 (Cebes Pharma 16), 헥사라이드베이스 95, 코토마(Cotomar), 히드록코테 SP, S-70-XXA, S-70-XX75(S-70-XX95), 히드록코테(Hydrokote) 25, 히드록코테 711, 이드로포스탈 (Idropostal), 마사에스트라리움(Massa estrarium, A, AS, B, C, D, E, I, T), 마사-MF, 마수폴, 마수폴-15, 네오수포스탈-엔, 파라마운드-B, 수포시로(OSI, OSIX, A, B, C, D, H, L), 좌제기제 IV 타입 (AB, B, A, BC, BBG, E, BGF, C, D, 299), 수포스탈 (N, Es), 웨코비 (W, R, S, M ,Fs), 테제스터 트리글리세라이드 기제 (TG-95, MA, 57)와 같은 기제가 사용될 수 있다.
경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 추출물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다.
경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.
본 발명에 따른 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서, “약학적으로 유효한 양”은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
본 발명에 따른 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 본 발명이 속하는 기술분야에 통상의 기술자에 의해 용이하게 결정될 수 있다.
본 발명의 약학적 조성물은 개체에게 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구 복용, 피하 주사, 복강 투여, 정맥 주사, 근육 주사, 척수 주위 공간(경막내) 주사, 설하 투여, 볼점막 투여, 직장 내 삽입, 질 내 삽입, 안구 투여, 귀 투여, 비강 투여, 흡입, 입 또는 코를 통한 분무, 피부 투여, 경피 투여 등에 따라 투여될 수 있다.
본 발명의 약학적 조성물은 치료할 질환, 투여 경로, 환자의 연령, 성별, 체중 및 질환의 중등도 등의 여러 관련 인자와 함께 활성성분인 약물의 종류에 따라 결정된다. 구체적으로, 본 발명에 따른 조성물의 유효량은 환자의 나이, 성별, 체중에 따라 달라질 수 있으며, 일반적으로는 체중 1 kg 당 0.001 내지 150 mg, 바람직하게는 0.01 내지 100 mg을 매일 또는 격일 투여하거나 1일 1 내지 3회로 나누어 투여할 수 있다. 그러나 투여 경로, 질환의 중증도, 성별, 체중, 연령 등에 따라서 증감될 수 있으므로 상기 투여량이 어떠한 방법으로도 본 발명의 범위를 한정하는 것은 아니다.
본 발명에서 “개체”란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐 (mouse), 쥐 (rat), 개, 고양이, 말, 및 소 등의 포유류를 의미한다.
본 발명에서 “투여”란 임의의 적절한 방법으로 개체에게 소정의 본 발명의 조성물을 제공하는 것을 의미한다.
본 발명에서 “예방”이란 목적하는 질환의 발병을 억제하거나 지연시키는 모든 행위를 의미하고, “치료”란 본 발명에 따른 약학적 조성물의 투여에 의해 목적하는 질환과 그에 따른 대사 이상 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미하며, “개선”이란 본 발명에 따른 조성물의 투여에 의해 목적하는 질환과 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 모든 행위를 의미한다.
또한, 본 발명은 본 발명에 따른 PAD 억제제를 포함하는 퇴행성 판막 질환의 예방 또는 치료용 키트를 제공한다.
본 발명에 있어서, “키트 (kit)”는 구체적인 형태나 종류에 제한이 없으며, 당업계에서 통상적으로 사용되는 형태의 키트를 사용할 수 있다. 예컨대, 본 발명에 따른 키트는 상기 PAD 억제제 외에도 상기 PAD 억제제의 보관 용액, 투여 도구, 투여용 현탁액 등을 추가로 포함할 수 있으며, 상기 PAD 억제제의 특성 등에 관한 지시서를 추가로 포함할 수 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예 및 실험예를 제시한다. 그러나 하기의 실시예 및 실험예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예 또는 실험예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. PAD 저해제의 사용
PAD 저해제의 판막퇴행성 질환 치료 효과를 확인하기 위해, PAD 저해제의 대표예로서 BB-Cl amidine (BB-Cl) 및 PAD2 siRNA를 사용하였다. PAD2 siRNA의 서열은 하기 표 1에 나타낸 바와 같다.
명칭 서열 서열번호
PAD2 siRNA_1 Sense GACGTATCTTGAACTGCCATT 1
Antisense TGGCAGTTCAAGATACGTCTA 2
PAD2 siRNA_2 Sense CGTTCTTCGGCCAACGCTATT 3
Antisense TAGCGTTGGCCGAAGAACGGG 4
PAD2 siRNA_3 Sense CGGCGTTGGGCTCTGCAAATT 5
Antisense TTTGCAGAGCCCAACGCCGTG 6
PAD2 siRNA_4 Sense AGGTCACCGTCAACTACTATT 7
Antisense TAGTAGTTGACGGTGACCTTG 8
상기 PAD2 siRNA의 PAD 발현 억제 효과를 확인하기 위해 대동맥판막 협착증 환자의 판막 조직으로부터 분리된 세포에 상기 PAD2 siRNA (PAD2 siRNA_2 또는 PAD2 siRNA_3)를 처리한 후 PAD2 단백질에 대한 웨스턴 블롯을 수행하였다. 도 1a 및 1b에 나타낸 바와 같이, 상기 siRNA에 의해 PAD2의 단백질 발현이 유의하게 감소한 것을 확인할 수 있었다.
실시예 2. 인간 대동맥판막 조직의 확보
대동맥판막 협착증 (aortic stenosis, AS)이 있는 환자의 대동맥판막 조직은 대동맥판막 교체술이 이루어질 때 수득하였다. 본 발명의 실시예는 헬싱키 선언 (Declaration of Helsinki)을 준수하였으며, 서울아산병원 임상연구심의위원회 (Institutional Review Board, IRB)가 인체 시료 수득을 위한 연구 프로토콜을 승인하였고, 모든 환자로부터 서면 동의를 얻었다.
실시예 3. 일차 대동맥판막 간질세포 (primary aortic valve interstitial cells)의 분리
실시예 2에서 확보된 인간 대동맥판막의 한 개 엽 (leaflet)을 4 내지 5 조각으로 절단한 후 콜라겐분해효소 (collagenase)와 37℃에서 30분간 반응시켜 대동맥판막 내피세포 (endothelial cells)를 제거하였다. 이어서, 조직을 더 작은 조각으로 세절하여 37℃에서 1.5시간 동안 추가 반응시켜 대동맥판막 간질세포 (aortic valve interstitial cells, AVICs)를 수득하였다. 단리된 인간 AVIC은 1% 항세균-항진균제 및 10% FBS가 함유된 DMEM/F12에서 배양하였다. 패시지 (passages)가 2 내지 5인 세포만을 웨스턴 블롯 등의 실험에 사용하였다.
실시예 4. 세포내 siRNA 도입
실시예 3에서 수득하여 배양한 대동맥판막 간질세포를 실험 전 1시간 동안 혈청과 항생제가 없는 배지에 노출시키고, 이 후 Lipofectamin 3000과 siRNA의 complex를 세포에 처치하였다. 6시간 후 항생제 없이 혈청만 포함되어 있는 배지로 교체하였고, 24시간 후 항생제와 혈청이 모두 포함되어 있는 배지로 교체하여 추가로 24시간 배양 후 다음 실험에 사용하였다.
실시예 5. 웨스턴 블롯 (Western blot)
수득한 대동맥판막 간질세포를 단백질분해효소 억제제와 혼합한 1X RIPA 용액으로 균질화 (homogenization)한 후, 용해물을 SDS-PAGE 젤에 로딩 (loading)하였다. 분리된 단백질은 PVDF 막에 트랜스퍼 (transfer) 하였으며, 이어서 PVDF 막을 상온에서 5% BSA로 1시간 동안 블로킹하였다. 이어서 PAD2 단백질 항체 (proteintech, 12110-1-AP, 1:000 비율 희석) 및 HRP-결합 항-토끼 IgG 항체를 사용하여 검출하였다.
실시예 6. 역전사 중합효소 연쇄반응 (Reverse transcription PCR) 및 실시간 중합효소 연쇄반응 (Real time PCR)
수득하여 배양한 대동맥판막 간질세포를 TRIzol 용액으로 균질화한 후, 용해물에서 mRNA를 분리하였다. 분리된 mRNA와 random hexamer, dNTP, RNAse inhibitor, 역전사 중합효소 (Reverse transcriptase)를 혼합하고 37℃에서 1시간 반응시켜 AVICs cDNA를 제작하였다. 만들어진 cDNA를 주형으로 석회화 마커 (BMP6, Runx2, COL1a1), 염증 마커 (MCP1, IL6), 섬유화 마커 (CTGF, α-SMA, COL3a1) 유전자들의 primer로 PCR을 수행하였으며 이 때, 형광 값으로 발현양을 측정할 수 있는 SYBR을 사용하여 각 유전자들의 발현양의 변화를 측정하였다.
[실험예]
실험예 1. PAD 저해제의 석회화 억제 효과 확인
석회화 (calcification)는 칼슘이 침착되는 상태를 의미하는데, 대동맥판막에 칼슘이 침착되면 판막이 두꺼워지고 딱딱해지면서 대동맥판막 협착증이 유발된다. 이에, PAD 저해제 처리에 따른 석회화 마커 수준의 변화를 측정하여 PAD 저해제가 대동맥판막 협착증의 대표적 병리기전인 석회화를 개선할 수 있는지 확인하였다. 이를 위하여 PAD 저해제로 화합물 BB-Cl, 및 siRNA를 각각 처리하여 실험을 수행하였다.
먼저, 대동맥판막 협착증 환자로부터 분리된 판막간질세포에 PAD 저해제 중 화합물인 BB-Cl을 1 μM, 3 μM, 또는 5 μM 농도로 처리하고, 24시간 또는 48시간 후에 석회화 마커들의 발현 수준을 확인하였다.
그 결과, 도 2a에 나타낸 바와 같이, 미처리 대조군에 비해 BB-Cl을 처리한 그룹에서 BMP6 및 COL1A1의 수준이 감소하였으며, 특히 PAD 저해제가 3 μM 이상의 농도로 처리된 그룹은 대조군에 비해 석회화 마커 수준이 절반 이하의 수준으로 감소한 것을 확인할 수 있었다. 이는 PAD 저해제가 판막 조직의 석회화를 개선할 수 있음을 보여준다.
또한, 동일한 판막간질세포에 PAD 타겟 siRNA를 48시간 동안 처리한 후 판막 석회화 마커 RUNX2 및 COL1A1의 발현 수준을 확인하였다.
그 결과, 도 2b에 나타낸 바와 같이, 미처리 대조군 대비 PAD 억제제가 처리된 그룹에서 석회화 마커들의 발현이 유의하게 감소하하는 것으로 확인되었다.
상기 결과는 앞선 결과와 마찬가지로 PAD 저해제가 대동맥판막에서 판막 질환의 대표적 병리기전인 석회화를 효과적으로 억제할 수 있으며, 이를 통해 다양한 판막 질환을 개선할 수 있음을 보여준다. 또한, 석회화는 대동맥판막 조직을 구성하고 있는 세포층이 골세포화 되는 과정인 골분화 (osteogenic differentiation) 등에 의해 유도될 수 있다. 따라서, 상기 결과는 본 발명의 PAD 저해제가 골분화 억제 효과도 발휘할 수 있음을 시사한다.
실험예 2. PAD 저해제의 염증 억제 효과 확인
대동맥판막 협착증은 조직의 섬유화, 석회화, 및 염증이 복합적으로 축적되어 발생한다. 이에, 본 발명의 PAD 저해제가 대동맥판막 조직에서 항염 효과를 발휘하는지 확인하기 위해, 대동맥판막 협착증 환자로부터 분리된 판막 조직 세포에 본 발명의 PAD 저해제를 처리한 후 염증 인자의 수준에 변화가 있는지 확인하였다. 이 때, PAD 저해제로 화합물 BB-Cl, 및 siRNA를 각각 처리하여 실험을 수행하였다.
먼저, 도 3a에 나타낸 바와 같이, 미처리 대조군에 비해 PAD 저해제 화합물 BB-Cl를 처리한 그룹에서 염증 마커인 MCP1의 수준이 확연히 감소하였으며, PAD 저해제가 3 μM 이상의 농도로 처리된 그룹은 대조군에 비해 염증 마커 수준이 절반 이상 감소한 것으로 나타났다. 즉, 상기 결과는 본 발명의 PAD 억제제가 항염 효과가 있음을 의미한다. 나아가, MCP1은 면역세포를 유도하는 케모카인으로서, 면역세포의 조직 침윤을 유도하는 기능을 수행한다. 따라서, PAD 억제제에 의한 MCP1 억제 효과는 상기 PAD 억제제가 면역세포의 조직 침윤 또한 감소시킬 수 있음을 시사한다.
또한, 실시예 1에 제시된 PAD2 siRNA를 처리한 그룹에서도 미처리 대조군 대비 염증 마커 (MCP1 및 IL-6)의 수준이 유의하게 감소하였다 (도 3b). 상기 결과는 PAD 저해제가 대동맥판막 조직의 염증을 억제하여 대동맥판막 협착증을 포함한 판막퇴행성 질환을 개선 내지 치료할 수 있음을 시사한다.
실험예 3. PAD 저해제의 섬유화 억제 효과 확인
섬유화 (fibrosis)는 대동맥판막 협착증의 대표적인 증상 중 하나로, 장기 내 섬유질 결합조직이 과도하게 형성되면서 장기의 일부가 단단하게 굳는 현상을 지칭한다. 대동맥판막협착증 환자 중 심장 근육 섬유화를 가진 환자는 예후가 더욱 안 좋은 것으로 알려져 있다. 따라서, PAD 억제제가 판막조직 세포의 섬유화를 억제할 수 있는지 확인하였다. 이 때, PAD 저해제로 화합물 BB-Cl, 및 siRNA를 각각 처리하여 실험을 수행하였다.
구체적으로, 대동맥판막 협착증 환자로부터 분리된 판막세포에 1 μM, 3 μM, 또는 5 μM의 PAD 저해제 화합물 BB-Cl을 24시간 또는 72시간 동안 처리한 후, 판막 섬유화 마커인 CTGF, COL3A1, α-SMA의 발현 수준을 확인하였다.
그 결과, 본 발명의 PAD 저해제가 처리된 판막조직 판막세포는 미처리 대조군에 비해 섬유화 마커들의 수준이 모두 감소하였으며, 이와 같은 경향은 PAD 저해제의 처리 농도에 의존적이었다 (도 4a). 특히, PAD 저해제를 5 μM의 농도로 처리한 그룹은 모든 섬유화 마커의 수준이 10 % 이하의 수준으로 감소한 것으로 나타났다.
또한, PAD2 타겟 siRNA를 처리한 후 섬유화 마커의 수준을 확인하였다. 그 결과, 앞선 결과와 마찬가지로, 미처리 대조군에 비해 PAD2 타겟 siRNA를 처리한 그룹에서 섬유화 마커인 CTGF 및 α-SMA의 수준이 유의하게 감소하였다 (도 4b). 상기 결과들은 PAD 저해제가 PAD 억제를 통해 판막의 석회화 또는 골분화뿐만 아니라 섬유화도 효과적으로 억제하여 대동맥판막 협착증의 증상 및 예후를 개선할 수 있음을 보여준다.
대동맥판막 협착증은 석회화 또는 골분화, 섬유화, 및 염증을 주요 임상증상으로 하는 질환으로서, 이를 치료하기 위해서는 대동맥판막조직의 석회화, 섬유화, 및 염증을 모두 개선할 수 있어야 한다. 본 발명자들은 구체적인 실시예를 통해, PAD 억제제가 그 종류의 관계없이 PAD의 발현 또는 활성을 억제함으로써 대동맥판막 협착증 환자 유래 세포에서 석회화 또는 골분화, 섬유화, 및 염증을 억제할 수 있음을 확인하였다. 따라서 본 발명에 따른 PAD 억제제는 대동맥판막 조직에서 주요 병리기전인 석회화 또는 골분화, 섬유화, 및 염증을 억제함으로써 대동맥판막 협착증을 비롯한 다양한 퇴행성 판막 질환의 치료제, 예후 개선용 제제로 활용될 것으로 기대된다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야 한다.
본 발명은 대동맥판막 협착증을 비롯한 퇴행성 판막 질환의 예방 내지 치료를 위한 약학적 조성물에 관한 것으로서, 대동맥판막 환자 유래 판막세포에서 PAD (protein-arginine deiminase) 단백질을 억제하였을 때 석회화 또는 골분화, 섬유화, 염증 등이 효과적으로 억제되는 것을 확인하여 완성된 것이다. 즉, 본 발명은 퇴행성 판막 질환의 주요 병리기전인 판막 조직의 석회화 또는 골분화, 섬유화, 및 염증을 동시에 억제하므로 퇴행성 판막 질환의 근본적인 치료 또는 진행의 예방이 가능하면서도 예후를 개선할 수 있는 바, 판막의 퇴행성 변형으로 유발되는 다양한 질환의 치료제로 활용 가능할 것으로 기대된다.

Claims (13)

  1. PAD (protein-arginine deiminase) 저해제를 유효성분으로 포함하는, 퇴행성 판막 질환의 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서,
    상기 저해제는 PAD 단백질의 활성 억제제 또는 PAD 유전자의 발현 억제제인 것을 특징으로 하는, 퇴행성 판막 질환의 예방 또는 치료용 약학적 조성물.
  3. 제2항에 있어서,
    상기 활성 억제제는 PAD 단백질에 특이적으로 결합하는 화합물 또는 이의 약학적으로 허용 가능한 염, 펩티드, 펩티드모방체, 기질유사체, 앱타머, 및 항체로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는, 퇴행성 판막 질환의 예방 또는 치료용 약학적 조성물.
  4. 제2항에 있어서,
    상기 발현 억제제는 PAD 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 안티센스 올리고뉴클레오티드, 작은 간섭 RNA (siRNA), 짧은 헤어핀 RNA (shRNA), 마이크로RNA (miRNA), 및 RNA 간섭 (RNAi) 분자로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는, 퇴행성 판막 질환의 예방 또는 치료용 약학적 조성물.
  5. 제4항에 있어서,
    상기 siRNA는 서열번호 1 내지 8로 이루어진 군에서 선택된 하나 이상의 염기 서열을 포함하는 것인, 퇴행성 판막 질환의 예방 또는 치료용 약학적 조성물.
  6. 제1항에 있어서,
    상기 판막은 대동맥판막인 것을 특징으로 하는, 퇴행성 판막 질환의 예방 또는 치료용 약학적 조성물.
  7. 제1항에 있어서,
    상기 퇴행성 판막 질환은 심장판막질환 (valvular heart disease), 대동맥판막 협착증 (aortic stenosis), 대동맥판막 폐쇄부전증 (aortic insufficiency), 승모판막 협착증 (mitral stenosis), 및 승모판 기능부전 (mitral insufficiency)으로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는, 퇴행성 판막 질환의 예방 또는 치료용 약학적 조성물.
  8. 제1항에 있어서,
    상기 조성물은 하기로 이루어진 군에서 선택된 하나 이상의 특징을 만족하는 것인, 퇴행성 판막 질환의 예방 또는 치료용 약학적 조성물:
    (a) 판막 조직의 석회화 또는 골분화를 억제함;
    (b) 판막 조직의 섬유화를 억제함; 및
    (c) 판막 조직의 염증을 억제함.
  9. 제1항에 있어서,
    상기 조성물은 MCP1, CTGF, COL1A1, COL3A1, α-SMA, RUNX2, 및 BMP6로 이루어진 군에서 선택된 하나 이상의 수준이 증가된 환자의 퇴행성 판막 질환을 치료하기 위한 것인, 퇴행성 판막 질환의 예방 또는 치료용 약학적 조성물.
  10. 제1항 내지 제9항 중 어느 한 항의 약학적 조성물을 포함하는, 퇴행성 판막 질환의 예방 또는 치료용 키트.
  11. PAD (protein-arginine deiminase) 저해제를 이를 필요로 하는 개체에게 투여하는 단계를 포함하는, 퇴행성 판막 질환의 예방 또는 치료방법.
  12. PAD (protein-arginine deiminase) 저해제의 퇴행성 판막 질환의 예방 또는 치료 용도.
  13. 퇴행성 판막 질환 치료용 약제의 제조를 위한 PAD (protein-arginine deiminase) 저해제의 용도.
PCT/KR2023/011582 2022-08-08 2023-08-07 Pad 저해제를 포함하는 퇴행성 판막 질환의 예방 또는 치료용 조성물 Ceased WO2024035035A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020220098653A KR20240020754A (ko) 2022-08-08 2022-08-08 Pad 저해제를 포함하는 퇴행성 판막 질환의 예방 또는 치료용 조성물
KR10-2022-0098653 2022-08-08

Publications (1)

Publication Number Publication Date
WO2024035035A1 true WO2024035035A1 (ko) 2024-02-15

Family

ID=89852039

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/011582 Ceased WO2024035035A1 (ko) 2022-08-08 2023-08-07 Pad 저해제를 포함하는 퇴행성 판막 질환의 예방 또는 치료용 조성물

Country Status (2)

Country Link
KR (1) KR20240020754A (ko)
WO (1) WO2024035035A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180136232A1 (en) * 2010-11-12 2018-05-17 Cedars-Sinai Medical Center Citrullinated proteins: a post-translated modification of myocardial proteins as marker of physiological and pathological disease
WO2018178935A1 (en) * 2017-03-29 2018-10-04 Universita' Degli Studi Di Torino Pad2 for use in preventing and/or treating or diagnosing infections caused by viruses of the herpesviridae family

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106420688B (zh) 2016-10-08 2017-11-10 西北大学 Idhp制备预防和治疗冠状动脉粥样硬化疾病药物的应用

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180136232A1 (en) * 2010-11-12 2018-05-17 Cedars-Sinai Medical Center Citrullinated proteins: a post-translated modification of myocardial proteins as marker of physiological and pathological disease
WO2018178935A1 (en) * 2017-03-29 2018-10-04 Universita' Degli Studi Di Torino Pad2 for use in preventing and/or treating or diagnosing infections caused by viruses of the herpesviridae family

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DÖRING YVONNE, LIBBY PETER, SOEHNLEIN OLIVER: "Neutrophil Extracellular Traps Participate in Cardiovascular Diseases : Recent Experimental and Clinical Insights", CIRCULATION RESEARCH, vol. 126, no. 9, 24 April 2020 (2020-04-24), US , pages 1228 - 1241, XP093140084, ISSN: 0009-7330, DOI: 10.1161/CIRCRESAHA.120.315931 *
KNIGHT JASON S., LUO WEI, O’DELL ALEXANDER A., YALAVARTHI SRILAKSHMI, ZHAO WENPU, SUBRAMANIAN VENKATARAMAN, GUO CHIAO, GRENN ROBER: "Peptidylarginine Deiminase Inhibition Reduces Vascular Damage and Modulates Innate Immune Responses in Murine Models of Atherosclerosis", CIRCULATION RESEARCH, vol. 114, no. 6, 14 March 2014 (2014-03-14), US , pages 947 - 956, XP093140063, ISSN: 0009-7330, DOI: 10.1161/CIRCRESAHA.114.303312 *
LING SHUANG, XU JIN-WEN: "NETosis as a Pathogenic Factor for Heart Failure", OXIDATIVE MEDICINE AND CELLULAR LONGEVITY, vol. 2021, 23 February 2021 (2021-02-23), US , pages 1 - 24, XP093140101, ISSN: 1942-0900, DOI: 10.1155/2021/6687096 *

Also Published As

Publication number Publication date
KR20240020754A (ko) 2024-02-16

Similar Documents

Publication Publication Date Title
EP2043631A2 (en) New indications for direct thrombin inhibitors in the cardiovascular field
CN101184495B (zh) 用于预防或降低患者中的不良作用的方法、组合物和制剂
WO2024177353A1 (ko) 락토바실러스 속 세균 유래 소포를 포함하는 대사질환, 섬유증 질환, 또는 근육질환 예방 또는 치료용 조성물
WO2024035035A1 (ko) Pad 저해제를 포함하는 퇴행성 판막 질환의 예방 또는 치료용 조성물
WO2019103523A2 (ko) 티모신 베타 4 또는 이의 유도체를 유효성분으로 포함하는 술잔세포 증식 또는 뮤신 분비 촉진용 조성물
WO2022158639A1 (ko) 베타아밀로이드 및 타우 단백질 집적과 연관된 질환 치료용 약학적 조성물
WO2019078663A2 (ko) 아연염, 시클로-히스프로 및 항당뇨 약물을 유효성분으로 함유하는 당뇨병 예방 또는 치료용 약학적 조성물
US20240091214A1 (en) Lonafarnib for use in the treatment of viral infections
WO2018155921A1 (ko) 고시폴 및 펜포르민을 유효성분으로 포함하는 췌장암 예방 및 치료용 약학적 조성물
US20080300182A1 (en) Eye disease treating agent and method for treating eye disease
WO2020116742A1 (ko) 중추신경계 질환, 당뇨병 및 이의 합병증의 예방 및 치료를 위한 벤즈이미다졸 또는 벤족사졸 유도체
ZA200106199B (en) Utilization of polycyclic 2-amino-thiazole systems in the production of medicaments for prophylaxis or treatment of obesity.
WO2023101441A1 (ko) 마이크로조말 트리글리세라이드 전달 단백질 억제제의 섬유화 질환 치료 용도
WO2017010382A1 (ja) 筋強直性ジストロフィー治療薬
WO2023219361A1 (ko) 티오우레아 유도체를 포함하는 섬유화 질환의 예방 또는 치료용 조성물
TWI650125B (zh) 用於延緩肺纖維化之發病及／或治療肺纖維化之藥劑
WO2022265382A1 (ko) 1-(3-시아노-1-아이소프로필-인돌-5-일)피라졸-4-카르복실산을 포함하는 약학적 조성물
WO2011007866A1 (ja) 筋強直性ジストロフィー治療薬
CN115974719B (zh) 化合物、包括所述化合物的药物组合物及其用途
KR102567012B1 (ko) 피라졸 유도체의 폐섬유증 치료제
WO2021162525A1 (ko) 히드록시유레아를 포함하는 염증 반응 억제용 약학 조성물
KR102655168B1 (ko) 스핑고실포스포릴콜린 및 핑고리모드의 병용투여용 조성물 및 이를 이용한 관절염 예방, 개선, 또는 치료방법
WO2025053518A1 (ko) 메틱센 또는 이의 약제학적으로 허용 가능한 염을 포함하는 신장 질환의 치료용 조성물
WO2022177180A1 (ko) Lif(leukemia inhibitory factor)를 유효성분으로 포함하는 심혈관 질환의 예방 또는 치료용 약학적 조성물
KR102634754B1 (ko) 이마티닙을 포함하는 근육 질환의 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23852914

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 23852914

Country of ref document: EP

Kind code of ref document: A1