WO2023274385A1 - Lymphocyte car-t universel ciblant her2 et son procédé de préparation - Google Patents

Lymphocyte car-t universel ciblant her2 et son procédé de préparation Download PDF

Info

Publication number
WO2023274385A1
WO2023274385A1 PCT/CN2022/103085 CN2022103085W WO2023274385A1 WO 2023274385 A1 WO2023274385 A1 WO 2023274385A1 CN 2022103085 W CN2022103085 W CN 2022103085W WO 2023274385 A1 WO2023274385 A1 WO 2023274385A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
hla
seq
gene
antigen receptor
Prior art date
Application number
PCT/CN2022/103085
Other languages
English (en)
Chinese (zh)
Inventor
尚小云
王丹
李甲璐
蒋海娟
马少文
沈慧
徐凡丽
Original Assignee
宁波茂行生物医药科技有限公司
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 宁波茂行生物医药科技有限公司 filed Critical 宁波茂行生物医药科技有限公司
Priority to CN202280046731.2A priority Critical patent/CN117642510A/zh
Publication of WO2023274385A1 publication Critical patent/WO2023274385A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/463—Cellular immunotherapy characterised by recombinant expression
    • A61K39/4631—Chimeric Antigen Receptors [CAR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4611—T-cells, e.g. tumor infiltrating lymphocytes [TIL], lymphokine-activated killer cells [LAK] or regulatory T cells [Treg]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464402—Receptors, cell surface antigens or cell surface determinants
    • A61K39/464403—Receptors for growth factors
    • A61K39/464406—Her-2/neu/ErbB2, Her-3/ErbB3 or Her 4/ ErbB4
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464402—Receptors, cell surface antigens or cell surface determinants
    • A61K39/464411—Immunoglobulin superfamily
    • A61K39/464412—CD19 or B4
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C12N15/867—Retroviral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/31—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterized by the route of administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/38—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the dose, timing or administration schedule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the cancer treated
    • A61K2239/49—Breast
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Definitions

  • This application relates to the field of biomedicine, in particular to a general-purpose CAR-T cell targeting HER2 and its preparation method and application.
  • CAR-T cell technology is a cell-based therapy that has produced excellent results in tumor immunotherapy, especially in the treatment of blood tumors.
  • CAR-T immunotherapy uses genetically modified T cells that can specifically recognize and kill tumor cells expressing specific antigens without being restricted by MHC.
  • CAR-T immunotherapy has achieved good results in the treatment of various B cell malignancies, such as CAR-T cells targeting CD19 in the treatment of acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL) and non-Hodgkin's lymphoma ( NHL).
  • ALL acute lymphoblastic leukemia
  • CLL chronic lymphocytic leukemia
  • NHL non-Hodgkin's lymphoma
  • the HER2 receptor is a transmembrane glycoprotein with tyrosine kinase activity and belongs to the family of EGFR receptors, which are essential for the control of epithelial cell growth and differentiation.
  • overexpression of the HER2 protein has been associated with several adenocarcinomas, such as breast, ovarian, endometrial, and cervical cancers, as well as cancers of the lung, esophagus, gastroesophageal junction, stomach, and bladder.
  • HER2 protein is strongly associated with increased disease relapse and is a poor prognostic factor for survival. Therefore, HER2 is an important prognostic target for the treatment of various cancers.
  • CAR-T adoptive reinfusion of CAR-T immune cell therapy is a novel and effective method for the treatment of tumors, which has been applied in many clinical trials.
  • CAR-T can specifically recognize the target molecule HER2 and kill tumor cells expressing HER2.
  • CAR-T cells targeting HER2 successfully treated glioblastoma and osteosarcoma.
  • the patient's autologous T cells are difficult to expand in vitro or their functions are reduced, resulting in insufficient quantity or poor quality of the prepared CAR-T cell products.
  • Universal CAR-T cells are T cells isolated from healthy donors. The prepared CAR-T cells not only have high expansion efficiency and strong vitality, but also have an increased infection positive rate. However, universal CAR-T also faces graft resistance. Problems with host disease (GVHD) and immune rejection.
  • GVHD host disease
  • the purpose of the present invention is to prepare a universal CAR-T cell targeting HER2, which recognizes tumor cell surface antigens and at the same time knocks out the TCR and HLA-A genes expressed by the cells, thereby reducing the immune rejection caused by allogeneic CAR-T therapy Response, prolong cell survival time, improve anti-tumor effect.
  • One of the purposes of the present application is to provide a chimeric antigen receptor targeting HER2.
  • the details are as follows: the anti-HER2 scFv is used as the targeting part, and is connected to the intracellular signal transduction domain through the hinge region and transmembrane region of the CD8 molecule. Composition of the signal domain.
  • Another purpose of the present application is to provide a UCAR-T cell with higher safety.
  • the source of the donor is based on the HLA-B homozygote in the population.
  • One of the alleles of the patient’s HLA-B is consistent with the homozygote of the donor. Cells from these donors can cover a high proportion of the patient population. Reduce the rejection caused by HLA-B.
  • HLA-B mainly selects B*40 homozygote, B*15 homozygote, B*46 homozygote, B*13 homozygote, B*51 homozygote, B*58 homozygote, B*07 homozygote with high frequency in the population Homozygote, B*35 homozygote, B*44 homozygote, B*52 homozygote, B*57 homozygote, B*54 homozygote, B*55 homozygote.
  • the knockout strategy targets HLA-A molecules that are highly related to TRAC and rejection, while retaining other HLA-I molecules, which not only reduces the rejection of allogeneic cells, but also avoids the complete knockout of HLA molecules being cleared by NK cells
  • the occurrence of allogeneic CAR-T cells greatly prolongs the half-life of allogeneic CAR-T cells in vivo. Simultaneously reduced GVHD response induced by allogeneic cell therapy.
  • TCR gene selects gene TRAC encoding TCR ⁇ chain
  • HLA-A selects A*02 homozygote, A*11 homozygote, A*02/A11 heterozygote and A*24 homozygote with high frequency in the population.
  • the transfection methods of CRISPR/Cas9 gene editing mainly include plasmid method, mRNA method and RNP method.
  • the RNP method refers to the assembly of spcas9 ribonucleoprotein (RNP) and sgRNA into an RNP complex in vitro, and the complex is introduced into cells by electroporation. Compared with the other two methods, it has the advantages of fast degradation of spCas9 protein and low off-target risk, and is very The electrotransfer efficiency is greatly improved, thereby improving the editing efficiency of the target gene.
  • the double knockout efficiency can reach more than 90%.
  • Another object of the present application is to provide a method for preparing universal CAR-T cells targeting HER2.
  • the chimeric antigen receptor comprises a targeting moiety comprising HCDR3 comprising the amino acid sequence shown in SEQ ID NO:8.
  • the targeting moiety comprises HCDR2 comprising the amino acid sequence shown in SEQ ID NO:6.
  • the targeting moiety comprises HCDR1 comprising the amino acid sequence shown in SEQ ID NO:4.
  • the targeting moiety comprises HCDR1, HCDR2 and HCDR3 in the heavy chain variable region set forth in SEQ ID NO: 1.
  • the targeting moiety comprises HCDR1, HCDR2, HCDR3, the HCDR3 comprises the amino acid sequence shown in SEQ ID NO:8; the HCDR2 comprises the amino acid sequence shown in SEQ ID NO:6; and the HCDR1 comprises the amino acid sequence shown in SEQ ID NO:4.
  • the targeting moiety comprises H-FR1
  • the C-terminus of the H-FR1 is directly or indirectly connected to the N-terminus of the HCDR1
  • the H-FR1 comprises SEQ ID NO:3 Amino acid sequence shown.
  • the targeting moiety comprises H-FR2, the H-FR2 is located between the HCDR1 and the HCDR2, and the H-FR2 comprises the amino acid sequence shown in SEQ ID NO:5 .
  • the targeting moiety comprises H-FR3, the H-FR3 is located between the HCDR2 and the HCDR3, and the H-FR3 comprises the amino acid sequence shown in SEQ ID NO:7 .
  • the targeting moiety comprises H-FR4, the N-terminus of the H-FR4 is directly or indirectly connected to the C-terminus of the HCDR3, and the H-FR4 comprises SEQ ID NO:9 Amino acid sequence shown.
  • the targeting moiety comprises H-FR1, H-FR2, H-FR3 and H-FR4, and the H-FR1 comprises the amino acid sequence shown in SEQ ID NO: 3; the H- FR2 comprises the amino acid sequence shown in SEQ ID NO:5; the H-FR3 comprises the amino acid sequence shown in SEQ ID NO:7; and the H-FR4 comprises the amino acid sequence shown in SEQ ID NO:9.
  • the targeting moiety comprises a VH comprising the amino acid sequence shown in SEQ ID NO:1.
  • the chimeric antigen receptor comprises a targeting moiety comprising LCDR3 comprising the amino acid sequence shown in SEQ ID NO: 17.
  • the targeting moiety comprises LCDR2 comprising the amino acid sequence shown in SEQ ID NO: 15.
  • the targeting moiety comprises LCDR1 comprising the amino acid sequence shown in SEQ ID NO: 13.
  • the targeting moiety comprises LCDR1, LCDR2 and LCDR3 in the light chain variable region set forth in SEQ ID NO: 10.
  • the targeting moiety comprises LCDR1, LCDR2, LCDR3, and the LCDR3 comprises the amino acid sequence shown in SEQ ID NO: 17; the LCDR2 comprises the amino acid sequence shown in SEQ ID NO: 15; and the LCDR1 comprises the amino acid sequence shown in SEQ ID NO:13.
  • the targeting moiety comprises L-FR1
  • the C-terminus of the L-FR1 is directly or indirectly linked to the N-terminus of the LCDR1
  • the L-FR1 comprises SEQ ID NO: 12 Amino acid sequence shown.
  • the targeting moiety comprises L-FR2, the L-FR2 is located between the LCDR1 and the LCDR2, and the L-FR2 comprises the amino acid sequence shown in SEQ ID NO:14 .
  • the targeting moiety comprises L-FR3, the L-FR3 is located between the LCDR2 and the LCDR3, and the L-FR3 comprises the amino acid sequence shown in SEQ ID NO:16 .
  • the targeting moiety comprises L-FR4, the N-terminus of the L-FR4 is directly or indirectly connected to the C-terminus of the LCDR3, and the L-FR4 comprises SEQ ID NO: 18 Amino acid sequence shown.
  • the targeting moiety comprises L-FR1, L-FR2, L-FR3 and L-FR4, and the L-FR1 comprises the amino acid sequence shown in SEQ ID NO: 12; the L- FR2 comprises the amino acid sequence shown in SEQ ID NO:14; said L-FR3 comprises the amino acid sequence shown in SEQ ID NO:16; and said L-FR4 comprises the amino acid sequence shown in SEQ ID NO:18.
  • the targeting moiety comprises a VL comprising the amino acid sequence shown in SEQ ID NO: 10.
  • the targeting moiety comprises an antibody or antigen-binding fragment.
  • the antigen-binding fragment is selected from the group consisting of Fab, Fab', F(ab)2, Fv fragment, F(ab')2, scFv, di-scFv, VHH and/or dAb.
  • the targeting moiety comprises a scFv.
  • the scFv targets HER2.
  • the targeting moiety comprises the amino acid sequence shown in any one of SEQ ID NOs: 198-199.
  • the chimeric antigen receptor comprises a transmembrane domain comprising a transmembrane domain derived from a protein selected from the group consisting of: CD8A, CD8B, CD28, CD3e, CD3 ⁇ , 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3 ⁇ , CTLA-4, LAG-3, CD5, ICOS, OX40, NKG2D, 2B4, CD244, Fc ⁇ RI ⁇ , BTLA, CD30, GITR, HVEM , DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L, CD154, TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, and SLAM.
  • a protein selected from the group consisting of: CD8A, CD8B, CD28, CD3e, CD3 ⁇ , 4-1BB, CD4, CD27, CD7, PD-1, TRAC
  • said transmembrane domain of said chimeric antigen receptor comprises a transmembrane domain derived from CD8A or CD8B.
  • the transmembrane domain of the chimeric antigen receptor comprises the amino acid sequence shown in any one of SEQ ID NO:21 to SEQ ID NO:69.
  • the chimeric antigen receptor comprises a co-stimulatory signaling domain comprising a co-stimulatory signaling domain derived from a protein selected from the group consisting of: CD28, 4-1BB, CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4, Fc ⁇ RI ⁇ , BTLA, GITR, HVEM, DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD-1, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD40, and MyD88.
  • a protein selected from the group consisting of: CD28, 4-1BB, CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4, F
  • the co-stimulatory signaling domain in the chimeric antigen receptor comprises a co-stimulatory signaling domain derived from 4-1BB.
  • the co-stimulatory signaling domain in the chimeric antigen receptor comprises the amino acid sequence shown in any one of SEQ ID NO:70 to SEQ ID NO:102.
  • the N-terminal of the co-stimulatory signaling domain in the chimeric antigen receptor is directly or indirectly linked to the C-terminal of the transmembrane domain.
  • the chimeric antigen receptor comprises an intracellular signal transduction domain comprising an intracellular signal transduction domain derived from a protein selected from or Combinations thereof: CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14 Nef, DAP10, DAP-12 and at least An ITAM domain.
  • EBV Epstein-Bar
  • the intracellular signaling domain of the chimeric antigen receptor comprises an intracellular signaling domain derived from CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , or CD3 ⁇ .
  • the intracellular signal transduction domain in the chimeric antigen receptor comprises SEQ ID NO:86, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:103 to The amino acid sequence shown in any one of SEQ ID NO:113.
  • the N-terminus of the intracellular signal transduction domain in the chimeric antigen receptor is directly or indirectly linked to the C-terminus of the co-stimulatory signal transduction domain.
  • the chimeric antigen receptor includes a hinge region between the targeting moiety and the transmembrane domain, the hinge region comprising a hinge region derived from a protein selected from the group consisting of: CD28, IgG1, IgG4, IgD, 4-1BB, CD4, CD27, CD7, CD8, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
  • a protein selected from the group consisting of: CD28, IgG1, IgG4, IgD, 4-1BB, CD4, CD27, CD7, CD8, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
  • the hinge region comprises a hinge region derived from CD8.
  • the hinge region comprises the amino acid sequence shown in any one of SEQ ID NO: 114 to SEQ ID NO: 135.
  • the non-targeting portion of the chimeric antigen receptor comprises the transmembrane domain of CD8A, the hinge region of CD8, the intracellular co-stimulatory signaling domain of 4-1BB, and the intracellular signaling domain of CD3 ⁇ domain.
  • the non-targeting portion comprises the amino acid sequence shown in SEQ ID NO:19.
  • the chimeric antigen receptor comprises the amino acid sequence shown in SEQ ID NO:200.
  • the present application provides one or more isolated nucleic acid molecules encoding said chimeric antigen receptor.
  • the present application provides one or more vectors comprising said isolated nucleic acid molecule.
  • the vector comprises a viral vector.
  • the vector comprises a lentiviral vector.
  • the present application provides one or more immune cells comprising and/or expressing said isolated nucleic acid molecule or said vector, and/or said chimeric antigen receptor.
  • the immune cells are of human origin.
  • the immune cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, ⁇ T cells, monocytes, dendritic cells, granulocytes, lymphocytes cells, leukocytes, and/or peripheral blood mononuclear cells.
  • NK cells natural killer cells
  • macrophages include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, ⁇ T cells, monocytes, dendritic cells, granulocytes, lymphocytes cells, leukocytes, and/or peripheral blood mononuclear cells.
  • the immune cells include T cells.
  • the immune cells include modified immune cells.
  • the modified immune cells include cells that reduce immune rejection from allogeneic cell therapy.
  • TCR T cell antigen receptor
  • MHCI major histocompatibility complex
  • the modification in the immune cells includes down-regulation of the expression and/or activity of one or more genes related to immune rejection.
  • the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
  • the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune cells compared with the unmodified corresponding cells in the immune cells.
  • the expression and/or activity of the CIITA gene is not down-regulated in the modified immune cells compared to the corresponding cells without the modification.
  • the expression and/or activity of the B2M gene is not down-regulated in the modified immune cells compared to the corresponding cells without the modification.
  • the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune cells compared with the corresponding wild-type cells.
  • the expression and/or activity of the B2M gene is not down-regulated in the modified immune cells compared to the corresponding wild-type cells.
  • the expression and/or activity of the CIITA gene is not down-regulated in the modified immune cells compared to the corresponding wild-type cells.
  • down-regulating the expression level and/or activity of the gene comprises down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulating the expression and/or activity of a protein product encoded by the gene. / or the activity is downregulated.
  • the modification includes: gene knockout, gene mutation and/or gene silencing.
  • said modification comprises administering to said immune cells one or more agents selected from the group consisting of antisense RNA, siRNA, shRNA and sgRNA.
  • the modification further comprises administering to the immune cells a sgRNA targeting an exon portion of the TRAC gene.
  • the sgRNA targeting the exon portion of the TRAC gene comprises the nucleotide sequence shown in any one of SEQ ID NO:138 to SEQ ID NO:152.
  • the modification comprises administering to the immune cells a sgRNA targeting an exon portion of the HLA-A gene.
  • the sgRNA targeting the exon portion of the HLA-A gene comprises the nucleotide sequence shown in any one of SEQ ID NO:153 to SEQ ID NO:193.
  • said modifying further comprises administering a Cas enzyme to said cell.
  • the Cas enzyme includes a Cas9 protein.
  • said modification comprises administering antisense RNA to said cell
  • said antisense RNA comprises the nucleotide sequence shown in any one of SEQ ID NO:194 to SEQ ID NO:197.
  • the immune cells are HLA-B homozygous cells.
  • the HLA-B homozygotes include HLA-B*40 homozygotes, HLA-B*15 homozygotes, HLA-B*46 homozygotes, HLA-B*13 homozygotes, HLA-B homozygotes *51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B*57 Homozygous, HLA-B*54 homozygous or HLA-B*55 homozygous.
  • the immune cells are HLA-A homozygous or heterozygous cells.
  • the HLA-A homozygote or heterozygote includes HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A* 24 homozygotes.
  • the present application provides a method for preparing immune cells, which includes introducing the nucleic acid molecule and/or the carrier into the immune cells.
  • the method further includes: before/after introducing the nucleic acid molecule and/or the vector into the immune effector cells, modifying the immune cells, the modification includes The expression and/or activity of one or more of the associated genes is downregulated.
  • the gene associated with immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
  • the expression and/or activity of the TRAC gene and the HLA-A gene in the immune cells are down-regulated compared to the immune cells without the modification.
  • the expression and/or activity of the CIITA gene in the immune cells is not down-regulated compared to the immune cells without the modification.
  • the expression and/or activity of the B2M gene in the immune cells is not down-regulated compared to the immune cells without the modification.
  • the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the immune cells compared to wild-type cells.
  • the expression and/or activity of the CIITA gene is not down-regulated in the immune cells compared to wild-type cells.
  • the expression and/or activity of the B2M gene is not down-regulated in the immune cells compared to wild-type cells.
  • the down-regulation of the expression level and/or activity of the gene in the method includes down-regulation of the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulation of the gene encoded by the gene The expression and/or activity of the protein product is downregulated.
  • the modification in the method includes: gene knockout, gene mutation and/or gene silencing.
  • said modifying in said method comprises administering to said immune cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and sgRNA.
  • said modifying in said method comprises administering to said immune cells a sgRNA targeting an exon portion of said TRAC gene.
  • the sgRNA targeting the exon portion of the TRAC gene in the method comprises the nucleotide sequence shown in any one of SEQ ID NO:138 to SEQ ID NO:152.
  • said modifying in said method comprises administering to said immune cells a sgRNA targeting an exon portion of said HLA-A gene.
  • the sgRNA targeting the exon portion of the HLA-A gene in the method comprises the nucleotides shown in any one of SEQ ID NO:153 to SEQ ID NO:193 sequence.
  • said modifying in said method further comprises administering a Cas enzyme to said cell.
  • the Cas enzyme in the method includes a Cas9 protein.
  • said modifying in said method comprises administering to said cell an antisense RNA comprising a nucleus set forth in any one of SEQ ID NO: 194 to SEQ ID NO: 197 nucleotide sequence.
  • the immune cells of the method are derived from humans.
  • the immune effector cells in the method include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, ⁇ T cells, monocytes, dendritic cells , granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • the immune cells of the method comprise T cells.
  • the immune cells in the method are HLA-B homozygous cells.
  • the HLA-B homozygotes in the method include HLA-B*40 homozygotes, HLA-B*15 homozygotes, HLA-B*46 homozygotes, HLA-B*13 homozygotes Zygote, HLA-B*51 homozygous, HLA-B*58 homozygous, HLA-B*07 homozygous, HLA-B*35 homozygous, HLA-B*44 homozygous, HLA-B*52 homozygous, HLA-B*57 homozygote, HLA-B*54 homozygote or HLA-B*55 homozygote.
  • the immune cells in the method are HLA-A homozygous or heterozygous cells.
  • the HLA-A homozygote or heterozygote in the method includes HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote Or HLA-A*24 homozygous.
  • the present application provides the application of the chimeric antigen receptor, the isolated nucleic acid molecule, the vector, and/or the immune cells in the preparation of CAR-T cells.
  • the present application provides one or more pharmaceutical compositions, which comprise the chimeric antigen receptor, the isolated nucleic acid molecule, the carrier, and/or the immune cell, and optionally a pharmaceutically acceptable carrier.
  • the present application provides one or more of the antigen chimeric receptors, the isolated nucleic acid molecules, the vectors, the immune cells, and/or the pharmaceutical composition , for use in the treatment of a disease or condition associated with the expression of HER2.
  • the diseases or disorders associated with the expression of HER2 include diseases or disorders associated with up-regulated expression of HER2.
  • the disease or condition associated with expression of HER2 comprises a tumor.
  • the tumor comprises a HER2 positive tumor.
  • the tumor comprises a solid tumor.
  • the tumor comprises a hematoma.
  • the tumor comprises breast cancer, gastric cancer, ovarian cancer, cervical cancer, urothelial cancer, esophageal cancer, bladder cancer, colorectal cancer, endometrial cancer, kidney cancer, lung cancer, pancreatic cancer, Head and neck cancer, sarcoma, glioblastoma, prostate cancer, and/or thyroid cancer.
  • the present application provides the chimeric antigen receptor, the isolated nucleic acid molecule, the carrier, the immune cell, and/or the pharmaceutical composition in the preparation of medicine Use, the medicine is used for treating diseases or diseases related to the expression of HER2.
  • the diseases or disorders associated with the expression of HER2 include diseases or disorders associated with up-regulated expression of HER2.
  • the disease or condition associated with expression of HER2 comprises a tumor.
  • the tumor comprises a HER2 positive tumor.
  • the tumor comprises a solid tumor.
  • the tumor comprises a hematoma.
  • the tumor comprises breast cancer, gastric cancer, ovarian cancer, cervical cancer, urothelial cancer, esophageal cancer, bladder cancer, colorectal cancer, endometrial cancer, kidney cancer, lung cancer, pancreatic cancer, Head and neck cancer, sarcoma, glioblastoma, prostate cancer, and/or thyroid cancer.
  • the present application provides a method for preventing and/or treating diseases or disorders related to the expression of HER2, which comprises administering an effective amount of the chimeric antigen receptor to a subject in need, wherein The isolated nucleic acid molecule, the carrier, the immune cell, and/or the pharmaceutical composition.
  • the diseases or disorders associated with the expression of HER2 include diseases or disorders associated with up-regulated expression of HER2.
  • the disease or condition associated with expression of HER2 comprises a tumor.
  • the tumor comprises a HER2 positive tumor.
  • the tumor comprises a solid tumor.
  • the tumor comprises a hematoma.
  • the tumor comprises breast cancer, gastric cancer, ovarian cancer, cervical cancer, urothelial cancer, esophageal cancer, bladder cancer, colorectal cancer, endometrial cancer, kidney cancer, lung cancer, pancreatic cancer, Head and neck cancer, sarcoma, glioblastoma, prostate cancer, and/or thyroid cancer.
  • Figure 1 shows the exemplary anti-HER2 CAR gene lentiviral expression vector described in this application.
  • Figure 2 shows the construction strategy of anti-HER2 UCAR-T cells described in this application.
  • Figures 3A-3D show the phenotype detection results of anti-HER2 UCAR-T cells described in this application (knockout efficiency, transfection efficiency, amplification factor, memory T cell ratio).
  • Figure 4 shows the results of killing target cells by anti-HER2 UCAR-T cells described in this application.
  • Figures 5A-5C show the detection results of cytokine secretion in the co-culture of anti-HER2 UCAR-T cells and target cells described in this application.
  • Figure 6 shows the anti-tumor effect of the anti-HER2 UCAR-T cells described in this application in vivo.
  • Figure 7 shows the results of the in vivo half-life detection of anti-HER2 UCAR-T cells described in this application.
  • Figures 8A-8B show the results of in vivo rejection of anti-HER2 UCAR-T cells described in this application.
  • Figure 9 shows the off-target analysis of anti-HER2 UCAR-T cells described in this application.
  • Figure 10 shows the chromosomal translocation analysis of targeting anti-HER2 UCAR-T cells described in this application.
  • Figure 11 shows the karyotype analysis of anti-HER2 UCAR-T cells targeted in this application.
  • Figure 12 shows the Cas9 residue analysis of targeting anti-HER2 UCAR-T cells described in this application.
  • FIG. 13 shows the results of Sanger sequencing of the TRAC gene in this application after Sg9RNA editing.
  • Figure 14 shows the results of TA clone detection of the TRAC gene in this application after Sg9RNA editing.
  • Figure 15 shows the results of flow cytometry detection of the TRAC gene in this application after Sg9RNA editing.
  • Figure 16 shows the results of Sanger sequencing of the HLA-A02 gene in this application after Sg2RNA editing.
  • Figure 17 shows the results of Sanger sequencing of the HLA-A02 gene in this application after Sg5RNA editing.
  • Figure 18 shows the results of Sanger sequencing of the HLA-A11 gene in this application after Sg21 RNA editing.
  • Figure 19 shows the results of Sanger sequencing of the HLA-A11 gene in this application after editing by Rsg2 RNA.
  • 20A-20B show the results of simultaneous knockout of HLA-A02 and TRAC in the modified immune effector cells of the present application.
  • 21A-21B show the protein levels of HLA-A02 and TRAC in the modified immune effector cells of the present application.
  • Figure 22 shows the mRNA levels of TRAC, HLA-A, B2M and CIITA in the modified immune effector cells of the present application.
  • 23A-23B show the protein levels of B2M and CIITA in the modified immune effector cells of the present application.
  • 24A-24D show the protein levels of TRAC, HLA-A, B2M and CIITA in the modified immune effector cells of the present application.
  • Figures 25A-25B show the knockout of TRAC and HLA-A mRNA levels in the modified immune effector cells of the present application.
  • 26A-26B show the protein levels of CD69 and CD137 in the modified immune effector cells of the present application.
  • Figure 27 shows the co-culture of the modified immune effector cells and NK cells of the present application.
  • Figure 28 shows the expression level of IFN- ⁇ by the modified immune effector cells of the present application.
  • 29A-29D show the protein levels of TRAC, HLA-A, B2M and CIITA in the modified immune effector cells of the present application.
  • Figure 30 shows the infection efficiency of the modified immune effector cells of the present application to CAR.
  • Figure 31 shows the expansion factor of the modified immune effector cells of the present application.
  • Figure 32 shows the killing effect of the modified immune effector cells of the present application on CD19 positive target cells.
  • Figure 33 shows the dosing regimen for administering the modified immune effector cells of the present application.
  • Figure 34 shows the killing effect of the modified immune effector cells of the present application on tumors in mice.
  • chimeric antigen receptor generally refers to a group of polypeptides, usually two in the simplest embodiment, which, when in immune effector cells, provide cellular (usually cancer cells) and generate intracellular signals.
  • a CAR comprises at least one extracellular antigen-binding domain, a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as an "intracellular signaling domain”) comprising Functional signaling domains of defined stimulatory and/or co-stimulatory molecules.
  • the set of polypeptides are in the same polypeptide chain (eg, comprising chimeric fusion proteins).
  • the set of polypeptides is discontinuous from each other, eg, in different polypeptide chains.
  • the set of polypeptides includes a dimerization switch that, in the presence of a dimerization molecule, can couple the polypeptides to each other, eg, can couple an antigen binding domain to an intracellular signaling domain.
  • the stimulatory molecule of the CAR is the zeta chain associated with the T cell receptor complex.
  • the cytoplasmic signaling domain comprises a primary signaling domain (eg, the primary signaling domain of CD3-zeta).
  • the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one co-stimulatory molecule as defined below.
  • the co-stimulatory molecule may be selected from 4-1BB (ie 4-1BB), CD27, ICOS and/or CD28.
  • a CAR comprises a chimeric fusion protein that may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule.
  • a CAR comprises a chimeric fusion protein that may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling domain derived from a co-stimulatory molecule domains and functional signaling domains derived from stimulatory molecules.
  • the CAR comprises a chimeric fusion protein which may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signal transduction domain comprising a protein derived from one or more co-stimulatory molecules.
  • Functional signaling domains and functional signaling domains derived from stimulatory molecules may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signal transduction domain comprising a protein derived from one or more co-stimulatory molecules.
  • the CAR comprises a chimeric fusion protein which may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signal transduction domain comprising at least two derived from one or more common A functional signaling domain of a stimulatory molecule and a functional signaling domain derived from a stimulatory molecule.
  • the CAR comprises an optional leader sequence at the amino terminus (N-ter) of the CAR fusion protein.
  • the CAR further comprises a leader sequence at the N-terminus of the extracellular antigen recognition domain, wherein the leader sequence is optionally cleaved from the antigen recognition domain (e.g. scFv) during cellular processing and localizes the CAR to the cell membrane.
  • HER2 protein generally refers to a transmembrane glycoprotein with tyrosine kinase activity, belonging to the EGFR receptor family.
  • a "HER2 protein” may also be referred to as ERBB2.
  • the amino acid sequence of the human HER2 protein can be found at UniProt/Swiss-Prot Accession No. P04626.
  • the isolated antigen-binding fragment can bind to HER2 protein.
  • the terms "HER2 protein”, “HER2 antigen” and "HER2-Fc recombinant protein” are used interchangeably and include any variant or isoform thereof naturally expressed by cells.
  • CDR complementarity determining region
  • CDRs Chothia CDRs
  • Padlan FASEB J.9:133-139 (1995)
  • MacCallum J Mol Biol 262(5):732-45 (1996).
  • CDR boundaries for CDR may not strictly follow one of the above systems, but will still overlap with Kabat CDRs, although they can be shortened according to predictions or experimental findings that specific residues or groups of residues or even CDRs as a whole do not significantly affect antigen binding. or extended. In this application, the IMGT numbering system is used.
  • FR generally refers to the more highly conserved portions of antibody variable domains, known as the framework regions.
  • the variable domains of native heavy and light chains may each comprise four FR regions, four in VH (H-FR1, H-FR2, H-FR3, and H-FR4), and four in VL. (L-FR1, L-FR2, L-FR3 and L-FR4).
  • Framework region generally refers to the art-recognized portion of an antibody variable region that exists between the more divergent (ie hypervariable) CDRs.
  • Framework regions are typically referred to as Frameworks 1 to 4 (FR1, FR2, FR3, and FR4) and provide the backbone for representing the six CDRs (three from the heavy chain and three from the light chain) in three-dimensional space, to Forms the antigen-binding surface.
  • single chain antibody or “scFv” generally refers to a molecule comprising an antibody heavy chain variable region (VH) and an antibody light chain variable region (VL) connected by a linker.
  • VH antibody heavy chain variable region
  • VL antibody light chain variable region
  • the 2 domains, VL and VH, are encoded by separate genes, they can be joined using recombinant methods, through a synthetic linker, making them a single protein chain, where the VL and VH regions pair to form what is known as a single-chain Fv (scFv). monovalent molecule.
  • the term "antibody” when referring to fragments includes said single chain antibodies which can be produced by recombinant techniques or enzymatic or chemical cleavage of intact antibodies.
  • homologous sequences may include amino acid sequences that may be at least 80%, 85%, 90%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to the subject sequence .
  • a homologue will comprise the same active site, etc., as the subject amino acid sequence.
  • Homology can be considered in terms of similarity (ie, amino acid residues having similar chemical properties/functions), or can be expressed in terms of sequence identity.
  • a sequence having a percentage identity of any one of the SEQ ID NOs of the mentioned amino acid sequence or nucleotide sequence means having said percentage identity over the entire length of the mentioned SEQ ID NO the sequence of.
  • sequence alignment can be performed by various means known to those skilled in the art, for example, using BLAST, BLAST-2, ALIGN, NEEDLE or Megalign (DNASTAR) software and the like. Those skilled in the art can determine appropriate parameters for alignment, including any algorithms needed to achieve optimal alignment across the full-length sequences being compared.
  • KD is used interchangeably with “KD”, and generally refers to the dissociation equilibrium constant of a specific antibody-antigen interaction, and the unit is M (mol/L).
  • isolated nucleic acid molecule generally refers to an isolated form of nucleotides, deoxyribonucleotides or ribonucleotides or their analogs of any length, isolated from their natural environment or artificially synthesized .
  • the term "vector” generally refers to a nucleic acid molecule capable of self-replication in a suitable host, which transfers an inserted nucleic acid molecule into and/or between host cells.
  • the vectors may include vectors mainly used for inserting DNA or RNA into cells, vectors mainly used for replicating DNA or RNA, and vectors mainly used for expression of transcription and/or translation of DNA or RNA.
  • the carrier also includes a carrier having various functions as described above.
  • the vector may be a polynucleotide capable of being transcribed and translated into a polypeptide when introduced into a suitable host cell. Generally, the vector can produce the desired expression product by culturing an appropriate host cell containing the vector.
  • the term "host cell” generally refers to an individual cell, cell line or cell culture that can or has contained a vector comprising the isolated nucleic acid molecule described herein, or is capable of expressing the isolated antigen-binding fragment described herein things.
  • the host cells may include progeny of a single host cell. Due to natural, accidental or deliberate mutations, the progeny cells may not necessarily be completely identical in morphology or genome to the original parent cells, but they only need to be able to express the isolated antigen-binding fragments described in this application.
  • the host cells can be obtained by using the vectors described in this application to transfect cells in vitro.
  • the host cell can be a prokaryotic cell (such as Escherichia coli), or a eukaryotic cell (such as yeast cells, such as COS cells, Chinese hamster ovary (CHO) cells, HeLa cells, HEK293 cells, COS-1 cells, NSO cells or myeloma cells).
  • the host cells may be E. coli cells.
  • the host cell may be a yeast cell.
  • the host cell can be a mammalian cell.
  • the mammalian cells may be CHO-K1 cells.
  • immune effector cells generally refers to immune cells that participate in the immune response and perform effector functions.
  • the exercising effector functions may include clearing foreign antigens or promoting immune effector responses and the like.
  • Immune effector cells may include plasma cells, T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and myeloid-derived phagocytes.
  • the immune effector cells of the present application may be autologous/autogeneic ("own") or non-autologous ("non-self", eg allogeneic, syngeneic or allogeneic).
  • autologous generally refers to cells from the same subject.
  • Allogeneic generally refers to cells that are of the same species but are genetically different from those to which they are being compared.
  • Isgeneic generally refers to cells of a different subject that are genetically identical to the cells being compared.
  • Allogeneic generally refers to a cell of a different species than the compared cell.
  • the cells of the present application are autologous or allogeneic.
  • the term "modify” generally refers to altering the state or structure of a cell and/or changing the state or structure of a cell.
  • the change is usually compared with the state or structure of the corresponding unmodified cell, and the change may include a change in the expression level or function of an endogenous gene, such as down-regulating the expression level of an endogenous gene in a cell by means of genetic engineering, Up-regulation or non-expression, the genetic engineering means may include homologous recombination, CRISPR/Cas9 system gene editing, etc.; the change may also include changes in cellular protein expression, structure or function, such as through the endogenous gene expression level or Changes in protein expression, changes in structure or function achieved by changes in function, such as changes in protein expression, changes in structure or function achieved by regulating protein translation, post-translational modification; the changes may also include introducing exogenous Genes, expression of foreign proteins, etc.
  • T cell receptor alpha cons-stant T cell receptor alpha cons-stant
  • T cell receptor T cell receptor
  • MHC major histocompatibility complex
  • ⁇ T cells account for about 95% of the total T cells, and ⁇ T cells account for about 5% of the total T cells. This ratio varies during ontogeny and in disease states (such as leukemia) and also varies between species. different.
  • Each chain that makes up the TCR contains a variable region and a constant region.
  • the gene encoding the ⁇ chain (TRA, such as the information shown in HGNC: 12027) is located on chromosome 14 and consists of multiple gene segments, including variable Segment (V), connecting segment (J) and constant region (C), TRAC gene usually refers to the gene sequence (for example, the information shown in HGNC:12029) encoding T cell receptor ⁇ chain constant region (C), which is located in Chromosome 14 (14q11.2;14:22,547,505-22,552,131).
  • variable segment (V) genes encoding the N-segment antigen recognition domain is rearranged with one of the junction segment (J) to generate a functional V region exon that is transcribed and spliced together with the
  • the constant regions (C) are linked to form the T cell receptor alpha chain coding sequence.
  • MHC major histocompatibility complex antigen
  • HLA human leukocyte antigen
  • HLA class I antigens (A, B, C in humans) allow each cell to be recognized as "self", while HLA class II antigens (DR, DP and DQ in humans) participate in the communication between lymphocytes and antigen-presenting cells reaction between. Both have been implicated in the rejection of transplanted organs.
  • An important aspect of the HLA gene system is its polymorphism. Different alleles exist for each gene, MHC class I (A, B, and C) and MHC class II (DP, DQ, and DR). HLA alleles are indicated by numbers and subscripts. For example, two unrelated individuals may carry the class I HLA-B genes B5 and Bw41, respectively. Allelic products differ in one or more amino acids in the alpha and/or beta domains.
  • HLA-A MHC class I and II proteins
  • HLA-B HLA-DR
  • the HLA genes are clustered in a "superlocus" present on chromosome position 6p21, which encodes six classical Transplantation of HLA genes and at least 132 protein-coding genes. The complete locus measures roughly 3.6Mb, with at least 224 loci.
  • haplotype a set of alleles present on a single chromosome, inherited from one parent, that tends to be inherited as a group.
  • the set of alleles inherited from each parent forms a haplotype, some of which tend to be associated together. Identifying a patient's haplotype can help predict the probability of finding a matching donor and help develop a search strategy because some alleles and haplotypes are more common than others and they are more common in different races and ethnicities The frequencies in the distribution are different.
  • HLA-A generally refers to a type of human leukocyte antigen polypeptide chain, encoded by the HLA-A gene located on human chromosome 6p21.3 (for example, the information shown in HGNC:4931).
  • HLA-A is one of three major polypeptide types that make up MHC class I molecules on the surface of human cells, the others including HLA-B and HLA-C.
  • the heterodimer composed of the ⁇ chain encoded by the HLA-A gene and the ⁇ chain ( ⁇ 2-microglobulin) encoded by the B2M gene is the HLA-A class MHC I molecule.
  • the ⁇ chain encoded by the HLA-A gene may comprise an ⁇ 1 domain, an ⁇ 2 domain, an ⁇ 3 domain, a transmembrane region, and a cytoplasmic region, wherein the ⁇ 1 domain and the ⁇ 2 domain may be combined with peptides to be activated by MHC I molecules (eg, HLA-A class) present the peptides to cells of the immune lineage.
  • MHC I molecules eg, HLA-A class
  • HLA-A alleles may include those named by the WHO HLA Factor Nomenclature Committee included in the IMGT/HLA database version 3.38.0 (https://www.ebi.ac.uk/ipd/imgt/hla/) Sequence information of the different HLA-A alleles.
  • HLA-B generally refers to a part of the gene family of the human leukocyte antigen (HLA) complex.
  • HLA is the human version of the major histocompatibility complex (MHC), a family of genes present in many species. The genes in this complex are divided into three basic groups: class I, class II and class III.
  • MHC major histocompatibility complex
  • HLA-B gene and two related genes, HLA-A and HLA-C are the major MHC class I genes.
  • the HLA-B gene is located in band 21.3 of the short (p) arm of chromosome 6, from base pairs 31,353,871 to 31,357,211.
  • HLA-B is one of the three main HLAs that should be matched between donor and recipient.
  • HLA-A HLA-B
  • HLA-DR MHC class II
  • HLA-matched refers to a donor-recipient pair in which there is no mismatch in HLA antigens between the donor and recipient, such as providing hematopoietic stem cell transplantation therapy to a recipient in need of A donor for a stem cell transplant.
  • HLA-matched (i.e., in which all 6 alleles are matched) donor-recipient pairs have a reduced risk of graft rejection because endogenous T cells and NK cells are less likely to enter the graft recognized as foreign and thus less likely to mount an immune response against the graft.
  • HLA-mismatched refers to a donor- A recipient pair, such as a donor who provides a hematopoietic stem cell transplant to a recipient in need of hematopoietic stem cell transplantation therapy.
  • one haplotype is matched while the other is not.
  • HLA-mismatched donor-recipient pairs may have an increased risk of graft rejection relative to HLA-matched donor-recipient pairs because endogenous Sexual T cells and NK cells are more likely to recognize an incoming graft as foreign, and such T cells and NK cells are therefore more likely to mount an immune response against the graft.
  • B2M generally refers to ⁇ 2-microglobulin ( ⁇ 2-microglobulin), which is one of the components of MHC class I molecules.
  • ⁇ 2 microglobulin also known as ⁇ chain
  • B2M is normally expressed in all nucleated cells.
  • ⁇ 2 microglobulin is encoded by the B2M gene located at 15q21.1 (for example, the information shown in HGNC:914).
  • CIITA generally refers to the transactivator of major histocompatibility complex class II (MHC II).
  • the transactivator may be a protein having an acidic transcription activation domain, 4 LRRs (leucine rich repeats) and a GTP binding domain.
  • the protein can be localized in the nucleus and acts as a positive regulator of the transcription of major histocompatibility complex class II (MHC II) genes, known as the "master control factor” for the expression of these genes.
  • MHC II major histocompatibility complex class II
  • the protein also binds GTP and uses the binding to GTP to transport itself into the nucleus where it normally acts in a coactivator-like manner through acetyltransferase (AT) activity.
  • the protein is encoded by a gene located at 16p13.13 (for example the information shown at HGNC:7067), enabling the generation of several transcript variants encoding different isoforms.
  • wild-type cell generally refers to a naturally occurring or naturally derived cell.
  • T cells generally refers to thymus-derived cells that participate in various cell-mediated immune responses.
  • nucleic acid or “polynucleotide” or “nucleic acid molecule” generally refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in single- or double-stranded form. Unless specifically limited, the term may include nucleic acids that contain analogs of natural nucleotides that have similar binding properties to a reference nucleic acid (for example, for which sequence information is shown) and in a manner similar to naturally occurring nucleotides metabolism. Unless otherwise stated, the sequence of a nucleic acid may include conservatively modified variants thereof, such as degenerate codon substitutions, alleles, orthologs, SNPs, and complementary sequences, as well as the sequences explicitly indicated.
  • expression generally refers to the transcription and/or translation of a specific nucleotide sequence.
  • gene mutation generally refers to changes in the composition or sequence of base pairs in the structure of a gene. For example, point mutations caused by single base changes, or deletions, duplications, and insertions of multiple bases.
  • the term "gene silencing” generally refers to preventing the expression of certain genes by regulatory mechanisms. It can mainly include two types: one is transcriptional gene silencing (TGS) at the transcriptional level caused by factors such as DNA methylation, heterochromatinization, and position effects, and the other is post-transcriptional gene silencing (post -transcriptional gene silencing (PTGS), that is, at the post-transcriptional level of the gene, it affects the expression of the gene by specifically interfering with the target RNA.
  • TGS transcriptional gene silencing
  • PTGS post-transcriptional gene silencing
  • the expression of the corresponding gene is downregulated/decreased.
  • Gene silencing is generally considered to be a gene knockdown mechanism, and methods commonly used to silence genes can be RNAi, etc.
  • endogenous refers to any substance derived from or produced within an organism, cell, tissue or system.
  • exogenous refers to any substance introduced from or produced outside of an organism, cell, tissue or system.
  • antisense RNA generally refers to a single-stranded RNA that is complementary to the transcript mRNA (messenger RNA). Antisense RNA can inhibit gene expression by binding to mRNA. For example, the combination of antisense RNA and target mRNA increases the sensitivity of the double-stranded RNA molecule to RNase III and degrades it; for example, antisense RNA binds to the upstream non-coding region of mRNA, thereby directly inhibiting the translation of target mRNA .
  • siRNA generally refers to the abbreviation of Small interfering RNA (small interfering RNA) or short in-terfering RNA (short interfering RNA).
  • siRNA is a type of double-stranded non-coding RNA molecule with a length of about 18-28 base pairs, which can cause mRNA degradation through complementary binding to mRNA, thereby interfering with the expression of specific genes.
  • siRNA may be a product obtained by treating long double-stranded RNA or shRNA with Dicer enzyme.
  • the siRNA enters the cell and forms an RNA-induced silencing complex (RISC) with other proteins, the sense strand is degraded, and the antisense strand can bind to a complementary targeting sequence, thereby achieving gene silencing.
  • RISC RNA-induced silencing complex
  • shRNA generally refers to the abbreviation of short hairpin RNA, namely “short hairpin RNA”.
  • shRNA usually includes two short inverted repeat sequences separated by a stem-loop sequence to form a hairpin structure.
  • 5-6 T bases can also be included as the transcription terminator of RNA polymerase III.
  • shRNA can enter cells through viral vectors or plasmids, and be transcribed under the action of polymerase II or polymerase III, and the transcripts are exported from the nucleus (usually through Exportin 5) and then transported after being treated by Dicer To RISC, the sense strand is degraded, and the antisense strand can bind to a complementary targeting sequence, thereby achieving gene silencing.
  • CRISPR/Cas system generally refers to a group of molecules comprising an RNA-guided nuclease or other effector molecule and a gRNA molecule capable of directing and implementing the RNA-guided nuclease or other effector molecule Nucleic acid is modified at a target sequence, eg, causing degradation of the target sequence.
  • a CRISPR system comprises a gRNA and a Cas protein, e.g., a Cas9 protein.
  • Cas9 systems systems comprising Cas9 or functional mutants thereof are referred to herein as “Cas9 systems” or "CRISPR/Cas9 systems”.
  • the gRNA molecule and the Cas molecule can complex to form a ribonucleoprotein (RNP) complex.
  • RNP ribonucleoprotein
  • gRNA molecule or “guide RNA”, “guide RNA”, “guide RNA”, “guide RNA molecule”, “gRNA” are used interchangeably and generally refer to Nucleases or other effector molecules (generally complexed with gRNA molecules) to nucleic acid molecules on the target sequence. In certain embodiments, this is accomplished by hybridizing a portion of the gRNA to DNA (e.g., via a gRNA guidance domain) and by binding a portion of the gRNA molecule to an RNA-guided nuclease or other effector molecule (e.g., at least via gRNAtracr). described guide.
  • a gRNA molecule consists of a single contiguous polynucleotide molecule, referred to herein as a "single guide RNA” or “sgRNA” or the like.
  • a gRNA molecule consists of multiple (eg, two) polynucleotide molecules that are themselves capable of associating (typically by hybridization), referred to herein as “dual guide RNA” or “dgRNA” and the like.
  • Cas protein generally refers to the enzyme responsible for cutting DNA in the CRISPR/Cas system. Enzymes from Type I, II, and III CRISPR/Cas systems may be included. For example, Cas3, Cas9, Cas10.
  • Cas9 protein generally refers to the enzyme from the bacterial type II CRISPR/Cas system responsible for cutting DNA. Cas9 can include the wild-type protein and its functional mutants.
  • allele generally refers to the different variations that the gene sequence at a locus may have.
  • a genetic locus also known as a gene locus or site, refers to a fixed location on a chromosome, such as where a certain gene is located. The arrangement of loci in the genome is called a genetic map.
  • homozygous generally refers to a genotyped individual whose two alleles on the same locus of the homologous chromosome are the same.
  • a pair of relative genes can have individuals of both genotypes AA and aa.
  • heterozygote generally refers to a diploid individual whose two alleles at the same site on the homologous chromosome are different, such as Aa. Heterozygous genotypes generally have higher fitness than homozygous dominant or homozygous recessive genotypes, a phenomenon known as heterozygous dominance.
  • the term "pharmaceutically acceptable” generally refers to a drug that is commensurate with a reasonable benefit/risk ratio, suitable within the scope of sound medical judgment for use in contact with human and animal tissues without undue toxicity, irritation, Those compounds, materials, compositions and/or dosage forms for allergic reactions or other problems or complications.
  • the term "pharmaceutically acceptable carrier” generally refers to any of those conventionally used, and is subject only to physico-chemical considerations such as solubility and reactivity with active binding agents. lack of) and is limited by the route of administration.
  • the pharmaceutically acceptable carriers described herein, such as vehicles, adjuvants, excipients, and diluents, are well known to those skilled in the art and are readily available to the public.
  • a pharmaceutically acceptable carrier is one that is chemically inert to the active ingredients of the pharmaceutical composition and that exhibits no adverse side effects or toxicity under the conditions of use. In some embodiments, the carrier does not produce an adverse, allergic or other inappropriate reaction when administered to an animal or a human.
  • compositions are free of pyrogens and other impurities that could be harmful to humans or animals.
  • Pharmaceutically acceptable carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like; their use is well known in the art.
  • Acceptable carriers, excipients, or stabilizers are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphates, citrates, or other organic acids; antioxidants; , such as ascorbic acid; low-molecular-weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulin; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, arginine, or lysine amino acids; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugar alcohols, such as mannitol or sorbitol; salt-forming counterions, such as sodium; and/or Or nonionic surfactants such as Tween, Pluronics or polyethylene glycol (PEG).
  • buffers such as phosphates, citrates,
  • the term "about” generally refers to a range of 0.5%-10% above or below the specified value, such as 0.5%, 1%, 1.5%, 2%, 2.5%, above or below the specified value. 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10%.
  • the application provides a chimeric antigen receptor (CAR), which may comprise a targeting moiety, which may comprise at least one CDR in the heavy chain variable region VH.
  • the VH may comprise the amino acid sequence shown in SEQ ID NO:1.
  • the HCDR of the isolated antigen-binding protein can be divided in any form, as long as the VH is identical to the amino acid sequence shown in SEQ ID NO: 1, the HCDR obtained by any form of division can fall under the protection of this application within range.
  • the CDR of an antibody also known as the complementarity determining region, is part of the variable region.
  • the amino acid residues in this region may make contacts with the antigen or antigenic epitope.
  • Antibody CDRs can be determined by a variety of coding systems, such as CCG, Kabat, Chothia, IMGT, AbM, comprehensive consideration of Kabat/Chothia, etc. These numbering systems are known in the art, see, for example, http://www.bioinf.org.uk/abs/index.html#kabatnum. Those skilled in the art can use different coding systems to determine the CDR region according to the sequence and structure of the antibody. There may be differences in the CDR regions using different coding systems.
  • the CDR covers the CDR sequence divided according to any CDR division method; also covers its variants, the variants include the amino acid sequence of the CDR through substitution, deletion and/or addition of one or more amino acids .
  • the variants include the amino acid sequence of the CDR through substitution, deletion and/or addition of one or more amino acids .
  • amino acids For example 1-30, 1-20 or 1-10, and for example 1, 2, 3, 4, 5, 6, 7, 8 or 9 amino acid substitutions, deletions and/or or insertions; homologues thereof, which may be at least about 85% (e.g., at least about 85%, about 90%, about 91%, about 92%, Amino acid sequences having about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more) sequence homology.
  • the isolated antigen binding proteins described herein are defined by the IMGT coding system.
  • the targeting moiety may comprise HCDR3, and the HCDR3 may comprise the amino acid sequence shown in SEQ ID NO:8.
  • the HCDR3 of the targeting moiety can be defined by the IMGT coding system.
  • the targeting moiety may comprise HCDR2, and the HCDR2 may comprise the amino acid sequence shown in SEQ ID NO:6.
  • the HCDR2 of the targeting moiety can be defined by the IMGT coding system.
  • the targeting moiety may comprise HCDR1, and the HCDR1 may comprise the amino acid sequence shown in SEQ ID NO:4.
  • HCDR1 of the targeting moiety can be defined by the IMGT coding system.
  • the targeting moiety may comprise HCDR1, HCDR2 and HCDR3 in the heavy chain variable region shown in SEQ ID NO:1.
  • the targeting moiety may comprise HCDR1, HCDR2, HCDR3, and the HCDR3 may comprise the amino acid sequence shown in SEQ ID NO:8; the HCDR2 may comprise the amino acid sequence shown in SEQ ID NO:6; And the HCDR1 may comprise the amino acid sequence shown in SEQ ID NO:4.
  • the antigen-binding protein may comprise antibody A0 or an antigen-binding fragment (eg, scFv) that has the same HCDR3 as it (eg, has the same HCDR1-3 as it).
  • the targeting moiety may comprise H-FR1
  • the C-terminus of the H-FR1 is directly or indirectly linked to the N-terminus of the HCDR1
  • the H-FR1 may comprise SEQ ID NO:3 Amino acid sequence shown.
  • the targeting moiety may comprise H-FR2, the H-FR2 is located between the HCDR1 and the HCDR2, and the H-FR2 may comprise the amino acid sequence shown in SEQ ID NO:5 .
  • the targeting moiety may comprise H-FR3, the H-FR3 is located between the HCDR2 and the HCDR3, and the H-FR3 may comprise the amino acid sequence shown in SEQ ID NO:7 .
  • the targeting moiety may comprise H-FR4, the N-terminus of the H-FR4 is directly or indirectly linked to the C-terminus of the HCDR3, and the H-FR4 may comprise SEQ ID NO:9 Amino acid sequence shown.
  • the targeting moiety may comprise H-FR1, H-FR2, H-FR3 and H-FR4, and the H-FR1 may comprise the amino acid sequence shown in SEQ ID NO: 3; the H- FR2 may comprise the amino acid sequence shown in SEQ ID NO:5; the H-FR3 may comprise the amino acid sequence shown in SEQ ID NO:7; and the H-FR4 may comprise the amino acid sequence shown in SEQ ID NO:9 .
  • the antigen-binding protein may comprise antibody A0 or an antigen-binding fragment (eg, scFv) having the same H-FR1-4 therewith.
  • the targeting moiety in the chimeric antigen receptor may comprise a heavy chain variable region VH, and the VH may comprise the amino acid sequence shown in SEQ ID NO:1.
  • the nucleotide sequence encoding the VH can be SEQ ID NO:2.
  • the antigen binding protein may comprise a light chain variable region VL, and the VL may comprise at least one, two or three of LCDR1, LCDR2 and LCDR3.
  • the VL may comprise the amino acid sequence shown in SEQ ID NO:10.
  • the LCDR of the isolated antigen-binding protein can be divided in any form, as long as the VL is identical to the amino acid sequence shown in SEQ ID NO: 10, the LCDR obtained by dividing in any form can fall under the protection of this application within range.
  • the targeting moiety in the chimeric antigen receptor may comprise LCDR3, and the LCDR3 may comprise the amino acid sequence shown in SEQ ID NO:17.
  • the LCDR3 of the targeting moiety can be defined by the IMGT coding system.
  • the targeting moiety in the chimeric antigen receptor may comprise LCDR2, and the LCDR2 may comprise the amino acid sequence shown in SEQ ID NO:15.
  • the LCDR2 of the targeting moiety can be defined by the IMGT coding system.
  • the targeting moiety in the chimeric antigen receptor may comprise LCDR1, and the LCDR1 may comprise the amino acid sequence shown in SEQ ID NO:13.
  • LCDR1 of the targeting moiety can be defined by the IMGT coding system.
  • the targeting moiety in the chimeric antigen receptor may comprise LCDR1, LCDR2 and LCDR3 in the light chain variable region shown in SEQ ID NO:10.
  • the targeting moiety in the chimeric antigen receptor may comprise LCDR1, LCDR2, LCDR3, and the LCDR3 may comprise the amino acid sequence shown in SEQ ID NO: 17; the LCDR2 may comprise SEQ ID The amino acid sequence shown in NO:15; And the LCDR1 can comprise the amino acid sequence shown in SEQ ID NO:13.
  • the antigen-binding protein may comprise antibody A0 or an antigen-binding fragment (eg, scFv) that has the same LCDR3 (eg, the same LCDR1-3) as antibody A0.
  • the targeting moiety in the chimeric antigen receptor may comprise L-FR1
  • the C-terminus of the L-FR1 is directly or indirectly connected to the N-terminus of the LCDR1
  • the L-FR1 -FR1 may comprise the amino acid sequence shown in SEQ ID NO: 12.
  • the targeting moiety in the chimeric antigen receptor may comprise L-FR2, the L-FR2 is located between the LCDR1 and the LCDR2, and the L-FR2 may comprise SEQ Amino acid sequence shown in ID NO:14.
  • the targeting moiety in the chimeric antigen receptor may comprise L-FR3, the L-FR3 is located between the LCDR2 and the LCDR3, and the L-FR3 may comprise SEQ Amino acid sequence shown in ID NO:16.
  • the targeting moiety in the chimeric antigen receptor may comprise L-FR4, the N-terminus of the L-FR4 is directly or indirectly connected to the C-terminus of the LCDR3, and the L-FR4 -FR4 may comprise the amino acid sequence shown in SEQ ID NO: 18.
  • the targeting moiety may comprise L-FR1, L-FR2, L-FR3 and L-FR4, and the L-FR1 may comprise the amino acid sequence shown in SEQ ID NO: 12; the L- FR2 may comprise the amino acid sequence shown in SEQ ID NO:14; the L-FR3 may comprise the amino acid sequence shown in SEQ ID NO:16; and the L-FR4 may comprise the amino acid sequence shown in SEQ ID NO:18 .
  • the antigen-binding protein may comprise antibody A0 or an antigen-binding fragment (eg, scFv) having the same L-FR1-4 therewith.
  • the targeting moiety in the chimeric antigen receptor may comprise a light chain variable region VL, and the VL may comprise the amino acid sequence shown in SEQ ID NO:10.
  • the nucleotide sequence encoding the VL is SEQ ID NO: 11.
  • the targeting moiety in the chimeric antigen receptor may comprise HCDR1-3 and LCDR1-3.
  • the HCDR3 may comprise the amino acid sequence shown in SEQ ID NO:8; the HCDR2 may comprise the amino acid sequence shown in SEQ ID NO:6; and the HCDR1 may comprise the amino acid sequence shown in SEQ ID NO:4; the The LCDR3 may comprise the amino acid sequence shown in SEQ ID NO:17; the LCDR2 may comprise the amino acid sequence shown in SEQ ID NO:15; and the LCDR1 may comprise the amino acid sequence shown in SEQ ID NO:13.
  • the antigen-binding protein may comprise antibody A0 or an antigen-binding fragment (eg, scFv) that has the same LCDR3 and HCDR3 (eg, has the same LCDR1-3 and HCDR1-3) as antibody A0.
  • an antigen-binding fragment eg, scFv
  • the antigen binding protein may comprise a heavy chain variable region and a light chain variable region.
  • the heavy chain variable region of the antigen binding protein may comprise HCDR1-3 and H-FR1-4.
  • the light chain variable region of the antigen binding protein may comprise LCDR1-3 and L-FR1-4.
  • the HCDR1 may comprise the amino acid sequence shown in SEQ ID NO:4;
  • the HCDR2 may comprise the amino acid sequence shown in SEQ ID NO:6;
  • the HCDR3 may comprise the amino acid sequence shown in SEQ ID NO:8;
  • the LCDR1 can include the amino acid sequence shown in SEQ ID NO:13;
  • the LCDR2 can include the amino acid sequence shown in SEQ ID NO:15;
  • the LCDR3 can include the amino acid sequence shown in SEQ ID NO:17.
  • the H-FR1 may comprise the amino acid sequence shown in SEQ ID NO:3; the H-FR2 may comprise the amino acid sequence shown in SEQ ID NO:5; the H-FR3 may comprise the amino acid sequence shown in SEQ ID NO:7
  • the amino acid sequence shown; the H-FR4 can comprise the amino acid sequence shown in SEQ ID NO:9; the L-FR1 can comprise the amino acid sequence of SEQ ID NO:12; the L-FR2 can comprise the amino acid sequence of SEQ ID NO The amino acid sequence shown in: 14;
  • the L-FR3 can comprise the amino acid sequence shown in SEQ ID NO: 16;
  • the L-FR4 can comprise the amino acid sequence shown in SEQ ID NO: 18.
  • the heavy chain variable region of the antigen binding protein may comprise the amino acid sequence shown in SEQ ID NO:1.
  • the antigen binding protein may comprise antibody A0 or an antigen binding protein having the same heavy chain variable region as it.
  • the light chain variable region of the antigen binding protein may comprise the amino acid sequence shown in SEQ ID NO: 10.
  • the antigen binding protein may comprise antibody A0 or an antigen binding protein having the same light chain variable region as it.
  • the targeting moiety in the chimeric antigen receptor may include an antibody or an antigen-binding fragment.
  • the antigen-binding fragment in the chimeric antigen receptor can be selected from the following group: Fab, Fab', F(ab)2, Fv fragment, F(ab')2, scFv, di- scFv, VHH and/or dAb.
  • the targeting moiety in the chimeric antigen receptor may include scFv.
  • the scFv can target HER2.
  • the C-terminus of the VH may be directly or indirectly linked to the N-terminus of the VL.
  • the C-terminus of the VL may be directly or indirectly linked to the N-terminus of the VH.
  • the C-terminal of the VH can be directly or indirectly connected to the N-terminal of the VL through a linker.
  • the scFv can comprise the amino acid sequence set forth in any one of SEQ ID NO: 198-199.
  • transmembrane domain which may comprise a transmembrane domain derived from one or more proteins selected from the group consisting of: CD8A, CD8B, CD28, CD3e, CD3 ⁇ , 4- 1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3 ⁇ , CTLA-4, LAG-3, CD5, ICOS, OX40, NKG2D, 2B4, CD244, Fc ⁇ RI ⁇ , BTLA, CD30, GITR, HVEM, DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L, CD154, TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, and SLAM.
  • proteins selected from the group consisting of: CD8A, CD8B, CD28, CD3e, CD3 ⁇ , 4- 1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3 ⁇ , CTLA-4, L
  • the transmembrane domain may comprise a transmembrane domain derived from CD8A or CD8B.
  • transmembrane domain may comprise the amino acid sequence shown in any one of SEQ ID NO:21 to SEQ ID NO:69.
  • an intracellular co-stimulatory signaling domain which may comprise intracellular co-stimulatory signaling derived from one or more proteins selected from the group consisting of Domains: CD28, 4-1BB, CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4, Fc ⁇ RI ⁇ , BTLA, GITR, HVEM , DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD-1, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD40, and MyD88.
  • intracellular co-stimulatory signaling domain which may comprise intracellular co-stimulatory signaling derived from one or more proteins selected from the group consisting of Domains: CD28, 4-1BB, CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CD
  • the intracellular co-stimulatory signaling domain may include a co-stimulatory signaling domain derived from 4-1BB.
  • intracellular co-stimulatory signaling domain may comprise the amino acid sequence shown in any one of SEQ ID NO:70 to SEQ ID NO:102.
  • an intracellular signal transduction domain which may comprise an intracellular signal transduction domain derived from one or more proteins selected from the group consisting of: CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14Nef, DAP10, DAP-12 and structures containing at least one ITAM area.
  • an intracellular signal transduction domain derived from one or more proteins selected from the group consisting of: CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14Nef, DAP10, DAP-12 and structures
  • the intracellular signal transduction domain may comprise a signal transduction domain derived from CD3 ⁇ , CD3 ⁇ , CD3 ⁇ or CD3 ⁇ .
  • the intracellular signal transduction domain may comprise any one of SEQ ID NO:86, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:103 to SEQ ID NO:113 Amino acid sequence shown.
  • a hinge region between the targeting moiety and the transmembrane domain may comprise a hinge region derived from one or more proteins selected from the group consisting of: CD28, IgG1, IgG4 , IgD, 4-1BB, CD4, CD27, CD7, CD8, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
  • the hinge region may comprise a hinge region derived from CD8.
  • the hinge region may comprise the amino acid sequence shown in any one of SEQ ID NO:114 to SEQ ID NO:135.
  • the chimeric antigen receptor may also include a signal peptide, and the signal peptide may include the amino acid sequence shown in SEQ ID NO:136.
  • the nucleic acid encoding the signal peptide may comprise the nucleotide sequence shown in SEQ ID NO:137.
  • the non-targeting portion of the chimeric antigen receptor may include a hinge region, a transmembrane domain, an intracellular co-stimulatory signal transduction domain and an intracellular signal transduction domain.
  • the chimeric antigen receptor uses an anti-HER2 single-chain antibody (scFv) as a targeting moiety, and is connected to an intracellular signal transduction domain through a hinge region and a transmembrane domain, and the intracellular signal transduction domain is composed of The co-stimulatory signaling domain is composed of an intracellular signal transduction domain.
  • scFv anti-HER2 single-chain antibody
  • the non-targeting portion of the chimeric antigen receptor may comprise the transmembrane domain of the CD8A molecule, the hinge region of CD8, the intracellular co-stimulatory signaling domain of 4-1BB, and the intracellular signal transduction domain of CD3 ⁇ . guiding domain.
  • the chimeric antigen receptor uses an anti-HER2 single-chain antibody (scFv) as the targeting moiety, and is connected to the intracellular signal transduction domain through the CD8 molecular hinge region and transmembrane domain, and the intracellular signal transduction structure
  • the domain consists of the 4-1BB intracellular co-stimulatory signaling domain and the CD3 ⁇ intracellular signaling domain.
  • the non-targeting portion of the chimeric antigen receptor comprises the amino acid sequence shown in SEQ ID NO: 19.
  • the chimeric antigen receptor comprises the amino acid sequence shown in SEQ ID NO:200.
  • the present application provides one or more isolated nucleic acid molecules encoding the aforementioned chimeric antigen receptors.
  • the isolated nucleic acid molecule may comprise the nucleotide sequence shown in SEQ ID NO:201.
  • the present application provides a vector, which may comprise the aforementioned isolated nucleic acid molecule.
  • the vector may include a viral vector or a non-viral vector.
  • the non-viral vector may include Sleeping Beauty system or piggybac system.
  • the vector may include a lentiviral vector.
  • the present application provides a cell, which may comprise the aforementioned chimeric antigen receptor, the aforementioned isolated nucleic acid molecule, and/or the aforementioned vector.
  • the present application provides the application of the aforementioned chimeric antigen receptor, the aforementioned isolated nucleic acid molecule, the aforementioned vector, the aforementioned cell, or the aforementioned immune effector cell in the preparation of CAR-T cells.
  • the present application provides an immune effector cell, which may comprise the aforementioned nucleic acid molecule or the aforementioned vector, and/or express the aforementioned CAR.
  • the immune effector cells may include human cells.
  • the immune effector cells may include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and / or peripheral blood mononuclear cells.
  • the above-mentioned immune effector cells may include T cells.
  • the immune effector cells may include modified immune effector cells.
  • the modified immune effector cells may include cells that reduce immune rejection caused by allogeneic cell therapy.
  • TCR T cell antigen receptor
  • MHCI major histocompatibility complex
  • the modification may include down-regulation of the expression and/or activity of one or more genes related to immune rejection.
  • the gene related to immune rejection can be selected from one or more genes in the following group: TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
  • the gene related to immune rejection can be selected from one or more genes in the following group: TRAC, TRBC, HLA-A and HLA-B.
  • the gene related to immune rejection can be selected from one or more genes in the following group: TRAC, TRBC and HLA-A.
  • the gene related to immune rejection can be selected from one or more genes in the following group: TRAC and HLA-A.
  • the expression and/or activity of the TRAC gene and the HLA-A gene can be down-regulated in the modified immune effector cells compared with the unmodified corresponding cells.
  • the expression and/or activity of the CIITA gene is not down-regulated in the modified immune effector cells compared with the corresponding cells without the modification.
  • the expression and/or activity of the B2M gene is not down-regulated in the modified immune effector cells compared with the corresponding cells without the modification.
  • the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune effector cells compared with the corresponding wild-type cells.
  • the expression and/or activity of the B2M gene is not down-regulated in the modified immune effector cells compared with the corresponding wild-type cells.
  • the expression and/or activity of the CIITA gene is not down-regulated in the modified immune effector cells compared with the corresponding wild-type cells.
  • the expression level and/or activity of the gene is down-regulated includes down-regulating the expression and/or activity of the nucleic acid molecule encoding the gene; and/or down-regulating the expression and/or activity of the protein product encoded by the gene or the activity is downregulated.
  • the modification may include: gene knockout, gene mutation and/or gene silencing.
  • the modification may include the knockout of any one of the two TRAC alleles and the knockout of any one of the two HLA-A alleles in the immune effector cells.
  • the modification may include the knockout of two TRAC alleles and the knockout of any one of the two HLA-A alleles in the immune cells.
  • the modification may include knocking out the exons of the TRAC gene and knocking out the exons of the HLA-A gene in the immune cells.
  • the modification may include administering one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system to the immune effector cells.
  • the modification may include administering the CRISPR/Cas9 system to the immune effector cells.
  • the modification may further include administering sgRNA targeting the exon portion of the TRAC gene to the immune effector cells.
  • the sgRNA targeting the exon part of the TRAC gene may comprise the nucleotide sequence shown in any one of SEQ ID NO:138 to SEQ ID NO:152.
  • the modification may include administering sgRNA targeting the exon portion of the HLA-A gene to the immune effector cells.
  • the sgRNA targeting the exon part of the HLA-A gene may comprise the nucleotide sequence shown in any one of SEQ ID NO:153 to SEQ ID NO:193.
  • the modification may also include administering Cas enzyme to the cells.
  • the Cas enzyme may include Cas9 protein.
  • the antisense RNA may comprise the nucleotide sequence shown in any one of SEQ ID NO:194 to SEQ ID NO:197.
  • the immune effector cells may be HLA-B homozygous cells.
  • the HLA-B homozygous may include HLA-B*40 homozygous, HLA-B*15 homozygous, HLA-B*46 homozygous, HLA-B*13 homozygous, HLA-B *51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B*57 Homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
  • the immune effector cells may be HLA-A homozygous or heterozygous cells.
  • the HLA-A homozygote or heterozygote may include HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A* 24 homozygotes.
  • the present application provides a method for preparing immune effector cells, which may include introducing the aforementioned nucleic acid molecules or the aforementioned vectors into the immune effector cells.
  • the method may further include: before/after introducing the aforementioned nucleic acid molecule or the aforementioned vector into the immune effector cells, modifying the immune effector cells, the modification includes The expression and/or activity of one or more is downregulated.
  • the method may include: after introducing the aforementioned nucleic acid molecule or the aforementioned vector into the immune effector cells, modifying the immune effector cells, the modification includes one or more of the genes related to immune rejection The expression and/or activity of each is downregulated.
  • the method for preparing immune effector cells may include:
  • the modification includes down-regulating the expression and/or activity of one or more genes related to immune rejection.
  • the method for preparing immune effector cells may include:
  • CD3 magnetic beads were added in proportion to collect CD3-T cells (cells not bound to magnetic beads).
  • the gene related to immune rejection is selected from one or more genes in the following group: TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
  • the expression and/or activity of the TRAC gene and the HLA-A gene in the immune effector cells are down-regulated compared with the expression and/or activity of the corresponding genes in the corresponding cells without the modification.
  • the expression and/or activity of the CIITA gene is not down-regulated compared to the expression and/or activity of the corresponding gene in the corresponding cell without said modification.
  • the expression and/or activity of the B2M gene is not down-regulated compared to the expression and/or activity of the corresponding gene in the corresponding cell without said modification.
  • the expression and/or activity of the TRAC gene and the HLA-A gene of the immune effector cells are down-regulated.
  • the expression and/or activity of the CIITA gene was not down-regulated compared to the corresponding wild-type cells.
  • the expression and/or activity of B2M genes was not down-regulated compared to corresponding wild-type cells.
  • the expression level and/or activity of the gene is down-regulated, which may include down-regulating the expression and/or activity of the nucleic acid molecule encoding the gene; and/or down-regulating the expression and/or activity of the protein product encoded by the gene. / or the activity is downregulated.
  • the modification includes: gene knockout, gene mutation and/or gene silencing.
  • the modification may include the knockout of any one of the two TRAC alleles and the knockout of any one of the two HLA-A alleles in the immune effector cells.
  • the modification may include the knockout of two TRAC alleles and the knockout of any one of the two HLA-A alleles in the immune cells.
  • the modification may include knocking out the exons of the TRAC gene and knocking out the exons of the HLA-A gene in the immune cells.
  • the modification may include administering one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system to the immune effector cells.
  • the modification may include administering the CRISPR/Cas9 system to the immune effector cells.
  • the modification may include administering sgRNA targeting the exon portion of the TRAC gene to the immune effector cells.
  • the sgRNA targeting the exon part of the TRAC gene may comprise the nucleotide sequence shown in any one of SEQ ID NO:138 to SEQ ID NO:152.
  • the modification may include administering sgRNA targeting the exon portion of the HLA-A gene to the immune effector cells.
  • the sgRNA targeting the exon part of the HLA-A gene may comprise the nucleotide sequence shown in any one of SEQ ID NO:153 to SEQ ID NO:193.
  • the modification may also include administering Cas enzyme to the cells.
  • the Cas enzyme may include Cas9 protein.
  • the antisense RNA may comprise the nucleotide sequence shown in any one of SEQ ID NO:194 to SEQ ID NO:197.
  • the immune effector cells may include human cells.
  • the immune effector cells may include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and / or peripheral blood mononuclear cells.
  • the immune effector cells may include T cells.
  • the cells may be HLA-B homozygous cells.
  • the HLA-B homozygous may include HLA-B*40 homozygous, HLA-B*15 homozygous, HLA-B*46 homozygous, HLA-B*13 homozygous, HLA-B *51 homozygous, HLA-B*58 homozygous, HLA-B*07 homozygous, HLA-B*35 homozygous, HLA-B*44 homozygous, HLA-B*52 homozygous, HLA-B*57 Homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
  • the cells may be HLA-A homozygous or heterozygous cells.
  • the HLA-A homozygote or heterozygote may include HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A* 24 homozygotes.
  • the method for preparing immune effector cells may include:
  • CD3 magnetic beads were added in proportion to collect CD3-T cells (cells not bound to magnetic beads).
  • the present application provides a pharmaceutical composition, which may comprise the aforementioned chimeric antigen receptor, the aforementioned isolated nucleic acid molecule, the aforementioned carrier, the aforementioned cell, and/or the aforementioned immune effector cell, and any Optionally a pharmaceutically acceptable carrier.
  • the pharmaceutical composition may include the aforementioned immune effector cells and optionally a pharmaceutically acceptable carrier.
  • the present application provides the aforementioned antigen chimeric receptor, the aforementioned isolated nucleic acid molecule, the aforementioned carrier, the aforementioned cell, the aforementioned immune effector cell, and/or the aforementioned pharmaceutical composition, which can be used for the treatment of HER2 expression-associated diseases or conditions.
  • the diseases or disorders associated with the expression of HER2 may include diseases or disorders associated with the up-regulation of the expression of HER2.
  • the diseases or conditions associated with the expression of HER2 may include HER2 positive tumors.
  • HER2-positive tumors compared with normal cells, the protein expression of HER2 on the surface of tumor cells or in the tumor microenvironment is about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80% or higher.
  • the tumor may include breast cancer, gastric cancer, ovarian cancer, cervical cancer, urothelial cancer, esophageal cancer, bladder cancer, colorectal cancer, endometrial cancer, kidney cancer, lung cancer, pancreatic cancer, head and neck cancer, sarcoma , glioblastoma, prostate and/or thyroid cancer.
  • the present application provides the aforementioned chimeric antigen receptor, the aforementioned isolated nucleic acid molecule, the aforementioned carrier, the aforementioned cell, the aforementioned immune effector cell, and/or the aforementioned pharmaceutical composition in the preparation of medicines , the medicament can be used to treat a disease or condition associated with the expression of HER2.
  • the diseases or disorders associated with the expression of HER2 may include diseases or disorders associated with the up-regulation of the expression of HER2.
  • the diseases or disorders associated with the expression of HER2 may include diseases or disorders associated with the up-regulation of the expression of HER2.
  • the diseases or conditions associated with the expression of HER2 may include HER2 positive tumors.
  • HER2-positive tumors compared with normal cells, the protein expression of HER2 on the surface of tumor cells or in the tumor microenvironment is about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80% or higher.
  • the tumor may include breast cancer, gastric cancer, ovarian cancer, cervical cancer, urothelial cancer, esophageal cancer, bladder cancer, colorectal cancer, endometrial cancer, kidney cancer, lung cancer, pancreatic cancer, head and neck cancer, sarcoma , glioblastoma, prostate and/or thyroid cancer.
  • the present application provides a method for preventing or treating a disease or disorder related to the expression of HER2, which may include administering to a subject in need an effective amount of the aforementioned chimeric antigen receptor, the aforementioned isolated nucleic acid molecule , the aforementioned carrier, the aforementioned cell, the aforementioned immune effector cell, and/or the aforementioned pharmaceutical composition.
  • the disease or disorder associated with the expression of HER2 may include a disease or disorder associated with up-regulated expression of HER2.
  • the diseases or disorders associated with the expression of HER2 may include diseases or disorders associated with the up-regulation of the expression of HER2.
  • the diseases or conditions associated with the expression of HER2 may include HER2 positive tumors.
  • HER2-positive tumors compared with normal cells, the protein expression of HER2 on the surface of tumor cells or in the tumor microenvironment is about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80% or higher.
  • the tumor may include breast cancer, gastric cancer, ovarian cancer, cervical cancer, urothelial cancer, esophageal cancer, bladder cancer, colorectal cancer, endometrial cancer, kidney cancer, lung cancer, pancreatic cancer, head and neck cancer, sarcoma , glioblastoma, prostate and/or thyroid cancer.
  • the anti-HER2 CAR structure includes: a HER2 antigen-binding region (derived from an anti-HER2 scFv, the amino acid sequence of which is shown in any one of SEQ ID NO: 198-199), a CD8A extracellular hinge region, and a CD8A transmembrane region , a 4-1BB intracellular co-stimulatory domain and a CD3 ⁇ activation signaling domain.
  • the amino acid sequence of the non-antigen binding domain of HER2 CAR is shown in SEQ ID NO:19, and the nucleotide sequence is shown in SEQ ID NO:20.
  • the HER2 sequence information and the CAR vector structure construct the HER2 CAR lentiviral expression vector, and the schematic diagram of the vector (see Figure 1). Optimization: select the commercial lentiviral expression vector pCDH-CMV-MCS-EF1-copGFP as the backbone, and carry out element transformation on the basis of this vector.
  • the ampicillin resistance gene ⁇ -lactamase of the vector was replaced with the aminoglycoside phosphotransferase derived from Tn5, so that the vector had kanamycin resistance.
  • the CMV promoter and its adjacent downstream multiple cloning sites which are potentially threatening for in vivo applications.
  • the copGFP gene expressed by the EF1 promoter in the original vector was deleted, the SalI restriction site was retained, and the SmaI restriction site was added at the 5' end of SalI for vector construction to form the final destination vector.
  • the added SmaI restriction site is a single restriction site for the final destination vector, and other sequence parts of the vector do not have this restriction site.
  • the non-limiting design principle of the sgRNA of the CRISPR/Cas9 system used in this example is: 5'-NNN(20)-NGG-3', NGG is called protospacer adjacent motif (PAM), wherein , N represents A, T, C or G.
  • PAM protospacer adjacent motif
  • sgRNAs Since many sgRNAs can be designed on the same exon, and sgRNAs consisting of 20 nucleotide sequences may appear repeatedly in the genome, use the website http://crispr.cos.uni-heidelberg.de to Carry out the design and evaluation of sgRNA, paste the exon sequence to this website, the website designs sgRNA and conducts prediction evaluation, the higher the score in the evaluation, it means that there may be higher editing efficiency and lower off-target risk, from which Select the sgRNA with higher score to test.
  • the sgRNA targeting the TRAC gene is shown in SEQ ID NO:138 to SEQ ID NO:152
  • the sgRNA targeting the HLA-A02 gene is shown in SEQ ID NO:153 to SEQ ID NO:174
  • the targeting HLA-A11 gene The sgRNA of the gene is shown in SEQ ID NO:175 to 185
  • the sgRNA targeting the HLA-A24 gene is shown in SEQ ID NO:186 to SEQ ID NO:193, which were synthesized by GenScript Biotechnology Company.
  • HLA-B typing of the recipient select HLA-B homozygotes that match the HLA-B typing of the recipient.
  • the source of the donor is based on the HLA-B homozygote in the population.
  • One of the alleles of the patient's HLA-B is consistent with the donor's HLA-B homozygote.
  • Cells from these donors can cover a high number of patient populations . Reduce the rejection caused by the inconsistency of HLA-B subtypes.
  • HLA-B mainly selects B*40 homozygote, B*15 homozygote, B*46 homozygote, B*13 homozygote, B*51 homozygote, B*58 homozygote, B*07 homozygote with high frequency in the population Homozygote, B*35 homozygote, B*44 homozygote, B*52 homozygote, B*57 homozygote, B*54 homozygote, B*55 homozygote.
  • HLA-A selects A*02 homozygotes, A*11 homozygotes and A*02/A11 heterozygotes with higher frequencies in the population.
  • Peripheral blood was collected from healthy donors and diluted 1:1 with PBS buffer.
  • cell separation solution Ficoll
  • blood cell dilution solution very slowly along the tube wall, and centrifuge at 800g for 20min at room temperature (set the centrifuge to increase speed 1, reduce speed 0).
  • the liquid in the centrifuge tube is divided into PBS and serum layer, white blood cell layer, lymphocyte separation solution, and red blood cell layer from top to bottom.
  • remove the PBS and serum layer move the white blood cell layer to a new 50ml centrifuge tube, add PBS to 40ml to wash the cells, and centrifuge at 450g for 10min. After centrifugation, the supernatant was discarded to obtain peripheral blood mononuclear cells. Cell counts were performed after the cells were resuspended.
  • T cells in peripheral blood mononuclear cells were extracted using EasySep TM Human T Cell Separation Kit (purchased from StemCell Technologies, catalog number: 17951). Adjust the PBMC density to 5 ⁇ 10 7 cells/ml, and add PBS buffer in the range of 0.25-2ml; first add cocktail to mix well, then add isolation cocktail at 50 ⁇ l/ml, mix well and place at room temperature for 5 minutes; shake RapidSpheres by vortex After vortexing for 30s, add 40 ⁇ l/ml to the cells and mix well; add buffer to the multiple of 2.5ml, and gently blow up and down 2-3 times; add 2.5ml to each tube respectively, and put Place the cryovial on the magnetic stand, and let it stand at room temperature for 3 minutes; gently open the cap of the cryovial, carefully hold the two sides to pick up the magnetic stand, keep it upside down for 2-3 seconds, and pour the cell solution into a new centrifuge tube at one time; use 10 - After resuspending the cells in 20ml buffer (dependured
  • CD3+T cells were obtained according to the method of Example 2 (D0 day), and activated with CD3/CD28 antibody magnetic beads, and then transfected with a lentiviral vector (HER2 CAR lentiviral expression vector prepared in Example 1) on D1 day after activation, On D2, the lentiviral vector was washed away, and on D3, electroporation was performed.
  • a lentiviral vector HER2 CAR lentiviral expression vector prepared in Example 1
  • TRAC sgRNA AGAGTCTCTCAGCTGGTACA (SEQ ID NO: 138), A02 sgRNA: CTGACCATGAAGCCACCCCTG (SEQ ID NO: 155), A11 sgRNA: GGCCCCTCCTGCTCTATCCA (SEQ ID NO: 185).
  • Sorting CD3-negative T cells centrifuging after counting cells, discarding supernatant; resuspending cells with buffer and mixing, adding CD3 magnetic beads to 20ul CD3 magnetic beads/ 107 cells, mixing evenly, and incubating in a 4-degree refrigerator.
  • Cell harvesting Collect cells in a centrifuge tube and discard after centrifugation, wash the cells again with normal saline, centrifuge, prepare a cryopreservation solution, resuspend the centrifuged cells in the cryopreservation solution, and draw the cell suspension into the final product with a cell freezer In the storage bag, label the cell cryopreservation bag for the next step of freezing.
  • Knockout efficiency (AB)/A ⁇ 100%; A is the positive expression rate of the control group; B is the positive expression rate of the knockout group.
  • HER2 target cells SK-BR-3-Luciferase-GFP; adjust the state of the target cells to the logarithmic growth phase, and need to be continuously passaged twice before the experiment;
  • the target cells were resuspended in 1640+10% FBS, and three 24-well plates were taken for each target site, and the target cells were inoculated according to the amount of 2x10 ⁇ 5/well. (Both target cells and effector cells were seeded at a density of 2x10 ⁇ 6/ml). Then add effector cells according to the E/T (effect-to-target ratio, effector cells: target cells) ratio. Fill each well to the maximum volume (such as 600ul). The control was inoculated with the same number of target cells without adding effector cells (600ul). The well plate was placed in a 5% CO 2 , 37° C. incubator and incubated for 24 hours. E/T: 1:2, 1:1, 2:1, 5:1, 10:1 plank, repeat three times.
  • HER2 UCAR-T has a significant killing effect on SK-BR-3-Luciferase-GFP cells, and the killing efficiency can reach more than 90% when the effect-to-target ratio is 1:2 (see Figure 4).
  • Example 5 In vivo anti-tumor effect of targeting HER2 UCAR-T cells
  • mice aged 8-10 weeks were subcutaneously injected with tumor cell SK-BR-3-Luciferase-GFP (5x10 ⁇ 6). The mice were divided into three groups with 5 mice in each group, and the tumor formation time was generally 2-4 weeks.
  • HER2 UCAR-T cells, HER2 CAR-T cells, and non-gene knockout T cells 5E6 were injected intratumorally into each group of mice, single-point injection, injection volume 50ul. Tumor regression in mice was monitored by luciferase.
  • mice Prepare 15 humanized immune system mice (hHSC-NCG). Divide into 3 groups. Preparation of cells, experimental group anti-HER2 UCAR-T cells (knockout TRAC+HLA-A02); control group 1: anti-HER2 CAR-T; control group 2: anti-HER2 UCAR-T cells (knockout TRAC+B2M ); each mouse was injected with 1x10 ⁇ 7 cells, and blood was collected at different time points D0, 2h, D3, D7, D14, D21, D28, D35, D42, D49, D56, D60. Genomes were extracted from blood samples at different time points, and the copy/ng genome DNA was calculated by QPCR absolute quantification method. The positive control used UCAR-T cells harvested on the 14th day, and the negative control used DEPC water.
  • GVHD response Prepare TRAC, HLA-A double-knockout T cells, T cells without gene knockout, irradiate allogeneic PBMC, stimulate the two groups of cells prepared respectively, and detect the level of IFN-r.
  • Allogeneic reaction Allogeneic PBMC stimulated the cells of the two groups after irradiation, and detected the level of IFN-r.
  • GVHD response prepare TRAC, HLA-A double knockout T cells, and T cells without gene knockout. 8-10 weeks NSG mice were injected with 1x10 ⁇ 7 respectively, and the graft-versus-host reaction was observed through clinical indicators: survival rate, fur texture and skin integrity, etc. Cytokine detection: Peripheral blood serum was collected to detect the levels of cytokines such as IL6, IL-2, TNF- ⁇ , IFN- ⁇ , etc. Blood collection time: before reinfusion, 24h, D3, D7, D14, D28, 2M. Detection of organ lesions: At the end of the observation period (about 2 months), the spleen, liver, skin, gastrointestinal tract, lung, and kidney of the mice were taken for HE section staining analysis.
  • mice injected with untreated T cells developed lethal graft-versus-host disease (GVHD) within 2 months of injection. None of the mice receiving TRAC, HLA-A double knockout cells developed GVHD; the TRAC, HLA-A double knockout T cell group secreted very low levels of cytokines IL6, IL-2, TNF- ⁇ , IFN- ⁇ ; and The morphology of different organs of the mice was normal. It shows that TRAC, HLA-A double-knockout T cell group greatly reduces the GVHD response.
  • GVHD lethal graft-versus-host disease
  • Allogeneic reaction preparation of TRAC, HLA-A double knockout CAR-T cells, and co-injection of 1x10 ⁇ 7 TCR-HLA-A-double knockout CAR-T cells and 2x10 ⁇ 6 allogeneic T cells into NSG mice in vivo.
  • Control group Inject 1x10 ⁇ 7 TCR-CAR-T cells into NSG mice.
  • Control group transfer to CAS9+ODN label
  • On-target and off-target-WGS (Whole genome sequencing): 1 ⁇ 10 ⁇ 6 T cells without gene knockout, TRAC, and HLA-A double-knockout T cells were taken respectively and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for detection .
  • Result analysis double-knockout T cells (TRAC+HLA-A) detected whether chromosomal translocation occurred on D14 (harvest).
  • the detection results the detection values of both translocation methods were close to zero detection value, indicating that no rearrangement of the loci occurred ( See Figure 10).
  • Residual Cas9 protein During cell preparation, 1 ⁇ 10 ⁇ 6 cells at each of the three time points before knockout, after knockout, and before harvest were lysed, and then protein quantification kit (NOVATEINBIO, Cat. No. NB-E1372PR ) for quantification, the samples in each group were adjusted to the same loading volume of 2 ⁇ g, and the CRISPR/Cas9 protein ELISA kit was used for detection according to the instructions.
  • the Cas9 protein in the sample is firmly and stably placed on the test paper well. Then use the detection antibody to recognize the bound Cas9 protein, and then develop with the developer.
  • the Cas9 ratio is proportional to the absorbance, and the absolute amount of Cas9 protein is quantified by comparing with the Cas9 control.
  • Double knockout T cells detected the residue of spCas9 at four time points before electroporation (D3), before electroporation (D5), D9, and D14 (harvest). Trace residues were detected before solution (D5), but not detected at the other three time points. (See Figure 12).
  • the RNP complex was transferred into the activated T cells prepared in Example 2 by electroporation using an electroporation kit (purchased from LONZA, product number V4XXP-3024). Preheat the medium (X-VIVO15 medium + 10% FBS + IL2 (200 U/ml) + IL7 (10 ng/ml) + IL15 (5 ng/ml)) in the well plate 30 minutes in advance.
  • the sgRNA sequence of TRAC is sg9 (as shown in SEQ ID NO: 138)
  • the sgRNA sequence of HLA-A is HLA-A02 Sg2 (as shown in SEQ ID NO: 154) or HLA-A02 Sg5 (as shown in SEQ ID NO: 154) SEQ ID NO:155) or HLA-A11 sg21 (as shown in SEQ ID NO:185) or HLA-A11 Rsg2 (as shown in SEQ ID NO:184)
  • 10 ⁇ g of Cas9 protein purchased from thermo, product number A36499
  • Example 2 Count the activated T cells cultured in Example 2, centrifuge at 300g for 8min, discard the supernatant, add PBS to resuspend the cells, absorb 1E7 cells and centrifuge again at 300g for 8min, discard the supernatant, and resuspend the cells with 100 ⁇ l of prepared electroporation buffer .
  • Add the preheated medium into the electro-cup then transfer the cells into the preheated medium in the well plate with a matching pipette, and then place them in a 37°C, 5% CO 2 incubator for culture.
  • Knockout efficiency (AB)/A ⁇ 100%; A is the positive expression rate of the control group; B is the positive expression rate of the knockout group.
  • the three detection results of TRAC single gene knockout are shown in Figure 13 to Figure 15, and the knockout efficiency calculation results are shown in Table 1.
  • the three detection methods are basically the same, and only the Sanger sequencing method was used to detect the editing efficiency in subsequent experiments.
  • the RNP complex was transferred into the activated T cells prepared in Example 2 by electroporation using an electroporation kit (purchased from LONZA, product number: V4XXP-3024). Preheat the medium (X-VIVO15 medium + 10% FBS + IL2 (200 U/ml) + IL7 (10 ng/ml) + IL15 (5 ng/ml)) in the well plate 30 minutes in advance.
  • TRAC Sg9 20 ⁇ g TRAC sgRNA (TRAC Sg9), 20 ⁇ g HLA-A sgRNA (HLA-A02 Sg2 or HLA-A02 Sg5 or HLA-A11sg21 or HLA-A*24:02:01, HLA-A *30:01:01:01, HLA-A*33:01:01:01, HLA-A*03:01:01:01, HLA-A*01:01:01:01 or HLA-A*26 :01:01:01 sgRNA) into PCR tubes (no RNA), and then add 10 ⁇ g Cas9 protein (purchased from thermo, product number A36499) respectively, mix gently, and incubate at room temperature for 12 minutes.
  • Cas9 protein purchased from thermo, product number A36499
  • Example 2 Count the activated T cells cultured in Example 2, centrifuge at 300g for 8min, discard the supernatant, add PBS to resuspend the cells, absorb 1E7 cells and centrifuge again at 300g for 8min, discard the supernatant, and resuspend the cells with 100 ⁇ l of prepared electroporation buffer .
  • Add the preheated medium into the electro-cup then transfer the cells into the preheated medium in the well plate with a matching pipette, and then place them in a 37°C, 5% CO 2 incubator for culture.
  • the double-gene knockout efficiency is detected by sequencing, and TRAC-negative and HLA-A-negative T cells with a double-gene knockout efficiency of not less than 80% can be obtained.
  • the results are shown in Figure 20-21.
  • Figure 20A shows the result of using HLA-A02 Sg5 to knock out HLA-A02, wherein the upper row shows the results of the control group (that is, without using HLA-A02 Sg5 to knock out); the next row shows the simultaneous knockout of HLA -The results of A02 and TRAC;
  • Figure 20B shows the results of knocking out TRAC using TRAC Sg9, where the upper line shows the results of the control group (that is, no knocking out with TRAC Sg9); the next line shows simultaneous knockout HLA-A02 and TRAC results.
  • Figure 21A-21B shows the knockout of HLA-A02 and TRAC protein levels, where NEG refers to the negative control, WT refers to the situation without any knockout treatment, TRAC+HLA-A double knockout refers to the simultaneous knockout of HLA- Results of A02 and TRAC.
  • Example 13 Differences in the expression of TRAC gene, HLA-A gene, B2M gene and CIITA gene in T cells with double gene knockout and corresponding genes in corresponding cells
  • Example 2 The activated T cells prepared in Example 2 were divided into two groups, one group was used as a control, and the other group prepared TRAC gene and HLA-A gene double gene knockout T cells according to the method in Example 5, according to Sanger sequencing was performed in the manner of step (1) of Example 4. According to the sequencing results, the TRAC and HLA-A double gene knockout cells were obtained.
  • the prepared double gene knockout T cells are incubated with corresponding TRAC and HLA-A antibodies, and the double gene knockout cell lines can be obtained by flow sorting or magnetic bead sorting.
  • RNA extraction kit purchased from QIAGEN, catalog number: 74004
  • reverse transcription kit purchased from Applied Biosystems, catalog number: 4368814
  • FIG. 22-23 shows the results.
  • Fig. 22 shows the mRNA level determination of gene expression, and wherein Fig. 22 shows the mRNA level of TRAC, HLA-A, B2M and CIITA;
  • WT refers to the situation without any knockout treatment
  • double knockout group refers to TRAC gene and HLA-A gene double knockout T cells results.
  • Figure 23 shows the protein level determination of gene expression, wherein Figure 23A-23B shows the protein expression levels of B2M and CIITA respectively; wherein NEG refers to the negative control, WT refers to the situation without any knockout treatment, TRAC+HLA-A Double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene.
  • Example 14 Prepare TRAC gene, HLA-A/B2M gene and CIITA gene knockout T cells and verify the expression changes of the corresponding three genes
  • TRAC, HLA-A and CIITA genes in TRAC, HLA-A and CIITA gene knockout T cells were down-regulated; compared with control cells, TRAC, B2M and CIITA triple gene knockout The protein expressions of TRAC, HLA-A and CIITA genes were down-regulated in T cells.
  • FIGS 24A-24D show the knockout status of TRAC, HLA-A and B2M protein levels in sequence.
  • WT refers to the situation without any knockout treatment
  • TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene
  • TRAC+HLA-A+CIITA triple knockout refers to TRAC, The result of the T cells of HLA-A and CIITA triple gene knockout
  • TRAC+B2M+CIITA triple knockout refers to the result of B2M, CIITA and TRAC triple gene knockout of T cells
  • TRAC+HLA-A knockdown refers to Example 16 Results of preparation of TRAC and HLA-A knockdown T cells.
  • Figure 24D shows the knockdown of CIITA protein levels.
  • Embodiment 15 designs antisense RNA sequence
  • RNA sequences of the corresponding genes (TRAC gene and HLA-A gene) through the database https://www.ncbi.nlm.nih.gov/ or www.ensembl.org/, and design siRNA with reference to the following principles:
  • the antisense RNA sequence that design obtains comprises HLA-A-homo-551 (it comprises the nucleotide sequence shown in SEQ ID NO:194); HLA-A-homo-NEG (it comprises the nucleotide sequence shown in SEQ ID NO:195) nucleotide sequence); TRAC-homo-375 (which comprises the nucleotide sequence shown in SEQ ID NO: 196); TRAC-homo-NEG (which comprises the nucleotide sequence shown in SEQ ID NO: 197).
  • Double gene knockdown was performed using the antisense RNA designed by Example 15.
  • the company prepares lentivirus (Gimma) with antisense RNA sequences of TRAC gene and HLA-A gene.
  • CD3 + T cells were prepared according to the method in Example 2 (D0 days), and activated with CD3/CD28 antibody magnetic beads, and the activated T cells were transfected with lentiviruses carrying the antisense RNA sequences of the TRAC gene and the HLA-A gene (D1 day), wash off the lentiviral vector on D2, and continue to culture until D5.
  • the T cells cultured to D5 days were collected, and the gene knockdown efficiency was detected by quantitative PCR or Western Blot and other methods.
  • T cells with TRAC gene and HLA-A gene knockdown can be obtained by flow sorting or magnetic bead sorting.
  • the results showed that the mRNA and protein expression levels of TRAC and HLA-A were down-regulated in the TRAC and HLA-A gene knockdown group.
  • Figures 25A-25B sequentially show the knockout status of TRAC and HLA-A mRNA levels.
  • WT refers to the situation without any knockout treatment
  • TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene.
  • the knockout levels of TRAC and HLA-A protein levels can be referred to the results in FIG. 24 .
  • T cells without gene knockout, double gene knockout, three gene knockouts and double gene knockdown in Examples 2, 12, 14 and 16 compare the cell counts of several T cell activities in each group and take them respectively 1*10 6 cells were inoculated in a 24-well plate, and PHA (0.3 ⁇ g/ml) (ionomycin +) or 5 ng/ml PMA and 50 ng/ml ionomycin were added to the cells in each well, and after continuing to culture for 5 hours, use CD69 (early activation) (purchased from BD Biosciences, catalog number: FN50) and CD137 (late stage) (purchased from BD Biosciences, catalog number: 4B4-1) antibodies were used to detect the activation status of cells by flow cytometry. The results showed that the activity of T cells with double gene knockout and double gene knockout was better than that of triple gene knockout T cells.
  • TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene
  • TRAC+HLA-A+CIITA triple knockout refers to TRAC
  • the result of the T cells of HLA-A and CIITA triple gene knockout wherein TRAC+B2M+CIITA triple knockout refers to the result of B2M, CIITA and TRAC triple gene knockout of T cells
  • TRAC+HLA-A knockdown refers to Example 16 Results of preparation of TRAC and HLA-A knockdown T cells.
  • T cells without gene knockout, double gene knockout, three gene knockouts and double gene knockdown in Examples 2, 12, 14 and 16 were labeled with CFSE (invitrogen, C34554), and the cell counts were taken as 1 *10 6 cells were co-cultured with NK cells (NK92MI) at a ratio of 1:1. After 24 hours, the co-cultured cells were collected, and the ratio of CFSE-positive cells in the mixed cells was detected by flow cytometry.
  • NK+T refers to the situation in which NK cells are co-cultured with T cells without any knockout treatment
  • NK+TRAC+HLA-A knockdown refers to the combination of NK cells with the TRAC gene and HLA-A gene prepared in Example 16
  • the results of the knockdown T cells co-culture NK+TRAC+HLA-A double knockout refers to the co-culture of NK cells and T cells with TRAC gene and HLA-A gene double gene knockout
  • NK+TRAC+HLA -A+CIITA triple knockout refers to the situation where NK cells are co-cultured with TRAC, HLA-A and CIITA triple knockout T cells
  • NK+TRAC+B2M+CIITA triple knockout refers to the situation where NK cells are combined with B2M
  • No gene knockout, double gene knockout, three gene knockout and double gene knockdown T cells in Examples 2, 12, 14 and 16 were prepared from peripheral blood from donor 1.
  • CD3 + T cells were prepared from peripheral blood from donor 2.
  • Each group of cells prepared from the peripheral blood of donor 1 was mixed with the CD3 + T cells prepared from the peripheral blood of donor 2 in equal proportions, and the expression level of IFN- ⁇ in the cell mixed system was detected 24 hours later. The results showed that the expression level of IFN- ⁇ in the double gene knockout T cell group was lower than that in the triple gene knockout T cell group.
  • TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene
  • TRAC+HLA-A+CIITA Triple knockout refers to the result of T cells knocked out by three genes of TRAC, HLA-A and CIITA
  • TRAC+B2M+CIITA triple knockout refers to the result of T cells knocked out by three genes of B2M, CIITA and TRAC
  • TRAC+HLA-A knockout Low refers to the result of TRAC gene and HLA-A gene knockdown T cells prepared in Example 16.
  • Example 20 Preparation of CAR-T cells with double gene knockout of TRAC gene and HLA-A gene, CAR-T cells with triple gene knockout of TRAC gene, HLA-A gene and CIITA gene, and knockout of TRAC gene, B2M gene and CIITA gene Removed CAR-T cells
  • TRAC gene and HLA-A gene double gene knockout cells according to the methods in Example 12 and Example 14 respectively, TRAC gene, HLA-A gene and CIITA gene as well as TRAC gene, B2M gene and CIITA gene knockout CAR-T cells.
  • the double-gene knockout and triple-gene knockout CAR-T cells can be obtained through flow cytometry detection, and the yield of double-gene knockout CAR-T cells is higher than that of triple-gene knockout CAR-T cells.
  • FIGS 29A-29D show the knockout status of TRAC, HLA-A and B2M protein levels in sequence.
  • Figure 29D shows the knockdown of CIITA protein levels.
  • WT refers to the situation without any knockout treatment
  • TRAC+HLA-A double knockout refers to the result of CAR-T cells with double gene knockout of TRAC gene and HLA-A gene
  • TRAC+HLA-A+CIITA triple knockout refers to The results of CAR-T cells with triple gene knockout of TRAC, HLA-A and CIITA
  • TRAC+B2M+CIITA triple knockout refers to the results of CAR-T cells with triple gene knockout of B2M, CIITA and TRAC.
  • the transfection efficiency of CD19CAR is shown in Figure 30A-30B.
  • CAR30%+ represents the transfection efficiency of CD19 CAR.
  • Figure 31 shows the expansion factor of different cells. Among them, CAR-T cells with double gene knockout of TRAC gene and HLA-A gene had the highest amplification factor.
  • Figure 32 shows the killing effect of Raji-Luciferase on CD19 target cells, among which the killing effect of CAR-T cells with double knockout of TRAC gene and HLA-A gene is the most significant.
  • each E/T ratio is the result corresponding to the legend of A-D from left to right.
  • NSG mice were injected with tumor cells intravenously. After the tumor was successfully established, CAR-T cells with double gene knockout of TRAC gene and HLA-A gene, CAR-T cells with triple gene knockout, or CAR-T cells without gene knockout were reinfused into the mice. T cells, monitoring tumor volume in mice.
  • the tumor growth rate was significantly slowed down in mice transfused with double-gene knockout CAR-T cells.
  • Figure 33 shows the administration method to mice, i.v. means intravenous injection, and CAR-T cells represent double-gene knockout CAR-T cells expressing CD19 CAR and triple-gene knockout CAR-T cells.
  • Figure 32 shows the volume of tumors in mice after administration of CAR-T cells. Among them, Figure 32 from left to right shows the three genes of CD19 CAR-T cells, TRAC, HLA-A and CIITA respectively administered with normal saline, unmodified T cells, TRAC gene and HLA-A gene knockout. Tumor volume in mice after knockout CD19 CAR-T cells, B2M, CIITA and TRAC knockout CD19 CAR-T cells. The results showed that the growth rate of tumors was significantly slowed down in mice transfused with CAR-T cells with double gene knockout of TRAC gene and HLA-A gene.
  • the present application prepares a chimeric antigen receptor targeting HER2.
  • the antigen binding domain (targeting part) of the recombinant receptor is derived from scFv, which has the characteristics of stable structure.
  • the present application provides a lentiviral expression vector.
  • the ampicillin resistance gene ⁇ -lactamase of the vector was replaced with aminoglycoside phosphotransferase derived from Tn5, so that the vector had kanamycin resistance;
  • the potentially threatening CMV promoter and its adjacent downstream multiple cloning sites in in vivo applications; delete the copGFP gene expressed by the EF1 promoter in the original vector, retain the SalI restriction site, and add it at the 5' end of SalI
  • the SmaI restriction site is used for vector construction to form the final destination vector.
  • the added SmaI restriction site is a single restriction site for the final destination vector, and other sequence parts of the vector do not have this restriction site.
  • This application optimizes the protein-RNA complex electrotransfection technology. A double gene knockout efficiency of more than 90% in primary T cells was obtained.
  • the source of donors for this application is based on the high frequency of HLA-B homozygotes in the population.
  • One allele of the patient’s HLA-B is consistent with the donor’s homozygosity.
  • Cells from these donors can cover a high number of patients population, and can reduce the rejection caused by HLA-B.
  • This application screened out the HLA-A molecules that are highly related to rejection and knocked them out, while retaining other HLA-I molecules, which not only reduced the rejection of allogeneic cells, but also avoided the complete knockout of HLA molecules being NK
  • the occurrence of cell clearance greatly prolongs the half-life of allogeneic CAR-T cells in vivo.
  • This application is the first to construct high-efficiency double-knockout TCR, HLA-A HER2-UCAR-T cells, to achieve a safe shelf-type ready-to-use therapeutic agent, improve anti-tumor effect, and be used for breast cancer and other diseases the treatment.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Lymphocyte CAR-T universel ciblant HER2 et procédé de préparation associé, le lymphocyte CAR-T universel comprenant un récepteur antigénique chimérique, le récepteur antigénique chimérique comprenant un fragment de ciblage, le fragment de ciblage comprenant HCDR3, et HCDR3 comprenant une séquence d'acides aminés telle que représentée dans SEQ ID NO:8. En plus de reconnaître les antigènes tumoraux, le lymphocyte CAR-T universel en question peut également réduire le rejet immunitaire causé par la thérapie CAR-T allogénique, prolonger le temps de survie des cellules et améliorer les effets anti-tumoraux.
PCT/CN2022/103085 2021-07-01 2022-06-30 Lymphocyte car-t universel ciblant her2 et son procédé de préparation WO2023274385A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202280046731.2A CN117642510A (zh) 2021-07-01 2022-06-30 靶向her2的通用型car-t细胞及其制备方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202110749397.4 2021-07-01
CN202110749397 2021-07-01

Publications (1)

Publication Number Publication Date
WO2023274385A1 true WO2023274385A1 (fr) 2023-01-05

Family

ID=84690455

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/103085 WO2023274385A1 (fr) 2021-07-01 2022-06-30 Lymphocyte car-t universel ciblant her2 et son procédé de préparation

Country Status (2)

Country Link
CN (1) CN117642510A (fr)
WO (1) WO2023274385A1 (fr)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016187158A1 (fr) * 2015-05-15 2016-11-24 City Of Hope Compositions de récepteur d'antigène chimérique
CN106543286A (zh) * 2016-12-07 2017-03-29 上海邦耀生物科技有限公司 一种去岩藻糖抗her2抗体及其应用
CN107723275A (zh) * 2017-10-20 2018-02-23 重庆精准生物技术有限公司 通用型car‑t细胞及其制备方法和应用
WO2018063985A1 (fr) * 2016-09-28 2018-04-05 Atossa Genetics Inc. Méthodes de thérapie cellulaire adoptive
CN107921148A (zh) * 2015-05-08 2018-04-17 哈佛学院校长同事会 通用供体干细胞和相关方法
CN108779174A (zh) * 2015-11-04 2018-11-09 希望之城公司 靶向her2的嵌合抗原受体
WO2020065406A2 (fr) * 2018-09-28 2020-04-02 Immpact-Bio Ltd. Procédés pour identifier des paires récepteur antigénique activateur (acar)/récepteur antigénique chimérique inhibiteur (icar) destinées à être utilisées en cancérothérapies
CN112391414A (zh) * 2020-11-17 2021-02-23 中国医学科学院基础医学研究所 一种靶向her2的car-t表达载体及其构建和应用

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107921148A (zh) * 2015-05-08 2018-04-17 哈佛学院校长同事会 通用供体干细胞和相关方法
WO2016187158A1 (fr) * 2015-05-15 2016-11-24 City Of Hope Compositions de récepteur d'antigène chimérique
CN108779174A (zh) * 2015-11-04 2018-11-09 希望之城公司 靶向her2的嵌合抗原受体
WO2018063985A1 (fr) * 2016-09-28 2018-04-05 Atossa Genetics Inc. Méthodes de thérapie cellulaire adoptive
CN106543286A (zh) * 2016-12-07 2017-03-29 上海邦耀生物科技有限公司 一种去岩藻糖抗her2抗体及其应用
CN107723275A (zh) * 2017-10-20 2018-02-23 重庆精准生物技术有限公司 通用型car‑t细胞及其制备方法和应用
WO2020065406A2 (fr) * 2018-09-28 2020-04-02 Immpact-Bio Ltd. Procédés pour identifier des paires récepteur antigénique activateur (acar)/récepteur antigénique chimérique inhibiteur (icar) destinées à être utilisées en cancérothérapies
CN112391414A (zh) * 2020-11-17 2021-02-23 中国医学科学院基础医学研究所 一种靶向her2的car-t表达载体及其构建和应用

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LI YONGQIANG, YAO SONGYUAN, LI YANSHENG, XU MINGKAI, ZHANG HUIWEN, ZHANG CHENGGANG: "Construction of HER2-specific CAR-T cells and in vitro analysis of their activity to suppress tumor cell growth", CHINESE JOURNAL OF BIOTECHNOLOGY, ZHONGGUO KEXUEYUAN WEISHENGWU YANJIUSUO, CHINESE ACADEMY OF SCIENCES, INSTITUTE OF MICROBIOLOGY, CN, vol. 34, no. 5, 25 May 2018 (2018-05-25), CN , pages 731 - 742, XP093018315, ISSN: 1000-3061, DOI: 10.13345/j.cjb.170437 *
SZÖŐR ÁRPÁD, TÓTH GÁBOR, ZSEBIK BARBARA, SZABÓ VIKTÓRIA, ESHHAR ZELIG, ABKEN HINRICH, VEREB GYÖRGY: "Trastuzumab derived HER2-specific CARs for the treatment of trastuzumab-resistant breast cancer: CAR T cells penetrate and eradicate tumors that are not accessible to antibodies", CANCER LETTERS, NEW YORK, NY, US, vol. 484, 1 August 2020 (2020-08-01), US , pages 1 - 8, XP055908579, ISSN: 0304-3835, DOI: 10.1016/j.canlet.2020.04.008 *

Also Published As

Publication number Publication date
CN117642510A (zh) 2024-03-01

Similar Documents

Publication Publication Date Title
CN112639083A (zh) 制备表达嵌合抗原受体的细胞的方法
TW202134264A (zh) 嵌合抗原受體及其用途
CN111566124A (zh) 制备表达嵌合抗原受体的细胞的方法
CN115058395A (zh) 嵌合抗原受体(car)、组合物及其使用方法
WO2021136263A1 (fr) Cellule effectrice immunitaire modifiée et son procédé de préparation
US20230256017A1 (en) Methods of making chimeric antigen receptor-expressing cells
CN115397460A (zh) 制备表达嵌合抗原受体的细胞的方法
KR20230051677A (ko) 메소텔린 양성 암을 치료하기 위한 조성물 및 방법
WO2023274384A1 (fr) Polypeptide de liaison à l'antigène ciblant b7h3 et son application
WO2023274385A1 (fr) Lymphocyte car-t universel ciblant her2 et son procédé de préparation
WO2023274386A1 (fr) Cellule car-t universelle ciblant egfr et son procédé de préparation
TW202214846A (zh) 用於治療ｅｇｆｒ陽性癌症之組合物及方法
WO2023274387A1 (fr) Cellule car-t universelle ciblant le gd2, son procédé de préparation et son application
WO2023274380A1 (fr) LYMPHOCYTE CAR-T UNIVERSEL CIBLANT IL13Rα2, SON PROCÉDÉ DE PRÉPARATION ET SON APPLICATION
WO2024094165A1 (fr) Cellule car-t universelle ciblant b7h3, son procédé de préparation et son utilisation
US20240109978A1 (en) Chimeric antigen receptor (car) spacer modifications enhance car t cell functionality
TW202323521A (zh) 製備表現嵌合抗原受體的細胞之方法
CN118271440A (zh) 靶向IL13Rα2的抗体以及靶向IL13Rα2的免疫效应细胞
WO2023199069A1 (fr) Récepteur antigénique chimérique qui se lie à la mésothéline

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22832197

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 202280046731.2

Country of ref document: CN

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22832197

Country of ref document: EP

Kind code of ref document: A1