WO2023204608A1 - Composition for improving skin, comprising potato-derived exosomes - Google Patents

Abstract

The present invention relates to a cosmetic composition and food composition for improving skin, comprising potato-derived exosomes.

Description

Composition for improving skin containing potato-derived exosomes

The present invention relates to cosmetic compositions and food compositions for skin improvement containing potato-derived exosomes.

The skin is the most basic defense organ that protects the body from irritation in contact with the external environment, and is an important organ that expresses external beauty.

Because external beauty is not only a criterion for judgment, symbolizing youth and health, but also a competitive advantage that expresses confidence and affects work ability, the tendency to take care of one's skin is increasing in modern society.

However, as we age, the secretion of various hormones that control metabolism decreases, the function of immune cells and the activity of cells decrease, which reduces the biosynthesis of immune proteins and biocomponent proteins necessary for living organisms, and externally destroys the ozone layer. Due to physical and chemical stimulation and stress caused by an increase in ultraviolet rays, free radicals, and active oxygen caused by environmental pollution, the normal function of the skin is weakened, aging is accelerated, complexion worsens, and the skin becomes wrinkled.

In order to prevent this phenomenon and maintain bright skin tone, efforts are being made to improve the skin by adding physiologically active substances obtained from various known animals, plants, and microorganisms to cosmetics to prevent skin aging due to oxidation. It is being done.

The cosmetics industry is developing a number of products using edible crops to reduce skin irritation caused by various chemicals. Edible crops not only have fewer side effects on the skin, but their development value as raw materials for cosmetics is gradually increasing as consumers' response to cosmetics using natural ingredients has recently increased.

Cosmetic products containing extracts derived from edible crops obtained through conventional methods do not sufficiently provide functionality such as skin improvement effects, and have difficulty passing through the skin barrier.

(Non-patent document 0001) Perocheau D, Touramanidou L, Gurung S, Gissen P, Baruteau J Clinical applications for exosomes: Are we there yet? Br J Pharmacol 2021 Jun;178(12):2375-2392.

(Non-patent document 0002) Xiong M, Zhang Q, Hu W, Zhao C, Lv W, Yi Y, Wang Y, Tang H, Wu M, Wu Y The novel mechanisms and applications of exosomes in dermatology and cutaneous medical aesthetics Pharmacol Res 2021 Apr;166:105490.

Therefore, the need to develop cosmetic compositions derived from edible crops that have excellent skin permeability and skin improvement effects along with excellent functionality is constantly emerging.

The purpose of the present invention is to provide a cosmetic composition for improving skin containing potato-derived exosomes.

Another object of the present invention is to provide a food composition for improving skin containing potato-derived exosomes.

Another object of the present invention is to provide a method for producing a cosmetic composition for improving skin containing potato-derived exosomes.

Potato-derived exosomes of the present invention have anti-aging, anti-inflammatory, and antioxidant effects and are excellent at improving skin. In particular, the potato exosomes of the present invention have excellent skin permeability and can be effectively used as a cosmetic composition for improving skin.

The effects of the present invention are not limited to the effects described above, and should be understood to include all effects that can be inferred from the configuration of the invention described in the detailed description or claims of the present invention.

Figure 1 schematically illustrates a method for isolating exosomes from plants.

Figure 2 shows the results of measuring the size of potato exosomes through dynamic light scattering (DLS).

Figure 3 shows the zeta potential (zeta-potential) measurement results of potato exosomes.

Figure 4 is a photograph of potato exosomes taken with a transmission electron microscope.

Figure 5 shows the results of confirming the cell permeability of potato exosomes. Figure 5A shows the results of confirming the cell permeability of potato exosomes. Figure 5B shows the results of examining the cell permeability of fluorescently labeled potato exosomes using flow cytometry.

Figure 6 shows the results of comparing the growth of HaCaT cell lines treated with potato exosomes or ascorbic acid.

Figure 7 shows the results confirming the antioxidant efficacy of potato exosomes. Figure 7A shows the antioxidant efficacy of potato exosomes against H ₂ O ₂ . Figure 7B shows the antioxidant efficacy of potato exosomes using the DPPH method.

Figure 8 shows the results of comparing the efficacy of potato exosomes when treated with HaCaT cell line before and after ultraviolet irradiation.

Figure 9 shows the results of confirming changes in gene expression according to potato exosome treatment before and after exposure to ultraviolet rays of potato exosomes. Figure 9A shows the results confirming the effect of potato exosomes on suppressing the expression of MMP1 and inflammation-inducing genes (IL6, TNF alpha) in the HaCaT cell line. Figure 9B shows the results of confirming changes in gene expression when potato exosomes were treated before and after exposure to ultraviolet rays.

Figure 10 shows the results of measuring changes in soluble collagen synthesis in cell culture medium after treating the HaCaT cell line with potato exosomes.

Figure 11 shows the results of comparing the skin cell growth efficacy of potato-derived exosomes, proteins (Comparative Example 1), and organic solvent extracts (Comparative Example 2). Figures 11A and 11B show potato-derived exosomes (Example 1), the same amount of protein recovered from potatoes (Comparative Example 1), and alcohol extract isolated from the same amount of protein (Comparative Example 2) at different concentrations in the HaCaT cell line. This shows the results of processing and checking the cell growth rate.

Figure 12 shows the prevention of UV damage by adding potato exosomes (Example 1), an equal amount of potato-derived protein (Comparative Example 1), and an alcohol extract derived from the same amount of protein (Comparative Example 2) to the HaCaT cell line before and after UV irradiation. and the results of measuring the recovery efficacy. Specifically, Figure 12A is a graph showing the relative cell survival rate when the HaCaT cell line is treated with potato exosomes (Example 1) before/after UV irradiation compared to the untreated cell line. Figure 12B is a graph showing the relative cell survival rate compared to the untreated cell line when the HaCaT cell line is treated with an equal amount of potato-derived protein (Comparative Example 1) and an alcohol extract derived from the same amount of protein (Comparative Example 2) before/after UV irradiation. am.

Figure 13 shows the results of comparing the photoaging prevention and recovery efficacy of potato-derived protein, alcohol extract, and E. coli-derived exosomes. Figure 13A shows the results of measuring the change in growth rate of the HaCaT cell line when the HaCaT cell line was treated with exosomes (Comparative Example 3) isolated from bacterial DH5α culture medium before UV irradiation. Figure 13B shows the results of measuring the change in growth rate of the HaCaT cell line when HaCaT was treated with exosomes (Comparative Example 3) isolated from bacterial DH5α culture after UV irradiation. Figure 13C shows the results of measuring the change in growth rate of the HaCaT cell line when HaCaT was treated with potato extract (Comparative Example 1) and potato alcohol extract (Comparative Example 2) before UV irradiation. Figure 13D shows the results of measuring the change in growth rate of the HaCaT cell line when HaCaT was treated with potato extract (Comparative Example 1) and potato alcohol extract (Comparative Example 2) after UV irradiation.

Figure 14 shows the results of comparing the anti-aging efficacy of potato-derived exosomes, potato-derived proteins, alcohol extracts, and E. coli-derived exosomes. Figure 14A shows the results of comparing the anti-aging gene expression efficacy of potato protein extract (Comparative Example 1) and E. coli exosome (Comparative Example 3) in HaCaT cell line. Figure 14B shows the results of comparing the gene expression efficacy of potato alcohol extract (Comparative Example 2) and potato exosomes (Example 1). Figure 14C shows the results of comparing the gene expression efficacy of potato protein extract (Comparative Example 1) and E. coli exosome (Comparative Example 3) before and after ultraviolet irradiation on HaCaT cell line. Figure 14D shows the results of comparing the gene expression efficacy of potato alcohol extract (Comparative Example 2) and potato exosomes (Example 1) before and after ultraviolet irradiation on HaCaT cell line.

Figure 15 shows the results of comparing the anti-inflammatory effects of potato-derived exosomes, potato-derived proteins, alcohol extracts, and E. coli-derived exosomes. Figure 15A shows the results of comparing the anti-inflammatory gene expression efficacy of potato protein extract (Comparative Example 1) and E. coli exosome (Comparative Example 3) in HaCaT cell line. Figure 15B shows the results of comparing the gene expression efficacy of potato alcohol extract (Comparative Example 2) and potato exosomes (Example 1). Figure 15C shows the results of comparing the gene expression efficacy of potato protein extract (Comparative Example 1) and E. coli exosome (Comparative Example 3) before and after ultraviolet irradiation on HaCaT cell line. Figure 15D shows the results of comparing the gene expression efficacy of potato alcohol extract (Comparative Example 2) and potato exosomes (Example 1) before and after ultraviolet irradiation on HaCaT cell line.

Figure 16 shows the results of comparing the anti-aging efficacy of exosomes derived from various edible crops. Figure 16A shows the results of RT-PCR for screening the anti-aging efficacy of various edible crops. Figure 16B shows the results of measuring the band intensity of RT-PCR.

Figure 17 shows the results of comparing the anti-inflammatory efficacy of exosomes derived from various edible crops. Figure 17A shows the results of RT-PCR for screening the anti-inflammatory efficacy of various edible crops. Figure 17B shows the results of measuring the band intensity of RT-PCR.

Figure 18 shows MMP-1, 2, 9, IL6 and MMP-1, 2, 9, IL6 and This is a result confirming the inhibitory effect of TNFalpha.

One aspect of the present invention for achieving the above object relates to a cosmetic composition for improving skin containing potato-derived exosomes.

In the present invention, the “potato (Solanum tuberosum)” is a perennial plant belonging to the nightshade family (Solanaceae), and is also called horse root, haji potato, and northern potato. It is native to the Andes Mountains of Peru and Chile, and is widely cultivated in temperate regions. It is 60 to 100 cm tall and has a unique smell.

In the present invention, the “exosome” is a nano-vesicle with a size of 30 to 150 nm composed of a double lipid membrane, and is composed of biologically active substances such as DNA, RNA, and proteins, and is secreted from the cell membrane and stored between cells. It plays an important function in communication. Exosomes can be moved to the cell surface and released through a multivesicular body (MVB) derived from lysosomes.

In the present invention, the “potato-derived exosome” or “potato exosome” refers to exosomes isolated from potatoes.

In the present invention, “skin improvement” refers to reducing the degree of symptoms associated with worsening skin condition.

Specifically, the “skin improvement” may include improving skin elasticity, improving skin wrinkles, improving skin texture, improving skin tone, improving skin brightness, skin regeneration, or skin moisturizing.

The term “improvement of skin elasticity” refers to the effect of shrinking sagging skin tissue by increasing the volume of skin fatty tissue, such as by promoting collagen synthesis, as well as maintaining or increasing the elasticity of the skin.

The “skin wrinkles” refer to fine lines that appear due to aging skin, and can be caused by genes, a decrease in collagen and elastin present in the dermis of the skin, and external environments. In the present invention, “skin wrinkle improvement” means suppressing or inhibiting the formation of wrinkles on the skin, or alleviating wrinkles that have already been formed.

The “skin tone” refers to a state in which the skin color is strong or weak, and “skin tone improvement” refers to making the uneven skin tone consistent.

The “improvement of skin brightness” includes increasing the brightness of skin whose brightness has decreased due to excessive pigments such as melanin, or maintaining the brightness of the skin at a certain level.

The “skin regeneration” refers to the recovery of skin cells or tissues damaged by external or internal causes. External causes include ultraviolet rays, external pollutants, wounds, and trauma, while internal causes include disease and stress.

The “skin moisturizing” refers to smoothing the skin surface and giving it shine by inhibiting or suppressing the decrease in skin moisture or increasing the moisture content of the skin.

The skin is composed of the epidermis, dermis, and hypodermis. The largest component of the dermis is collagen, which accounts for more than 80% and provides structural stability to the skin. Compared to healthy young skin, if photoaging damage from continuous exposure to ultraviolet rays accumulates, dermal collagen decomposition occurs, the outer layer shrinks, and this can lead to wrinkle formation.

In one example of the present invention, it was confirmed that potato exosomes promoted the growth of the HaCaT cell line, a human keratinocyte (FIG. 6), and reduced the expression of MMPs, a collagen degrading enzyme (FIG. 16).

Therefore, the cosmetic composition containing potato-derived exosomes has one or more effects selected from the group consisting of skin elasticity improvement, skin wrinkle improvement, skin texture improvement, skin tone improvement, skin brightness improvement, skin regeneration, skin whitening, and skin moisturizing effect. It can be expressed.

Specifically, the “skin improvement” may mean preventing or recovering skin damage caused by ultraviolet rays.

Ultraviolet rays are electromagnetic waves with a shorter wavelength than visible light and longer wavelengths than X-rays. Ultraviolet rays induce aging by stimulating oxidative stress on the skin. This is called ‘photoaging’ and is easily observed on skin areas frequently exposed to sunlight, such as the face, neck, backs of hands, arms, and legs. It is known that when exposed to ultraviolet rays, the destruction of collagen and elastin, the largest components of the skin cell matrix, increases, resulting in an imbalance of skin components.

In one example of the present invention, it was confirmed that cell growth increased when potato exosomes were treated before/after exposure to ultraviolet rays (FIG. 8). In addition, it was confirmed that the synthesis of collagen was significantly increased (Figure 10) and the expression of MMPs, a proteolytic enzyme, was decreased (Figure 14).

Therefore, a cosmetic composition containing potato-derived exosomes can exhibit the effect of preventing or recovering skin damage caused by ultraviolet rays.

Specifically, the “skin improvement” may mean preventing or improving skin inflammation. Inflammatory reactions can occur in the skin due to causes such as exposure to ultraviolet rays. In one embodiment of the present invention, it was confirmed that potato-derived exosomes reduced the expression of inflammatory cytokines such as IL6 and TNF alpha (FIGS. 15 and 17), and also the expression of inflammatory cytokines increased by ultraviolet rays. It was confirmed that it decreased (Figure 9). Therefore, a cosmetic composition containing potato-derived exosomes may have the effect of preventing or improving skin inflammation.

Specifically, the “potato-derived exosome” may be characterized by reducing the expression of one or more genes selected from the group consisting of MMP1, MMP2, MMP9, IL6, and TNF alpha (FIGS. 14 to 17).

The cosmetic composition of the present invention can be prepared in any formulation commonly prepared in the art, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansing agents. , oil, powder foundation, emulsion foundation, wax foundation, spray, etc., but is not limited thereto. More specifically, it can be manufactured in the form of softening lotion, astringent lotion, nourishing lotion, nourishing cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray, or powder.

Another aspect of the present invention relates to a food composition for improving skin containing potato-derived exosomes.

“Potato”, “exosome”, “potato-derived exosome”, “potato exosome”, and “skin improvement” are the same as described above.

Food compositions can be manufactured in any form, for example, beverages such as tea, juice, carbonated drinks, and electrolyte drinks, processed oils such as milk and yogurt, gums, rice cakes, Korean snacks, bread, etc. It can be manufactured into foods such as snacks and noodles, and preparations such as tablets, capsules, pills, granules, liquids, powders, flakes, pastes, syrups, gels, jellies, and bars.

The type of food may specifically be a health functional food. The above-mentioned health functional food is a food that emphasizes the bioregulatory function of food and is a food that has added value to act and express for a specific purpose using physical, biochemical, and biotechnological methods. The ingredients of these health functional foods are designed and processed to fully exert the body's regulatory functions related to biological defense, regulation of body rhythm, prevention and recovery of disease, and contain food auxiliary additives, sweeteners or functional ingredients that are acceptable as food. May contain raw materials.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the present invention is not limited by the following examples.

Example 1. Potato Exosome (ExoP)

After washing the potatoes, the skins were removed and juice was extracted using a juicer. The juice was centrifuged sequentially at 5,000~9,000 g for 30~120 minutes at 4℃, 10,000~20,000 g at 4℃ for 60~300 minutes, and 30,000~40,000 g at 4℃ for 60~300 minutes, and the supernatant was separated. It was recovered and filtered through a 0.8μm filter. Next, the filtrate was ultra-high-speed centrifuged at 100,000-180,000 g at 4°C for 2-24 hours to remove the supernatant, and the precipitated pellet containing exosomes was taken and washed in PBS (phosphate buffer, pH 6.5-7.5). ) was dissolved in (Figure 1)

Comparative Example 1. Potato-derived protein (Ext)

Potatoes were washed and ground. After precipitating the starch, it was centrifuged at 10,000 g at 4°C for 1 hour to remove non-soluble substances and isolate potato-derived proteins. The obtained potato protein was quantified using the BCA method.

Comparative Example 2. Alcohol Extract (AE) of Potato Protein

Ethanol (99%) and the potato-derived protein (1 mg/ml) isolated in Comparative Example 1 were mixed at a ratio of 2:1. After shaking vigorously at 100-200 rpm for 20 minutes at room temperature, the mixture was centrifuged at 1000 g for 10 hours at 4°C to remove non-dissolved compounds. After transferring the supernatant to a 2ml tube, the inlet was blocked with a film, an evaporation inlet was introduced, and the alcohol was evaporated overnight at 37°C and 120 rpm to separate the alcohol extract of potato protein. The volume was adjusted by adding PBS to the remaining compounds to maintain the same concentration as the potato extract before alcohol extraction.

Comparative Example 3. Exosome (ExoBAC) derived from E. coli (DH5a)

10 ml of a single colony of E. coli (DH5a) was cultured in LB liquid medium at 37°C and 150 rpm overnight, then added to 500 ml of new LB liquid medium, and culture was continued. When E. coli (DH5α) reached an OD of 1.5-1.7 at 600 nm, the strain culture was recovered and centrifuged at 10,000 to 15,000 g at 4°C to recover only the supernatant. The supernatant that passed through the 8 μm filter was ultra-high-speed centrifuged at 100,000-150,000 g at 4°C, exosomes were dissolved using PBS (phosphate buffer solution, pH 6.5-7.5), and protein was quantified using the BCA method.

Comparative Example 4. Pear-derived exosomes

Exosomes were isolated from pear in the same manner as in Example 1.

Comparative Example 5. Radish-derived exosomes

Exosomes were isolated from radish in the same manner as in Example 1 above.

Comparative Example 6. Orange-derived exosomes

Exosomes were isolated from oranges (citrus) in the same manner as in Example 1.

Experimental Example 1. Confirmation of physical properties of potato exosomes

1-1. Potato exosome size measurement

Potato exosomes (Example 1) were diluted in PBS (Phosphate Buffered Saline, pH 6.5-7.5) to a final concentration of 0.1 mg/ml, and then analyzed using a particle size & zeta analyzer (ELS-1000ZS Particle Size & Zeta potential Analyzer, Otsuka). The size of exosomes was measured through dynamic light scattering measurement using (Electronics, Japan).

As a result, as shown in Figure 2, the potato exosomes of the present invention have an average diameter of 60 nm, which is a typical exosome size.

1-2. Potato exosome zeta potential measurement

Potato exosomes (Example 1) were diluted in PBS (Phosphate Buffered Saline, pH 6.5-7.5) to a final concentration of 0.1 mg/ml, and then analyzed using a particle size & zeta analyzer (ELS-1000ZS Particle Size & Zeta potential Analyzer, Otsuka). Electronics, Japan) was used to measure the zeta potential.

As a result, as shown in Figure 3, the potato exosome of the present invention had a zeta potential of -19 mV, which was the zeta potential of a typical exosome. This means that the potato exosomes isolated in the present invention have relative stability without aggregation or precipitation.

1-3. Imaging of potato exosomes using transmission electron microscopy

Transmission electron microscopy (TEM) was taken to observe the shape of potato exosomes (Example 1). Potato exosome samples were stained with 2% uranyl acetate for 10 seconds, dried with an infrared lamp for 10 minutes, and photographed using a transmission electron microscope (JEM-1011, JEOL, Japan). .

As a result, as shown in Figure 4, when taken with a transmission electron microscope, oval exosomes in the form of a double membrane with a size of less than 100 nm were observed, indicating that the potato exosomes of the present invention exhibit a typical exosome size and shape. Confirmed.

Experimental Example 2. Confirmation of cell permeability of potato exosomes

2-1. Confocal microscopy

300 μg of potato exosomes (Example 1) and 1 μl of ExoGlow™-Protein EV Labeling Kit (Green) (System Biosciences, Palo Alto, CA, USA) were mixed for 4 hours, followed by Exoquick (System Biosciences, Inc.). ) was used to isolate only fluorescently labeled exosomes. 50 and 100 μg of fluorescently labeled exosomes were added to the HaCaT cell line at a concentration of 1x10 ⁵ cells/well, and 24 hours later, the cell line was photographed using a confocal microscope (LSM980, Carl Zeiss).

As a result, as shown in Figure 5A, fluorescence was not detected in cells treated with only the cells themselves or fluorescent dye (negative control), whereas fluorescence was not detected in cells treated with fluorescently labeled potato exosomes (50 and 100 μg/ml). It was confirmed that fluorescence was recognized in the cells. This indicates that the potato exosomes of the present invention can penetrate the HaCaT cell line on their own without external help.

2-2. flow cytometry

300 μg of potato exosomes (Example 1) and 1 μl of ExoGlow™EV Labeling Kit (Green) (System Biosciences, Palo Alto, CA, USA) were mixed for 4 hours and reacted using Exoquick (System Biosciences, Inc). Thus, only fluorescently labeled exosomes were isolated.

The HaCaT cell line was distributed in a 12-well plate at a concentration of 1x10 ⁵ cells/well and cultured for 4 hours at 37°C in 5% CO2 using DMEM medium containing 10% FBS and 1% each of penicillin and streptomycin. Fluorescently labeled potato exosomes were treated with 100 and 200 μg/ml and cultured. Each experiment was repeated twice. After 24 hours of incubation, each well was washed twice with 1 ml DPBS, cells were recovered, and resuspended in 300 μl staining buffer.

The cell permeability of exosomes was measured by measuring the percentage of cells into which fluorescently labeled potato exosomes were introduced using a flow cytometry machine, FACS CantoII (Becton Dickinson and Company), and compared and analyzed using the BD FACSDIva 80 software program. As a control group, HaCaT cell line that was not treated with fluorescently labeled potato exosomes was used.

As a result, as shown in Figure 5B, compared to the control group or cell lines treated with only fluorescent substances, when treated with fluorescently labeled potato exosomes, strong fluorescence was observed within the cells, showing that the potato exosomes of the present invention penetrated into the cells. .

Experimental Example 3. Confirmation of skin cytotoxicity of potato exosomes

The effect of potato exosomes (Example 1) on the growth of HaCaT cells, a human keratinocyte cell line, was measured using the WST-1 assay. Ascorbic acid (vitamin C) was used as a positive control.

Specifically, the HaCaT (human skin-derived keratinocyte) cell line was distributed in a ⁹⁶ -well plate at a concentration of 5 Cultured at 37°C and 5% CO2 conditions. HaCaT culture medium was treated with equal amounts of Example 1 (25, 50, 100, 150, 200 μg/ml) and ascorbic acid (1, 3, 5, 100 μg/ml). 24 and 48 hours after addition, WST-1 was added and formazan formation was quantified by reading at a wavelength of 450 nm.

As a result, as shown in Figure 6, when treated with ascorbic acid at a concentration of 100 μg/ml for 48 hours, the growth of the HaCaT cell line was reduced to 90% compared to the case without treatment, thereby inhibiting cell growth. On the other hand, when treated with low concentrations of ascorbic acid (1, 3, and 5 μg/ml), no change in the number of HaCaT cells was observed compared to the case without ascorbic acid treatment, and treatment with ascorbic acid at 100 μg/ml for 48 hours was observed. The decrease in cell growth was not due to cell death due to cell density and environmental influences, but cell growth was inhibited due to the toxicity of high-concentration ascorbic acid.

On the other hand, Example 1 did not show cytotoxicity because cell growth was not inhibited when treated for 24 hours and 48 hours at all concentrations of 25, 50, 100, 150, and 200 μg/ml. This indicates that the potato exosomes of the present invention do not exhibit toxicity to skin cells even when used at high concentrations for a long period of time.

Experimental Example 4. Confirmation of antioxidant efficacy of potato exosomes

4-1. Cell growth comparison

HaCaT cell lines were treated with H ₂ O ₂ , a representative oxidizing agent, alone, or potato exosomes (Example 1) were added 30 minutes before H ₂ O ₂ treatment and cultured, and changes in cell growth were examined using the WST-1 assay. For the WST-1 assay, refer to Experimental Example 3.

As a result, as shown in Figure 7A, when potato exosomes were added to the HaCaT cell line before H ₂ O ₂ treatment, cell death caused by H ₂ O ₂ was prevented. This indicates that potato exosomes are effective in preventing skin cell death caused by oxidative stress.

4-2. DPPH assay

DPPH (2,2-diphenyl-1-picrylhydrazyl) and potato exosomes (Example 1) at concentrations of 1, 2, and 4 mg/ml were mixed and absorbance was measured at a wavelength of 517 nm, and potato exosomes were directly exposed to DPPH. It was investigated whether activity was inhibited. Ascorbic acid, a representative antioxidant substance, was used as a control. The oxidation inhibition rate was calculated using Equation 1 below.

[Equation 1]

Oxidation inhibition rate (Inhibition, %) = (Sample absorbance - Control group absorbance) / (Control group absorbance)

As a result, as shown in Figure 7B, when Example 1 was reacted with DPPH, it exhibited the ability to reduce DPPH in a concentration-dependent manner, that is, the ability to inhibit oxidation. This indicates that potato exosomes have excellent antioxidant ability.

Experimental Example 5. Confirmation of photodamage prevention and recovery efficacy of potato exosomes

The efficacy of potato exosomes against photodamage was tested by treating the HaCaT cell line with potato exosomes (Example 1) at a concentration of 50 μg/ml before and after irradiation with ultraviolet rays (UVB, 15 mJ/cm2). This was confirmed through cell growth changes using the WST-1 assay. For the WST-1 assay, refer to Experimental Example 3.

As a result, as shown in Figure 8, UV exposure inhibits the growth of the HaCaT cell line by about 50%, while the growth of the HaCaT cell line pretreated with Example 1 increased by about 40% compared to the case without treatment with Example 1. , it was confirmed that Example 1 prevents skin cell damage caused by ultraviolet rays. In addition, when Example 1 was added to the HaCaT cell line already exposed to ultraviolet rays, the growth of the cell line increased, showing that there was a recovery effect after cell damage caused by ultraviolet rays.

This shows that potato exosomes have the effect of preventing and simultaneously recovering skin damage caused by ultraviolet rays, and have the effect of preventing and improving photoaging.

Experimental Example 6. Confirmation of gene expression changes according to potato exosome treatment before and after UV exposure

6-1. HaCaT cell line culture and reverse electron polymerase chain reaction (RT-PCR)

HaCaT (human skin-derived keratinocytes) cell line was distributed in a 96 ^- well plate at a concentration of 5 , cultured under 5% CO ₂ conditions.

Total RNA was extracted from the cultured HaCaT cell line using RNeasy Mini Kits (Qiagen), and the extracted RNA was quantified using Nanodrop (Denovix). 1 μg of extracted total RNA and 4 μg of oligo-dT primer were mixed in a total volume of 13.4 μl and reacted at 65 °C for 10 minutes. Afterwards, 400 U (unit) of enzyme Superscript II (400 U) (Invitrogen, Carlsbad, CA) was added and reacted at 42°C for an additional 90 minutes to synthesize cDNA.

PCR was performed on the cDNA using PCR Premix (AccuPower PCR PreMix, Bioneer), and primers for each gene in Table 1 below were used. The PCR reaction was performed once at 95°C for 5 minutes, followed by 25 to 33 cycles of 95°C for 1 minute, 60°C for 30 seconds, and 72°C for 1 minute, and stored at 4°C. A MiniAmp Plus (Thermo Fisher, USA) instrument was used for the PCR reaction.

sequence number	Primer type	Sequence (5' - 3')
One	GAPDH Forward		ATTCCATGGCACCGTCAAGG
2	GAPDH Reverse		TGATGGCATGGACTGTGGTC
3	IL6 Forward		CCAGTACCCCCAGGAGAAGA
4	IL6 Reverse		CAGCTCTGGCTTGTTCCTCA
5	TNF alpha Forward		GTGACAAGCCTGTAGCCCAT
6	TNF alpha Reverse		CTGAGTCGGTCACCCTTCTC
7	MMP1 Forward	GGTGTGAGTCCAAACAAGGTG
8	MMP1 Reverse		CCTTGCCTATCCAGGGTGAC
9	MMP2 Forward		GCCCCCAAAACGGACAAAG
10	MMP2 Reverse	CCAGACTTGGAAGGCACCGAG
11	MMP9 Forward	TCTATGGTCCTCGCCCTGAA
12	MMP9 Reverse	GCTCCTCAAAGACCGAGTCC
13	GSTA4 Forward	GAGGGGACACTGGATTCTGCT
14	GSTA4 Reverse	GGAGGCTTCTTCTTGCTGCC

6-2. Changes in gene expression following treatment with potato exosomes after exposure to ultraviolet rays

The cultured HaCaT cell line was irradiated with ultraviolet rays (15 mJ/cm ² ), treated with potato-derived exosomes (Example 1) at a concentration of 25 and 50 μg/ml, and then RNA was isolated from the HaCaT cell line and subjected to RT. -Change patterns in MMP1, IL6, and TNF alpha gene expression were analyzed through reverse transcription PCR (PCR).

As a result, as shown in Figure 9A, when the HaCaT cell line was treated with ultraviolet rays, the expression of collagen degrading enzyme MMP1 and the inflammatory factor TNF alpha significantly increased, and the expression of IL6, another inflammatory factor, also increased. As a result of treating the HaCaT cell line exposed to UV light with different concentrations of potato exosomes, the expression of MMP1 and IL6 decreased in a concentration-dependent manner, and in particular, TNF alpha was completely restored even when treated only at a relatively low concentration of 25 μg/ml. It shows an expression inhibition effect, showing that potato-derived exosomes can minimize ultraviolet ray damage to the skin even at low concentrations.

6-3. Changes in gene expression according to potato exosome treatment before/after UV exposure

HaCaT cell line was treated with 50 μg/ml of potato-derived exosomes (Example 1) before/after ultraviolet irradiation, and gene expression patterns were analyzed.

As a result, as shown in Figure 9B, when the HaCaT cell line pre-treated with potato exosomes was irradiated with ultraviolet rays, collagenase genes (MMP1, MMP2, MMP9) and inflammation were increased compared to the case where the exosomes were not treated. The expression of the induced cytokine gene (IL6, TNF alpha) was shown to be significantly suppressed, indicating that the potato-derived exosome according to the present invention can prevent photoaging caused by ultraviolet rays.

In addition, even when the HaCaT cell line is irradiated with ultraviolet rays in advance and then treated with potato exosomes (50 ㎍/㎖), collagenase genes (MMP1, MMP2, MMP9) and inflammation-inducing cytokine genes (IL6, TNF alpha) The expression of is all reduced, showing that it has the ability to restore skin caused by ultraviolet ray damage.

In addition, regardless of the relationship between UV irradiation and potato exosome treatment, potato exosomes increased the expression of GSTA4 compared to the case where potato exosomes were not treated (Figure 7B). GSTA4 itself is a gene that creates an antioxidant enzyme for intracellular defense, and is a gene whose expression increases due to external oxidative attacks. It is known that GSTA4 expression increases in cell lines as a defense against ultraviolet irradiation. Therefore, potato exosomes further increase the expression of GSTA4, indicating that they contribute to preventing cell death from attack by ultraviolet rays and resulting reactive oxygen species and increasing cell survival rate.

Experimental Example 7. Measurement of the effect of potato exosomes on collagen synthesis

The HaCaT cell line was distributed in a ⁹⁶ -well plate at a _{concentration} of 5 Thereafter, potato exosomes (Example 1) were treated at concentrations of 50, 100, and 150 μg/ml, and after 24 hours, they were irradiated with ultraviolet light (UVB, 15 mJ/cm ² ) and cultured for an additional 24 hours.

Soluble collagen secreted in cell culture was measured using the Soluble Collagen Assay kit (abcam, ab240150). The cell culture fluid was recovered and centrifuged at 10,000 g at 4°C for 15 minutes. Afterwards, 80 μl collagen assay buffer was added to 20 μl of the supernatant, reacted at 37°C for 60 minutes, and 75 μl of working solution was added and reacted for 5 minutes. Next, 25 μl of developer working solution was added, and the culture was shaken and incubated for 15 minutes under light blocking conditions. The final water-soluble collagen synthesis efficacy was analyzed in a fluorescence plate reader at a wavelength of Ex/Em=376/468 nm, and 80 μl of Collagen was added to 0, 0.4, 0.8, 1.2, 1.6, and 2 μg of collagen per well in a 96-well plate. The Assay Buffer was dispensed and calculated using a prepared standard curve.

As a result, as shown in Figure 10, when the HaCaT cell line was irradiated with ultraviolet rays, the amount of soluble collagen synthesized in the cells and released into the culture medium decreased. However, when treated in Example 1, the amount of water-soluble collagen increased statistically significantly. This indicates that potato exosomes increase the synthesis of water-soluble collagen through mechanisms such as cell penetration and MMP gene inhibition, and that the potato-derived exosomes of the present invention have an anti-aging effect through increased collagen synthesis.

Experimental Example 8. Comparison of skin cell growth efficacy of potato-derived exosomes, proteins, and organic solvent extracts

It was confirmed that the anti-aging effect of potato exosomes is distinct from potato-derived proteins or their organic solvent extracts. Equal amounts of potato exosomes (Example 1), potato-derived proteins (Comparative Example 1), and alcohol extracts of potato proteins (Comparative Example 2) were treated with HaCaT cell lines at concentrations of 25 μg/ml and 50 μg/ml, respectively, 48 After some time, cell growth rates were compared through WST-1 assay. For the WST-1 assay, refer to the method of Experimental Example 3.

As a result, as shown in Figure 11, when compared to the control cell line that was not treated with anything, Example 1 promoted cell growth statistically significantly (p<0005), while Comparative Example 1 showed no difference, Comparative Example 2 rather inhibited cell growth statistically significantly. This indicates that the purely isolated potato exosomes of the present invention show a specific cell growth promotion effect that is different from that of the same amount of potato-derived protein or alcohol extract derived from the same amount of potato protein.

Experimental Example 9. Comparison of photoaging prevention and recovery efficacy of potato-derived exosomes, proteins, and organic solvent extracts

In order to confirm that the effect of potato exosomes on preventing and recovering cell damage caused by ultraviolet rays is distinct from that of potato-derived proteins or their organic solvent extracts, potato-derived proteins (Comparative Example 1) and alcohol extracts of potato proteins (Comparative Example 2) were also tested. A comparative analysis was conducted to see whether the cells showed the same cell growth efficacy. For the WST-1 assay, see Experimental Example 3.

As a result, as shown in Figure 12, when Example 1 was added to the HaCaT cell line before UV irradiation, cell death caused by UV rays was statistically significantly reduced, and even when added after UV irradiation, the damage was statistically significant. Showed recovery ability.

In this way, while Example 1 showed statistical significance and prevented and recovered cell damage caused by ultraviolet rays, Comparative Examples 1 and 2 did not provide any prevention or recovery effect against ultraviolet rays in skin cells.

Therefore, potato exosomes protect HaCaT cell lines from damage caused by ultraviolet irradiation, prevent photoaging, and at the same time show recovery and treatment effects from photodamage. On the other hand, potato protein extract and potato protein alcohol extract inhibit HaCaT cell lines by ultraviolet rays.

It does not prevent damage and has no ability to repair photodamage that has already occurred. These results indicate that the prevention and recovery effect of cell damage caused by ultraviolet rays is a specific effect of potato exosomes.

Experimental Example 10. Comparison of photoaging prevention and recovery efficacy of potato-derived protein, alcohol extract, and E. coli-derived exosomes

It was confirmed whether the photodamage prevention and recovery effect caused by potato exosomes was found in other exosomes or other components derived from potatoes. As controls, potato-derived protein (Comparative Example 1), alcohol extract of potato protein (Comparative Example 2), and E. coli-derived exosome (Comparative Example 3) were used. For the WST-1 assay, see Experimental Example 3.

As a result, as shown in Figure 13, there was no difference in cell growth rate when treated with Comparative Example 3 before ultraviolet irradiation, and Comparative Example 3 did not provide efficacy in preventing damage from photo damage in the HaCaT cell line (Figure 13A ) In addition, even when Comparative Example 3 was treated after ultraviolet irradiation, there was no difference in cell growth rate, and no recovery effect from photodamage was seen (Figure 13B). In addition, Comparative Example 1 and Comparative Example 2 were also treated with the same amount in Experimental Example 7. Potato exosomes did not show photodamage prevention (Figure 13C) or recovery (Figure 13D).

Therefore, this indicates that the ability of potato exosomes to prevent and repair photodamage caused by ultraviolet rays is a very specific effect of potato-derived exosomes, rather than occurring simply because they are exosomes or because they are potato-derived substances.

Experimental Example 11. Comparison of anti-aging efficacy of potato-derived exosomes, potato-derived proteins, alcohol extracts, and E. coli-derived exosomes

The same amount of potato-derived exosomes (Example 1), potato-derived protein (Comparative Example 1), alcohol extract of potato protein (Comparative Example 2), and E. coli-derived exosomes (Comparative Example 3) were treated in the same amount in the HaCaT cell line and reverse transcription polymerase. Changes in anti-aging gene expression were investigated by performing chain reaction (RT-PCR). Refer to the method of Experimental Example 4.

As a result, as shown in Figure 14, the treatment of Example 1 inhibited the expression of MMP1, MMP2, and MMP9 (Figure 14B), whereas Comparative Examples 1, 2, and 3 had no effect on the expression of these genes. (Figures 14A and 14B).

Additionally, while Example 1 suppressed or minimized the expression of MMP1, MMP2, and MMP9 when treated before or after ultraviolet (UV) irradiation in HaCaT cell lines (Figure 14D), Comparative Examples 1, 2, and 3 did not inhibit the expression of these genes at all. It did not decrease, but rather showed a tendency to increase (Figures 14C and 14D). Therefore, it was confirmed that the potato-derived exosomes of the present invention (Example 1) showed anti-aging effects on the skin.

Experimental Example 12. Comparison of anti-inflammatory effects of potato-derived exosomes, potato-derived proteins, alcohol extracts, and E. coli-derived exosomes

The same amount of potato-derived exosomes (Example 1), potato-derived protein (Comparative Example 1), alcohol extract of potato protein (Comparative Example 2), and E. coli-derived exosomes (Comparative Example 3) were treated in the same amount in the HaCaT cell line and reverse transcription polymerase. Changes in anti-inflammatory gene expression were investigated by performing chain reaction (RT-PCR). Refer to the method of Experimental Example 4.

As a result, as shown in Figure 15, treatment with Example 1 suppressed IL6 and TNF alpha expression (Figure 15B), whereas Comparative Examples 1, 2, and 3 had no effect on the expression of these genes (Figure 15B). Figures 15A and 15B).

In addition, while Example 1 inhibits or minimizes IL6 and TNF alpha expression when the HaCaT cell line is treated with ultraviolet rays (UVB, 15 mJ/cm ² ) before or after irradiation (FIG. 15D), Comparative Examples 1, 2, and 3 are Gene expression did not decrease at all, but rather tended to increase (Figures 15C and 15D).

Therefore, the potato-derived exosome (Example 1) of the present invention indicates that it is a specific substance that exhibits anti-inflammatory effects on the skin.

Experimental Example 13. Comparison of anti-aging efficacy of exosomes derived from various edible crops

To compare the anti-aging efficacy of exosomes derived from various edible crops, potato-derived exosomes (Example 1), pear-derived exosomes (Comparative Example 4), radish-derived exosomes (Comparative Example 5), and orange-derived exosomes were added to the HaCaT cell line. The moths (Comparative Example 6) were each treated at a concentration of 50 μg/ml and cultured for 24 hours. Afterwards, reverse transcription polymerase chain reaction (RT-PCR) was performed to compare changes in anti-aging gene expression. Refer to the method of Experimental Example 4.

As a result, as shown in Figure 16, all edible crop exosomes did not affect the expression of GAPDH, and Example 1 inhibited MMP1 expression by 83.1% and MMP2 and MMP9 expression by 91 and 74%, respectively. , the MMPs inhibition effect was superior to that of Comparative Examples 4, 5, and 6.

This indicates that potato-derived exosomes have the best anti-aging effect among various active plants.

Experimental Example 14. Comparison of anti-inflammatory efficacy of exosomes derived from various edible crops

To compare the anti-inflammatory efficacy of exosomes derived from various edible crops, potato-derived exosomes (Example 1), pear-derived exosomes (Comparative Example 4), radish-derived exosomes (Comparative Example 5), and orange-derived exosomes were added to the HaCaT cell line. The moths (Comparative Example 6) were each treated at a concentration of 50 μg/ml and cultured for 24 hours. Afterwards, reverse transcription polymerase chain reaction (RT-PCR) was performed to compare changes in anti-inflammatory gene expression. Refer to the method of Experimental Example 4.

As a result, as shown in Figure 17, all edible crop exosomes did not affect the expression of GAPDH, and Example 1 inhibited IL6 and TNF alpha expression by 74 and 77%, respectively, compared to Comparative Examples 4, 5, and The IL6 and TNF alpha inhibitory effect was superior to that of 6. In addition, it was confirmed that it exhibited a superior effect than Comparative Examples 4, 5, and 6 in suppressing not only IL6 and TNF alpha, but also MMP-1, 2, and 9 (FIG. 18).

This indicates that potato-derived exosomes have the best anti-inflammatory effect among various active plants.

The description of the present invention described above is for illustrative purposes, and those skilled in the art will understand that the present invention can be easily modified into other specific forms without changing the technical idea or essential features of the present invention. will be. Therefore, the embodiments described above should be understood in all respects as illustrative and not restrictive. For example, each component described as unitary may be implemented in a distributed manner, and similarly, components described as distributed may also be implemented in a combined form.

The scope of the present invention is indicated by the claims described below, and all changes or modified forms derived from the meaning and scope of the claims and their equivalent concepts should be construed as being included in the scope of the present invention.

Claims (7)

1. A cosmetic composition for improving skin containing potato-derived exosomes.
2. According to clause 1,

   The skin improvement includes improving skin elasticity, improving skin wrinkles, improving skin texture, improving skin tone, improving skin brightness, skin regeneration, or skin moisturizing.
3. According to paragraph 1,

   A cosmetic composition wherein the skin improvement is prevention or improvement of skin damage caused by ultraviolet rays.
4. According to paragraph 1,

   A cosmetic composition wherein the skin improvement is prevention or improvement of skin inflammation.
5. According to paragraph 1,

   The potato-derived exosome is a cosmetic composition characterized in that it reduces the expression of one or more genes selected from the group consisting of MMP1, MMP2, MMP9, IL6, and TNF alpha.
6. Food composition for improving skin containing potato-derived exosomes.
7. The food composition according to claim 6, wherein the skin improvement is prevention or improvement of skin damage caused by ultraviolet rays.

Images