WO2023182606A1 - 항노화 유전자 klotho의 발현을 유도하는 신규 화합물 - Google Patents

항노화 유전자 klotho의 발현을 유도하는 신규 화합물 Download PDF

Info

Publication number
WO2023182606A1
WO2023182606A1 PCT/KR2022/017991 KR2022017991W WO2023182606A1 WO 2023182606 A1 WO2023182606 A1 WO 2023182606A1 KR 2022017991 W KR2022017991 W KR 2022017991W WO 2023182606 A1 WO2023182606 A1 WO 2023182606A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
klotho
formula
expression
present
Prior art date
Application number
PCT/KR2022/017991
Other languages
English (en)
French (fr)
Inventor
정동주
Original Assignee
주식회사 클로소사이언스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 클로소사이언스 filed Critical 주식회사 클로소사이언스
Publication of WO2023182606A1 publication Critical patent/WO2023182606A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42—Oxazoles
    • A61K31/423—Oxazoles condensed with carbocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D263/00—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings
    • C07D263/52—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings condensed with carbocyclic rings or ring systems
    • C07D263/54—Benzoxazoles; Hydrogenated benzoxazoles
    • C07D263/58—Benzoxazoles; Hydrogenated benzoxazoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached in position 2
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/30—Other Organic compounds

Definitions

  • the present invention relates to a novel compound that induces the expression of the anti-aging gene klotho.
  • mice that later increased the expression of this gene had an increase in lifespan of 20.0 to 30.8% in males and 18.8 to 19.0% in females. This served as an opportunity to inform the world for the first time that the lifespan of mice can be increased or decreased depending on the expression of a single gene.
  • the base sequence of the Klotho gene is very similar between animals, and it has been reported that there is about 98% identity between mice and humans. This indicates that even in humans, lifespan can be regulated by the expression of the klotho gene.
  • the klotho gene is located on chromosome 13 and produces a membrane protein with a base sequence similar to that of ⁇ -glucosidase.
  • Klotho protein is mainly expressed in renal tubular epithelial cells and brain choroid plexus, and has been reported to be expressed in some parathyroid glands.
  • the Klotho gene is a gene involved in various aging phenotypes. In mice deficient in the klotho gene, the aging process includes reduced lifespan, reduced activity, growth retardation, atherosclerosis, arterial calcification, osteoporosis, reproductive immaturity, infertility, skin atrophy, and emphysema. A similar syndrome occurs.
  • Klotho mRNA expression is significantly higher in kidney tissue than in other tissues, but expression of klotho mRNA is reduced in the kidneys of mouse disease models for hypertension, type 2 diabetes, diabetic nephropathy, and chronic renal failure.
  • NO Nitric Oxide
  • OLETF Oleuka Long-Evans Tokushima fatty rats
  • the klotho gene also affects glucose and insulin metabolism in mice, and statins, a representative hypercholesterolemia treatment, increase the expression of klotho mRNA in kidney proximal tubule cells.
  • statins a representative hypercholesterolemia treatment
  • osteopenia with low bone turnover occurs due to impaired differentiation of both osteoblasts and osteoclasts, which is similar to the characteristics of age-related bone loss and senile osteoporosis in humans.
  • Klotho mutant mice abnormal elongation of trabecular bone in the epiphyseal region and abnormal trabecular bone tissue findings are observed in microcomputed tomography, which is due to a disruption in the bone resorption process.
  • KL-VS functional variant of klotho
  • klotho which has mutations in three regions of the Klotho gene exon2
  • lipid metabolism blood pressure, lifespan, cognitive function, coronary artery disease, and cerebrovascular disease
  • microsatellites of the Klotho gene polymorphisms and single nucleotide polymorphisms have been associated with bone mineral density, and it has also been reported that single nucleotide polymorphisms in the Klotho gene are associated with risk factors for cardiovascular disease and bone mineral density in healthy adult women.
  • Recently, the association between the Klotho gene and Alzheimer's has been reported in several papers.
  • the present inventor has continuously conducted research on compounds that induce klotho expression, and as a result, the new compound developed by the present inventor has excellent stability and a protective effect against oxidative stress (oxidative toxicity) in retinal pigment epithelial cells (RPE). was experimentally confirmed to be excellent, and the present invention was completed.
  • RPE retinal pigment epithelial cells
  • the purpose of the present invention is to provide a novel compound represented by Formula 1 and a pharmaceutically acceptable salt thereof.
  • the present invention provides a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof.
  • R 1 and R 2 are each -H, halogen or C 1-6 straight or branched alkyl
  • R 3 and R 4 may each be -H or halogen.
  • the compound represented by Formula 1 may be a compound represented by Formula 1-1 below.
  • R 1 and R 2 may each be -H, halogen, or C 1-6 straight or branched alkyl.
  • the compound in another preferred embodiment of the present invention, can increase the expression of the Klotho gene.
  • the compound can protect retinal pigment epithelial cells from oxidative stress.
  • the compound according to the present invention not only has an excellent effect of improving the expression level of the Klotho gene, a gene related to aging, but also has a protective effect against oxidative stress in retinal pigment epithelial cells (RPE), so it can be used to prevent or treat macular degeneration. It can be usefully used as a pharmaceutical composition or health functional food composition.
  • RPE retinal pigment epithelial cells
  • Figure 1 shows the results of confirming the stability of KS compounds according to Example 1 of the present invention by MS/MS analysis: KS101 (compound of Formula 1-1A), KS102 (compound of Formula 1-1B), KS103 (compound of Formula 1-1C) ), KS104 (Formula 1-1D compound).
  • Figure 2 shows the results of confirming the expression level of the klotho gene by the KS compound according to Example 1 of the present invention by PCR.
  • Figure 3 shows the results of confirming the cytotoxicity of the KS compound according to Example 1 of the present invention.
  • Figure 4 shows the results of confirming changes in the amount of intracellular reactive oxygen species (ROS) after treating renal tubular epithelial cells (RPTEC) with the KS compounds of Example 1 of the present invention.
  • ROS reactive oxygen species
  • Figures 5 and 6 show the results of confirming changes in expression of oxidative stress-related genes caused by the KS compound in Example 1 of the present invention.
  • Figure 7 shows the results confirming the cell protection effect against oxidative stress of the KS compound of Example 1 of the present invention.
  • the present invention relates to a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof.
  • R 1 and R 2 may each be -H, halogen, or C 1-6 straight or branched alkyl, and R 3 and R 4 may each be -H or halogen.
  • the compound represented by Formula 1 may be a compound represented by Formula 1-1 below.
  • R 1 and R 2 may each be -H, halogen, or C 1-6 straight or branched alkyl.
  • the compound represented by Formula 1-1 is:
  • the compound of the present invention can be used in the form of a pharmaceutically acceptable salt, and an acid addition salt formed by a pharmaceutically acceptable free acid is useful as the salt.
  • pharmaceutically acceptable salt refers to any organic or organic salt of the base compound of Formula 1 where side effects due to the salt do not reduce the beneficial effects of the base compound of Formula 1, at a concentration that is relatively non-toxic and harmless to the patient and has an effective effect. It means inorganic addition salt. For these salts, inorganic acids and organic acids can be used as free acids.
  • Hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, perchloric acid, and phosphoric acid can be used as inorganic acids, and citric acid, acetic acid, lactic acid, maleic acid, and fumarine can be used as organic acids.
  • Acids gluconic acid, methanesulfonic acid, glyconic acid, succinic acid, tartaric acid, galacturonic acid, embonic acid, glutamic acid, aspartic acid, oxalic acid, (D) or (L) malic acid, maleic acid, methanesulfonic acid, ethane sulfuric acid Fonic acid, 4-toluenesulfonic acid, salicylic acid, citric acid, benzoic acid, or malonic acid can be used.
  • these salts include alkali metal salts (sodium salts, potassium salts, etc.) and alkaline earth metal salts (calcium salts, magnesium salts, etc.).
  • acid addition salts include acetate, aspartate, benzate, besylate, bicarbonate/carbonate, bisulfate/sulfate, borate, camsylate, citrate, edisylate, esylate, formate, fumarate, Gluceptate, gluconate, glucuronate, hexafluorophosphate, hybenzate, hydrochloride/chloride, hydrobromide/bromide, hydroiodide/iodide, isethionate, lactate, maleate, maleate , malonate, mesylate, methyl sulfate, naphthylate, 2-naphsylate, nicotinate, nitrate, orotate, oxalate, palmitate, pamoate, phosphate/hydrogen phosphate/dihydrogen phosphate, saccharate.
  • stearate, succinate, tartrate, tosylate, trifluoroacetate aluminum, arginine, benzathine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, olamine, potassium, Sodium, tromethamine, zinc salt, etc. may be included, and among these, hydrochloride or trifluoroacetate is preferable.
  • the compound of the present invention includes not only pharmaceutically acceptable salts, but also all salts, isomers, hydrates and solvates that can be prepared by conventional methods.
  • the addition salt according to the present invention can be prepared by conventional methods.
  • the compound is dissolved in a water-miscible organic solvent, such as acetone, methanol, ethanol, or acetonitrile, and an excess amount of organic acid is added or an aqueous acid solution of an inorganic acid is added. It can be manufactured by adding and then precipitating or crystallizing. Then, the solvent or excess acid in this mixture is evaporated and dried to obtain an addition salt, or the precipitated salt can be prepared by suction filtration.
  • a water-miscible organic solvent such as acetone, methanol, ethanol, or acetonitrile
  • the compound of the present invention can increase the expression of the Klotho gene.
  • the compounds of the present invention can be usefully used as a preventive or therapeutic agent for macular degeneration disease.
  • the present invention relates to a pharmaceutical composition for preventing or treating macular degeneration, comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
  • R 1 and R 2 may each be -H, halogen, or C 1-6 straight or branched alkyl, and R 3 and R 4 may each be -H or halogen.
  • the compound represented by Formula 1 may be a compound represented by Formula 1-1 below.
  • R 1 and R 2 may each be -H, halogen, or C 1-6 straight or branched alkyl.
  • the compound represented by Formula 1-1 is:
  • the macular degeneration may be age-related macular degeneration.
  • composition of the present invention can increase the expression level of the Klotho gene.
  • composition of the present invention can protect retinal pigment epithelial cells from oxidative stress.
  • the compound of the present invention can be administered in various oral and parenteral formulations during clinical administration, and when formulated, it is administered using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants. It is manufactured.
  • Solid preparations for oral administration include tablets, tablets, powders, granules, capsules, troches, etc. These solid preparations include one or more compounds of the present invention and at least one excipient such as starch, calcium carbonate, water, etc. It is prepared by mixing sucrose, lactose, or gelatin. Additionally, in addition to simple excipients, lubricants such as magnesium styrate talc are also used.
  • Liquid preparations for oral administration include suspensions, oral solutions, emulsions, or syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, they contain various excipients such as wetting agents, sweeteners, fragrances, and preservatives. You can.
  • Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, etc.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate.
  • injectable ester such as ethyl oleate.
  • As a base for suppositories witepsol, macrogol, tween 61, cacao, laurel, glycerol, gelatin, etc. can be used.
  • the effective dosage for the human body of the compound of the present invention may vary depending on the patient's age, weight, gender, dosage form, health condition, and disease degree, and is generally about 0.001-100 mg/kg/day, preferably Typically, it is 0.01-35 mg/kg/day. Based on an adult patient weighing 70 kg, the dose is generally 0.07-7000 mg/day, preferably 0.7-2500 mg/day, and is administered once a day at regular intervals depending on the judgment of the doctor or pharmacist. It may be administered in several divided doses.
  • the present invention relates to a food composition or health functional food composition for preventing or improving macular degeneration, comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • composition of the present invention can increase the expression level of the Klotho gene.
  • composition of the present invention can protect retinal pigment epithelial cells from oxidative stress.
  • the macular degeneration may be age-related macular degeneration.
  • Examples of foods to which the active substance of the present invention can be added include drinks, meat, sausages, bread, biscuits, rice cakes, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, There are various soups, beverages, alcoholic beverages, vitamin complexes, dairy products and milk products, and include both health foods and health functional foods in the conventional sense.
  • Health food and health functional food compositions containing the active substances according to the present invention can be added as is to food or used together with other foods or food ingredients, and can be used appropriately according to conventional methods.
  • the mixing amount of the effective substance can be appropriately determined depending on the purpose of use (prevention or improvement).
  • the amount of the composition in food or health functional food may be 0.1 to 90 parts by weight based on the total weight of the food (based on 100 parts by weight).
  • the amount may be below the above range, and since there is no problem in terms of safety, the active substance may be used in an amount above the above range.
  • the food and health functional food composition of the present invention has no particular restrictions on other ingredients other than containing the active substance of the present invention as an essential ingredient in the indicated ratio, and contains various flavoring agents or natural carbohydrates as additional ingredients like a conventional beverage. can do.
  • natural carbohydrates include monosaccharides such as glucose, fructose, etc.; Disaccharides such as maltose, sucrose, etc.; and polysaccharides, such as common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • natural flavoring agents thaumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)
  • synthetic flavoring agents sacharin, aspartame, etc.
  • the ratio of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g, per 100 g of the food or health functional food composition of the present invention.
  • food and health functional food compositions containing the active substances of the present invention include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavors, colorants, and thickening agents (cheese, chocolate, etc.) , pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc.
  • the health food and health functional food composition of the present invention may contain pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks.
  • the ratio of these additives is not that important, but is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of the food and health functional food composition containing the active substance of the present invention.
  • Step 1 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea ,FCCS-19025 -2-1) Manufacturing
  • reaction mixture was purified by silica-gel column chromatography (20% Acetone / n-hexane) to obtain 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (1 -(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea, FCCS-19025-2-1) was obtained as a pale yellow solid (354 mg, 92%).
  • Step 2 N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (FCCS-19025) manufacturing
  • FCCS-19025-2-1 (224 mg, 0.80 mmol) and potassium peroxide (KO 2 ) (284 mg, 4.00 mmol) obtained in step 1 were mixed with acetonitrile (MeCN) (25) under Ar gas atmosphere. mL) and stirred at room temperature for 14 hours. After confirming the completion of the reaction by TLC (thin layer chromatography), acetonitrile (MeCN) was removed under reduced pressure.
  • reaction mixture was purified by silica-gel column chromatography (10 ⁇ 20% Ethyl acetate / n-hexane) to obtain the target compound N-(3,4-difluorophenyl)benzo[d]oxazole-2- Amine (N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine, FCCS-19025) was obtained as a white solid (160 mg, 82%).
  • 3,4-difluorophenyl isothiocyanate (210 mg, 1.23 mmol) and 2-amino-5-fluorophenol (2-amino-5) obtained in Example 3-1 -fluorophenol, 130 mg, 1.02 mmol) was reacted to produce KS103 compound ( N -(3,4-difluorophenyl)-6-fluorobenzo[ d ]oxazol-2-amine), represented by the following formula 1-1C, as an ivory solid (203). mg, 75%).
  • 3,4-difluorophenyl isothiocyanate (212 mg, 1.24 mmol) and 2-amino-4,5-fluorophenol (2- amino-4,5-difluorophenol, 150 mg, 1.03 mmol) was reacted to produce KS104 compound ( N -(3,4-difluorophenyl)-5,6-difluorobenzo[ d ]oxazol-2, represented by the following formula 1-1D -amine) was obtained as a light purple solid (187 mg, 64%).
  • KS compound in Example 1 was used dissolved in 10mM DMSO, and tolbutamide, used as a standard substance, was dissolved in methanol at a concentration of 10mM.
  • each KS compound solution in 50 ⁇ l to a final concentration of 1 ⁇ M, pre-incubate for 3 minutes in a shaking water bath (37°C, 40 rpm), and then add 25 ⁇ l of 10 mM NADPH. Incubation was performed for 30 minutes under conditions with or without addition.
  • Electrospray Scan mode Multiple Reaction Monitoring (MRM) Analyze Ion Transition (m/z) Polarity Retention Time (min) Fragmentor (eV) C.E. (eV) KS101 247.2 > 80.0 Positive 1.69 135 35 KS102 265.0 > 98.1 Positive 1.79 135 40 KS103 265.0 > 128.0 Positive 1.79 135 30 KS104 283.3 > 141.0 Positive 1.91 135 40 IS_Tolbutamide 271.1 > 155.0 Positive 1.23 135 15 MS parameters Capillary voltage (V): 4500 Drying Gas Temp (°C): 350 Neubulizing pressure (psi): 45 Drying gas flow (L/min): 11
  • Figure 1 shows quantitative confirmation of KS compounds cultured with human liver microsomes through MS/MS analysis. Microsome enzymes operate dependent on the coenzyme NADPH(+), so compound metabolism occurred only in reactions where NADPH(+) was added. KS compounds showed higher stability than tolbutamide used as a control, and in particular, KS104 was confirmed to have the best microsomal stability.
  • RPTEC Human renal tubular epithelial cells
  • KS compound of Example 1 Human renal tubular epithelial cells
  • mRNA was collected from the cells, and mRNA expression of the klotho gene was confirmed by PCR.
  • Renal Proximal Tubular Epithelial Cell (RPTEC) was purchased from Lonza, cultured at 37°C and 5% CO 2 and used in the experiment.
  • Each KS compound was added to the cell medium and exposed for 6 hours.
  • RNA was isolated from the cells, converted to cDNA using reverse transcriptase, and klotho was amplified using PCR to confirm the expression level.
  • DMSO was added instead of the compound.
  • KL-F GATAGAGAAAAATGGCTTCCCTCC (SEQ ID NO: 1)
  • KL-R GGTCGGTAAACTGAGACAGAGTGG (SEQ ID NO: 2)
  • GAPDH-F TGACAACTTTGGTATCGTGGAAGG (SEQ ID NO: 3)
  • GAPDH-R AGGGATGATGTTCTGGAGAGCC (SEQ ID NO: 4)
  • Figure 2 shows the results of confirming the expression of the klotho gene by PCR.
  • the gel photo and the expression level of the band shown in the gel photo were quantified using Image J and displayed in a graph.
  • the upper band represents the secreted form of klotho
  • the lower band represents the membrane form of klotho.
  • the quantitative graph was shown by combining the two bands.
  • the expression effect of KS104 showed the best effect, and it was confirmed that the ability to express the klotho gene was more than doubled compared to KS101 as well as other fluorine-binding compounds.
  • KS104 Human retinal epithelial cells (ARPE) in culture were treated with each of the KS compounds of Example 1 at different concentrations, cultured for 24 hours, and then GOGEN's EX-cytox was added and reacted for 1 hour, and the change in absorbance was measured. As absorbance decreases, it indicates that cells are damaged due to toxicity. As shown in Figure 3, KS104 was confirmed to have the lowest cytotoxicity.
  • ROS reactive oxygen species
  • KS compound 2.5 ⁇ M was added to RPTEC cells in culture and incubated for 6 hours.
  • the amount of ROS present in the cells was measured by adding Invitrogen's Reactive Oxygen Detection Reagents and incubated for 1 hour, and the change in fluorescence was measured using a spectrophotometer.
  • Figure 4 is a graph showing the amount of ROS remaining in RPTEC cells. It can be seen that in cells treated with the KS103 compound and KS104 compound, the amount of ROS was reduced by about 30% compared to cells treated with only the solvent (DMSO).
  • ARPE retinal pigment epithelial cells
  • each KS compound was added at a concentration of 2.5 ⁇ M, and buthionine sulfoximine (BSO) was treated at a concentration of 50 mM for 6 hours to cause oxidative stress.
  • BSO buthionine sulfoximine

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Ophthalmology & Optometry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 항노화 유전자 klotho의 발현을 유도하는 신규 화합물에 관한 것이다. 본 발명에 따른 화합물은 노화와 관련된 유전자인 Klotho 유전자의 발현량을 향상시키는 효과가 우수할 뿐만 아니라, 망막색소상피세포(RPE)에서 산화스트레스에 대한 보호 효과를 가지고 있으므로, 황반변성 예방 또는 치료용 약학적 조성물, 또는 건강기능식품 조성물로 유용하게 사용할 수 있다.

Description

항노화 유전자 KLOTHO의 발현을 유도하는 신규 화합물
본 출원은 2023년 3월 22일 출원된 대한민국 특허출원 제10-2022-0035142호 를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
본 발명은 항노화 유전자 klotho의 발현을 유도하는 신규 화합물에 관한 것이다.
동물의 노화를 조절할 수 있는 유전자가 존재할 수 있다는 사실은 1981년에 보고된 SAM(senescence-accelerated mice)에서 알려지게 되었다. AKR/J 계열의 쥐를 교배하는 도중 우연히 만들어진 이 쥐는 같은 계열의 쥐보다 훨씬 노화가 빨랐는데, 이 쥐는 여러 유전자에 변이를 가지고 있는 것이 확인되었다. 이후 단일 그룹의 노화 관련 유전자 발견은 1990년대에 보고되었다. 보고된 유전자는 RecQ family로 DNA helicase라는 효소를 발현시키는 유전자들이었다. 이 유전자들에 변이가 발생하면 조기 노화가 발생하거나 암이 생성되는 결과가 보고되었는데, 이는 DNA의 수리에 영향을 미쳐서 발생하는 것으로 알려졌다. 단일 유전자로 노화와 관련된 것은 1997년에 보고가 된 klotho 유전자이다. Klotho 유전자는 고혈압 쥐의 형질변경 동물모델을 만들던 중 우연히 발견되었는데, 이 유전자를 발현하지 못하게 된 쥐에서는 조기 노화 현상이 발생하고 생명이 짧아졌다. 더 흥미로운 사실은 나중에 이 유전자의 발현을 증가시킨 쥐는 수컷의 경우 수명이 20.0~30.8%가 증가했고 암컷에서는 18.8 ~ 19.0% 증가하였다. 이는 단일 유전자의 발현에 따라 쥐의 수명이 늘어날 수도, 줄어들 수도 있다는 사실을 처음으로 세상에 알리게 된 계기가 되었다. 그리고 Klotho 유전자의 염기서열은 동물 간에 매우 유사하여 쥐와 사람의 경우는 98% 정도나 일치하는 것으로 보고되었다. 이는 사람에서도 klotho 유전자의 발현에 따라 수명이 조절될 수 있음을 나타낸다.
사람에서 klotho 유전자는 13번째 염색체에 위치하며 β-glucosidase와 염기서열이 유사한 막 단백질을 생산한다. Klotho 단백질은 신장의 세뇨관 상피세포와 뇌의 맥락총(choroid plexus)에서 주로 발현되며 일부 부갑상샘에서 발현되는 것으로 보고되었다. Klotho 유전자는 다양한 노화의 표현형에 관련된 유전자로, klotho 유전자가 결핍된 쥐에서는 수명감소, 활동성저하, 성장지연, 죽상경화증, 동맥의 석회화, 골다공증, 생식기미숙, 불임, 피부위축, 폐기종 등의 노화과정과 유사한 증후군이 발생한다. Klotho 변이 쥐에서는 인간에서 노화에 의하여 발생하는 중막 석회증(Monckeberg type)의 동맥경화증과 유사한 양상의 동맥경화증이 대동맥부터 소동맥까지 모든 동맥에서 관찰되고, 혈관형성(angiogenesis)과 맥관형성(vasculogenesis)에 장애가 발생한다.
Klotho mRNA는 신장 조직에서 타조직보다 발현이 현저히 높으나, 고혈압, 제2형 당뇨병, 당뇨병성 신증, 만성신부전의 질환 모델 쥐의 신장에서는 klotho mRNA의 발현이 감소된다. Klotho 발현 저하 쥐에서는 혈관내피유래 이완인자인 NO(Nitric Oxide) 생산이 감소하고, 많은 심혈관계질환의 위험인자를 동시에 가진 OLETF(Otsuka Long-Evans Tokushima fatty rat) 쥐에 klotho 유전자를 바이러스 유전자 전달체를 이용하여 주입하면 혈관내막 기능이상이 호전되고 NO 생산을 증가시키며 혈관 비후와 섬유화를 억제하여 혈압을 강하시킨다. 또한 klotho 유전자는 쥐에서 당과 인슐린대사에도 영향을 미치며, 대표적인 고콜레스테롤혈증 치료제인 스타틴은 신장 근위세뇨관 세포에서 klotho mRNA의 발현을 증가시킨다. Klotho 발현 저하 쥐에서는 조골세포와 파골세포 모두의 분화장애로 인한 낮은 골교체 상태의 골감소증이 발생하고 이는 인간에서 연령증가에 따른 골 소실 및 노인성 골다공증의 특징과 유사하다. 또한 Klotho 변이 쥐에서는 골단 부위의 소주골의 비정상적인 신장과 미세 전산화단층촬영에서 비정상적인 소주골 조직 소견이 관찰되며 이는 골 흡수 과정의 장애에 기인한다. 사람에서 관찰되는 Klotho 유전자 돌연변이에 의한 임상적 표현형의 변화는 다양하다. Klotho 유전자 exon2의 세 부위의 돌연변이를 가진 KL-VS(functional variant of klotho) 변형은 지질대사, 혈압, 수명, 인지기능, 관상동맥질환 및 뇌혈관 질환과 관련되며, Klotho 유전자의 미세부수체(microsatellite) 다형성과 단일염기 유전자 다형성이 골밀도와 연관되었고, 건강한 성인 여성에서 Klotho 유전자의 단일염기 유전자 다형성이 심혈관계질환의 위험인자 및 골밀도와 관련됨도 발표된 바 있다. 최근에는 Klotho 유전자와 알츠하이머와의 연관성도 여러 논문을 통해 보고되었다. 알츠하이머 치매 생쥐모델에서 klotho를 과발현시킬 경우 쥐의 수명이 30% 증가하고 인지기능 저하가 억제되는 것이 보고되었다. 아울러 klotho 발현에 의해 뇌 내에서 아밀로이드 베타 단백질의 생성이 50% 감소하는 것이 관찰되었다. 사람에서도 klotho의 발현량은 알츠하이머 질환의 진행 정도와 반비례하고, klotho 단백질이 알츠하이머 질환자의 혈액에서 염증성 사이토킨의 양을 감소시킨다는 보고가 제출되었다. Klotho는 망막색소상피(RPE)의 기능을 증진시키고 산화스트레스로부터 RPE세포를 보호하는 효과를 가지고 있다는 여러 연구 결과도 보고되었다. Klotho 유전자를 없앤(KL-/-) 쥐의 망막에서는 광수용체세포(photoreceptor)들의 퇴행과 RPE세포에서의 색소 생성이 감소된 것이 나타나는 것이 알려졌다. 배양된 RPE세포에서도 klotho가 발현된다는 것이 확인되었고, 발현된 klotho단백질은 L-3,4-dihydorxyphenylalanine(L-DOPA)의 합성을 증가하고, 기저막으로부터 혈관내피성장인자(vascular endothelial growth factor, VEGF)의 생성을 억제시키는 것이 실험을 통해 확인되었다. 또한 RPE세포에서 klotho는 활성산소(reactive oxygen species, ROS)의 생성을 감소시켜 RPE세포를 산화스트레스로부터 보호하는 기능이 있음이 연구결과로 확인되었다. 노인성황반변성(AMD)을 가진 환자들을 대상으로 실험한 결과 안구 방수액(aqueous humor)에서 klotho 발현이 감소되어 있었는데, 이 감소 효과는 산화스트레스 및 염증과 연관되어 있음이 확인되었다.
본 발명자는 klotho 발현을 유도하는 화합물에 대한 연구를 지속적으로 수행한 결과, 본 발명자가 개발한 신규 화합물이 안정성이 우수하며, 망막색소상피세포(RPE)에서 산화스트레스(산화독성)에 대한 보호 효과가 우수하다는 것을 실험적으로 확인하고, 본 발명을 완성하였다.
본 발명의 목적은 화학식 1로 표시되는 신규 화합물 및 이의 약학적으로 허용가능함 염을 제공하는 데 있다.
그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기 목적을 달성하기 위해,
본 발명은 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용가능한 염을 제공한다.
[화학식 1]
Figure PCTKR2022017991-appb-img-000001
상기 화학식 1에서
R1 및 R2는 각각 -H, 할로겐 또는 C1-6의 직쇄 또는 측쇄 알킬이고,
R3 및 R4는 각각 -H 또는 할로겐일 수 있다.
본 발명의 바람직한 일실시예에 있어서, 상기 화학식 1로 표시되는 화합물은 하기 화학식 1-1로 표시되는 화합물일 수 있다.
[화학식 1-1]
Figure PCTKR2022017991-appb-img-000002
상기 화학식 1-1에서 R1 및 R2는 각각 -H, 할로겐 또는 C1-6의 직쇄 또는 측쇄 알킬일 수 있다.
본 발명의 바람직한 다른 일실시예에 있어서, 상기 화학식 1-1로 표시되는 화합물은
하기 화학식 1-1A로 표시되는 화합물;
[화학식 1-1A]
Figure PCTKR2022017991-appb-img-000003
하기 화학식 1-1B로 표시되는 화합물;
[화학식 1-1B]
Figure PCTKR2022017991-appb-img-000004
하기 화학식 1-1C로 표시되는 화합물; 및
[화학식 1-1C]
Figure PCTKR2022017991-appb-img-000005
하기 화학식 1-1D로 표시되는 화합물;
[화학식 1-1D]
Figure PCTKR2022017991-appb-img-000006
로 구성된 군에서 선택된 어느 하나 이상일 수 있다.
본 발명의 바람직한 또 다른 일실시예에 있어서, 상기 화합물은 클로소(Klotho) 유전자의 발현을 증가시킬 수 있다.
본 발명이 바람직한 또 다른 일실시예에 있어서, 상기 화합물은 산화스트레스로부터 망막색소상피세포를 보호할 수 있다.
본 발명에 따른 화합물은 노화와 관련된 유전자인 Klotho 유전자의 발현량을 향상시키는 효과가 우수할 뿐만 아니라, 망막색소상피세포(RPE)에서 산화스트레스에 대한 보호 효과를 가지고 있으므로, 황반변성 예방 또는 치료용 약학적 조성물, 또는 건강기능식품 조성물로 유용하게 사용할 수 있다.
도 1은 본 발명의 실시예 1에 따른 KS화합물의 안정성을 MS/MS분석으로 확인한 결과이다: KS101(화학식1-1A 화합물), KS102(화학식1-1B 화합물), KS103(화학식1-1C 화합물), KS104(화학식1-1D 화합물).
도 2는 본 발명의 실시예 1에 따른 KS화합물에 의한 klotho 유전자의 발현 정도를 PCR로 확인한 결과이다.
도 3은 본 발명의 실시예 1에 따른 KS화합물의 세포 독성을 확인한 결과이다.
도 4는 신장세뇨관 상피세포 (RPTEC)에 본 발명의 실시예 1의 KS화합물을 각각 처리한 후 세포 내 활성산소(Reactive Oxygen Species, ROS)의 양 변화를 확인한 결과이다.
도 5 및 도 6은 본 발명의 실시예 1의 KS화합물에 의한 산화스트레스 관련 유전자들의 발현 변화를 확인한 결과이다.
도 7은 본 발명의 실시예 1의 KS화합물의, 산화스트레스에 대한 세포 보호 효과를 확인한 결과이다.
이하, 본 발명을 상세하게 설명한다.
항노화 유전자 klotho의 발현을 유도하는 화합물
본 발명은 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용가능한 염에 관한 것이다.
[화학식 1]
Figure PCTKR2022017991-appb-img-000007
(상기 화학식 1에서, R1 및 R2는 각각 -H, 할로겐 또는 C1-6의 직쇄 또는 측쇄 알킬이고, R3 및 R4는 각각 -H 또는 할로겐일 수 있다.)
바람직하게, 상기 화학식 1로 표시되는 화합물은 하기 화학식 1-1로 표시되는 화합물일 수 있다.
[화학식 1-1]
Figure PCTKR2022017991-appb-img-000008
(상기 화학식 1-1에서 R1 및 R2는 각각 -H, 할로겐 또는 C1-6의 직쇄 또는 측쇄 알킬일 수 있다.)
더 바람직하게, 상기 화학식 1-1로 표시되는 화합물은,
하기 화학식 1-1A로 표시되는 화합물;
[화학식 1-1A]
Figure PCTKR2022017991-appb-img-000009
하기 화학식 1-1B로 표시되는 화합물;
[화학식 1-1B]
Figure PCTKR2022017991-appb-img-000010
하기 화학식 1-1C로 표시되는 화합물; 및
[화학식 1-1C]
Figure PCTKR2022017991-appb-img-000011
하기 화학식 1-1D로 표시되는 화합물;
[화학식 1-1D]
Figure PCTKR2022017991-appb-img-000012
로 구성된 군에서 선택된 어느 하나 이상일 수 있다.
본 발명의 상기 화합물은 약학적으로 허용 가능한 염의 형태로 사용할 수 있으며, 염으로는 약학적으로 허용가능한 유리산(free acid)에 의해 형성된 산부가염이 유용하다. 약학적으로 허용가능한 염이란 표현은 환자에게 비교적 비독성이고 무해한 유효작용을 갖는 농도로서 이 염에 기인한 부작용이 화학식 1의 염기 화합물의 이로운 효능을 떨어뜨리지 않는 화학식 1의 염기 화합물의 어떠한 유기 또는 무기 부가염을 의미한다. 이들 염은 유리산으로는 무기산과 유기산을 사용할 수 있으며, 무기산으로는 염산, 브롬산, 질산, 황산, 과염소산, 인산 등을 사용할 수 있고, 유기산으로는 구연산, 초산, 젖산, 말레산, 푸마린산, 글루콘산, 메탄설폰산, 글리콘산, 숙신산, 타타르산, 갈룩투론산, 엠본산, 글루탐산, 아스파르트산, 옥살산, (D) 또는 (L) 말산, 말레산, 메테인설폰산, 에테인설폰산, 4-톨루엔술폰산, 살리실산, 시트르산, 벤조산 또는 말론산 등을 사용할 수 있다. 또한, 이들 염은 알칼리 금속염(나트륨염, 칼륨염 등) 및 알칼리 토금속염(칼슘염, 마그네슘염 등) 등을 포함한다. 예를 들면, 산부가염으로는 아세테이트, 아스파테이트, 벤즈에이트, 베실레이트, 바이카보네이트/카보네이트, 바이설페이트/설페이트, 보레이트, 캄실레이트, 시트레이트, 에디실레이트, 에실레이트, 포메이트, 퓨마레이트, 글루셉테이트, 글루코네이트, 글루큐로네이트, 헥사플루오르포스페이트, 하이벤제이트, 하이드로클로라이드/클로라이드, 하이드로브로마이드/브로마이드, 하이드로요오디드/요오디드, 이세티오네이트, 락테이트, 말레이트, 말리에이트, 말로네이트, 메실레이트, 메틸설페이트, 나프틸레이트, 2-나프실레이트, 니코티네이트, 나이트레이트, 오로테이트, 옥살레이트, 팔미테이트, 파모에이트, 포스페이트/수소 포스페이트/이수소 포스페이트, 사카레이트, 스테아레이트, 석시네이트, 타르트레이트, 토실레이트, 트리플루오르아세테이트, 알루미늄, 알기닌, 벤자틴, 칼슘, 콜린, 디에틸아민, 디올아민, 글라이신, 라이신, 마그네슘, 메글루민, 올아민, 칼륨, 나트륨, 트로메타민, 아연염 등이 포함될 수 있으며, 이들 중 하이드로클로라이드 또는 트리플루오르아세테이트가 바람직하다.
또한, 본 발명의 상기 화합물은 약학적으로 허용되는 염뿐만 아니라, 통상의 방법에 의해 제조될 수 있는 모든 염, 이성질체, 수화물 및 용매화물을 모두 포함한다.
본 발명에 따른 부가염은 통상의 방법으로 제조할 수 있으며, 예를 들면 화합물을 수혼화성 유기용매, 예를 들면 아세톤, 메탄올, 에탄올, 또는 아세토니트릴 등에 녹이고 과량의 유기산을 가하거나 무기산의 산 수용액의 가한 후 침전시키거나 결정화시켜서 제조할 수 있다. 이어서 이 혼합물에서 용매나 과량의 산을 증발시킨 후 건조시켜서 부가염을 얻거나 또는 석출된 염을 흡인 여과시켜 제조할 수 있다.
본 발명의 상기 화합물은 클로소(Klotho) 유전자의 발현을 증가시킬 수 있다.
또한, 망막색소상피를 이용한 산화스트레스 실험을 통해 사기 화합물들이 산화스트레스로부터 세포를 보호하는 효과를 나타내는 것을 확인하였는 바, 본 발명의 화합물들은 황반변성 질환의 예방 또는 치료제로 유용하게 이용할 수 있다.
황반변성 예방 또는 치료용 약학적 조성물
본 발명은 다른 일관점에서, 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는, 황반변성 예방 또는 치료용 약학적 조성물에 관한 것이다.
[화학식 1]
Figure PCTKR2022017991-appb-img-000013
(상기 화학식 1에서, R1 및 R2는 각각 -H, 할로겐 또는 C1-6의 직쇄 또는 측쇄 알킬이고, R3 및 R4는 각각 -H 또는 할로겐일 수 있다.)
바람직하게, 상기 화학식 1로 표시되는 화합물은 하기 화학식 1-1로 표시되는 화합물일 수 있다.
[화학식 1-1]
Figure PCTKR2022017991-appb-img-000014
(상기 화학식 1-1에서 R1 및 R2는 각각 -H, 할로겐 또는 C1-6의 직쇄 또는 측쇄 알킬일 수 있다.)
더 바람직하게, 상기 화학식 1-1로 표시되는 화합물은,
하기 화학식 1-1A로 표시되는 화합물;
[화학식 1-1A]
Figure PCTKR2022017991-appb-img-000015
하기 화학식 1-1B로 표시되는 화합물;
[화학식 1-1B]
Figure PCTKR2022017991-appb-img-000016
하기 화학식 1-1C로 표시되는 화합물; 및
[화학식 1-1C]
Figure PCTKR2022017991-appb-img-000017
하기 화학식 1-1D로 표시되는 화합물;
[화학식 1-1D]
Figure PCTKR2022017991-appb-img-000018
로 구성된 군에서 선택된 어느 하나 이상일 수 있다.
상기 황반변성은 노인성 황반변성일 수 있다.
본 발명의 조성물은 클로소(Klotho) 유전자의 발현정도를 증가시킬 수 있다.
또한, 본 발명의 조성물은 산화스트레스로부터 망막색소상피 세포를 보호할 수 있다.
본 발명의 화합물은 임상 투여시에 경구 및 비경구의 여러 가지 제형으로 투여될 수 있으며, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 제조된다.
경구투여를 위한 고형 제제에는 정제, 환자, 산제, 과립제, 캡슐제, 트로키제 등이 포함되며, 이러한 고형 제제는 하나 이상의 본 발명의 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로스(sucrose), 락토오스(lactose) 또는 젤라틴 등을 섞어 조제된다. 또한, 단순한 부형제 외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 경구 투여를 위한 액상 제제로는 현탁제, 내용액제, 유제 또는 시럽제 등이 해당되는데, 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁용제, 유제, 동결건조제제, 좌제 등이 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세롤, 젤라틴 등이 사용될 수 있다.
또한, 본 발명의 화합물의 인체에 대한 효과적인 투여량은 환자의 나이, 몸무게, 성별, 투여형태, 건강상태 및 질환 정도에 따라 달라질 수 있으며, 일반적으로 약 0.001-100 mg/kg/일이며, 바람직하게는 0.01-35 mg/kg/일이다. 몸무게가 70㎏인 성인 환자를 기준으로 할 때, 일반적으로 0.07-7000 mg/일이며, 바람직하게는 0.7-2500 ㎎/일이며, 의사 또는 약사의 판단에 따라 일정시간 간격으로 1일 1회 내지 수회로 분할 투여할 수도 있다.
황반변성 예방 또는 개선용 식품 조성물
본 발명은 다른 일관점에서, 상기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는, 황반변성 예방 또는 개선용 식품 조성물 또는 건강기능성식품 조성물에 관한 것이다.
본 발명의 조성물은 클로소(Klotho) 유전자의 발현정도를 증가시킬 수 있다.
또한, 본 발명의 조성물은 산화스트레스로부터 망막색소상피세포를 보호할 수 있다.
상기 황반변성은 노인성 황반변성일 수 있다.
식품의 종류에는 특별한 제한은 없다. 본 발명의 유효물질을 첨가할 수 있는 식품의 예로는 드링크제, 육류, 소시지, 빵, 비스킷, 떡, 초콜릿, 캔디류, 스낵류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 알코올 음료 및 비타민 복합제, 유제품 및 유가공 제품 등이 있으며, 통상적인 의미에서의 건강식품 및 건강기능성식품을 모두 포함한다.
본 발명에 따른 유효물질을 함유하는 건강식품 및 건강기능성식품 조성물은 식품에 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효물질의 혼합량은 그의 사용 목적(예방 또는 개선용)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 건강기능성 식품 중의 상기 조성물의 양은 전체 식품 중량(총 100 중량부 기준)의 0.1 내지 90 중량부로 첨가될 수 있다. 그러나 건강 유지를 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효물질은 상기 범위 이상의 양으로도 사용될 수 있다.
본 발명의 식품 및 건강기능식품 조성물은 지시된 비율로 필수 성분으로서 본 발명 유효물질을 함유하는 외에는 다른 성분에는 특별한 제한이 없으며 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트라이톨 등의 당알코올이다. 상술한 것 이외의 향미제로서 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진등) 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 식품 또는 건강기능식품 조성물 100 g당 일반적으로 약 1 내지 20 g, 바람직하게는 약 5 내지 12 g이다.
상기 외에 본 발명의 유효물질을 함유하는 식품 및 건강기능식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 건강식품 및 건강기능성식품 조성물은 천연 과일쥬스 및 과일쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다.
이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하진 않지만 본 발명의 유효물질을 함유하는 식품 및 건강기능식품 조성물 100 중량부 당 0.1 내지 약 20 중량부의 범위에서 선택되는 것이 일반적이다.
이하, 본 발명을 하기의 실시예에 의하여 더욱 상세히 설명한다. 단, 하기의 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기의 실시예에 의해 한정되는 것은 아니다.
실시예 1. 화합물 합성
1-1 : KS101 화합물 합성
단계 1: 1-(3,4-디플루오로페닐)-3-(2-하이드록시페닐)티오우레아 (1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea ,FCCS-19025-2-1)의 제조
Ar 가스 분위기 하에서 2-아미노페놀(2-Aminophenol) (150 mg, 1.37 mmol)을 메탄올(methanol) (8 mL)에 녹인 후, 3,4-디플루오로페닐 이소티오시아네이트(3,4-difluorophenyl isothiocyanate) (224 ㎕, 1.65 mmol)를 천천히 가한 후, 실온에서 13시간동안 교반하였다. TLC(thin layer chromatography)로 반응종결을 확인한 후, 감압하에서 메탄올(Methanol)을 제거하였다. 반응 혼합물을 크로마토그래피(Silica-gel column chromatrography) (20% Acetone / n-hexane)로 정제하여 1-(3,4-디플루오로페닐)-3-(2-하이드록시페닐)티오우레아 (1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea ,FCCS-19025-2-1)를 옅은 노란색의 고체 (354 mg, 92%)로 얻었다.
1H-NMR (400MHz, MeOH-d4) δ 7.62 (d, J = 8.0 Hz, 1H), 7.55 (ddd, J= 2.4 Hz, 1H), 7.25-7.13 (m, 2H), 7.11-7.05 (m, 1H), 6.92-6.82 (m, 2H); ESI-(+) 281.3 [M+H]+.
단계 2: N-(3,4-디플로오로페닐)벤조[d]옥사졸-2-아민 (N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine ,FCCS-19025)의 제조
Ar 가스 분위기 하에서 상기 단계 1에서 얻은 FCCS-19025-2-1 (224 mg, 0.80 mmol), 과산화칼륨(Potassium superoxide, KO2) (284 mg, 4.00 mmol)을 아세토니트릴(acetonitrile, MeCN) (25 mL)에 녹인 후, 상온에서 14시간동안 교반하였다. TLC(thin layer chromatography)로 반응종결을 확인한 후, 감압하에서 아세토니트릴(acetonitrile, MeCN)을 제거하였다. 반응 혼합물을 크로마토그래피(Silica-gel column chromatrography) (10 ~ 20% Ethyl acetate / n-hexane)으로 정제하여 목적 화합물N-(3,4-디플로오로페닐)벤조[d]옥사졸-2-아민 (N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine ,FCCS-19025)을 흰색의 고체 (160 mg, 82%)로 얻었다.
[화학식 1-1A]
Figure PCTKR2022017991-appb-img-000019
1H-NMR (400MHz, MeOH-d4) δ 7.82 (ddd, J= 2.8 Hz, 1H), 7.42 (d, J = 7.6 Hz, 1H), 7.36 (d, J = 8.0 Hz, 1H), 7.34-7.29 (m, 1H), 7.28-7.18 (m, 2H), 7.16-7.10 (m, 1H); ESI-(+) 247.2 [M+H]+.
1-2 : KS102 화합물 합성
THF(2 mL/mmol)에 2-아미노페놀(2-aminophenol, 1.0 equiv.) 및 3,4-디플루오로페닐 이소티오시아네이트(3,4-difluorophenyl isothiocyanate, 1.2 equiv.)를 혼합한 다음, 실온에서 교반하였다. 3시간 동안 교반한 후, 염화제2철(ferric Chloride; FeCl3·6H2O)를 상기 용액에 첨가하고 반응 혼합물을 90℃에서 12시간 동안 교반하였다. 반응 혼합물을 실온으로 냉각시키고 에틸아세테이트(Ethyl acetate, EtOAc)로 추출하였다. 혼합한 유기층을 황산마그네슘(Magnesium sulfate; MgSO4)상에서 건조시키고, 진공에서 농축시켰다. 잔류물을 디클로로메탄(Dichloromethane; CH2Cl2)로 분쇄하고, 디클로로메탄으로 여과 및 세척하여 원하는 생성물(3,4-difluorophenyl isothiocyanate)을 고체로 수득하였다.
그 다음, 상기 3,4-디플루오로페닐 이소티오시아네이트(3,4-difluorophenyl isothiocyanate, 210mg, 1.23mmol) 및 2-아미노-4-플루오로페놀(2-amino-4-fluorophenol, 130mg, 1.02mmol)을 반응시켜 하기 화학식 1-1B로 표시되는, KS102 화합물(N-(3,4-difluorophenyl)-5-fluorobenzo[d]oxazol-2-amine)을 밝은 갈색 고체(195mg, 72%)로 얻었다.
[화학식 1-1B]
Figure PCTKR2022017991-appb-img-000020
m.p. 222.9-223.9 ℃; Rf 0.40 (EtOAc/n-hexane = 1:3); HPLC RT 5.15 min (purity: 99.7%); 1H-NMR (DMSO-d6, 800 MHz) δ 6.97 (ddd, J = 9.8, 8.7, 2.6 Hz, 1H), 7.36 (dd, J = 9.0, 2.6 Hz, 1H), 7.43-7.48 (m, 2H), 7.52 (dd, J = 8.7, 4.4 Hz, 1H), 7.91 (ddd, J = 12.8, 7.1, 2.3 Hz, 1H), 11.0 (s, 1H); 13C-NMR (DMSO-d6, 200 MHz) 159.4 (JCF = 234.9 Hz), 159.1, 149.2 (JCF = 241.9, 13.0 Hz), 144.7 (JCF = 239.0, 12.4 Hz), 143.4, 143.2 (JCF = 13.7 Hz), 135.5 (JCF = 9.2, 2.2 Hz), 117.8 (JCF = 17.9 Hz), 114.1 (JCF = 5.8, 3.1 Hz), 109.5 (JCF = 10.3 Hz), 108.5 (JCF = 25.6 Hz), 106.7 (JCF = 22.1 Hz), 103.9 (JCF = 26.3 Hz) ppm, LR-MS (FAB) m/z 265 (M+H)+; HR-MS (FAB) calcd for C13H8F3N2O (M+H)+ 265.0589, found 265.0588.
1-3 : KS103 화합물 합성
상기 실시예 3-1에서 수득한 3,4-디플루오로페닐 이소티오시아네이트(3,4-difluorophenyl isothiocyanate, 210mg, 1.23mmol) 및 2-아미노-5-플루오로페놀(2-amino-5-fluorophenol, 130mg, 1.02mmol)을 반응시켜 하기 화학식 1-1C로 표시되는, KS103 화합물(N-(3,4-difluorophenyl)-6-fluorobenzo[d]oxazol-2-amine)을 상아색 고체(203 mg, 75%)로 얻었다.
[화학식 1-1C]
Figure PCTKR2022017991-appb-img-000021
m.p. 231.7-232.6 ℃; Rf 0.40 (EtOAc/n-hexane = 1:3); HPLC RT 5.12 min (purity: 98.4%); 1H-NMR (DMSO-d6, 800 MHz) δ 7.10 (ddd, J = 10.1, 8.6, 2.5 Hz, 1H), 7.42-7.45 (m, 2H), 7.47 (dd, J = 8.6, 4.9 Hz, 1H), 7.54 (dd, J = 8.4, 2.5 Hz, 1H), 7.91 (ddd, J = 12.6, 7.0, 2.1 Hz, 1H), 10.9 (s, 1H); 13C-NMR (DMSO-d6, 200 MHz) 158.1, 158.0 (JCF = 235.9 Hz), 149.2 (JCF = 241.8, 13.2 Hz), 146.8 (JCF = 15.0 Hz), 144.6 (JCF = 238.8, 12.6 Hz), 138.4. 135.7 (JCF = 7.3 Hz), 117.8 (JCF = 17.9 Hz), 116.8 (JCF = 9.6 Hz), 113.8 (JCF = 5.5, 3.3 Hz), 111.0 (JCF = 23.7 Hz), 106.4 (JCF = 22.1 Hz), 98.0 (JCF = 28.9 Hz) ppm, LR-MS (FAB) m/z 265 (M+H)+; HR-MS (FAB) calcd for C13H8F3N2O (M+H)+ 265.0589, found 265.0586.
1-4 : KS104 화합물 합성
상기 실시예 3-1에서 수득한 3,4-디플루오로페닐 이소티오시아네이트(3,4-difluorophenyl isothiocyanate, 212 mg, 1.24 mmol) 및 2-아미노-4,5-플루오로페놀(2-amino-4,5-difluorophenol, 150 mg, 1.03 mmol)을 반응시켜 하기 화학식 1-1D로 표시되는, KS104 화합물(N-(3,4-difluorophenyl)-5,6-difluorobenzo[d]oxazol-2-amine)을 밝은 보라색 고체(187 mg, 64%)로 얻었다.
[화학식 1-1D]
Figure PCTKR2022017991-appb-img-000022
m.p. 242.1-243.2 ℃; Rf 0.40 (EtOAc/n-hexane = 1:3); HPLC RT 5.44 min (purity: 99.1%); 1H-NMR (DMSO-d6, 800 MHz) δ 7.41-7.42 (m, 1H), 7.46 (dd, J = 19.3, 9.0 Hz, 1H), 7.62 (dd, J = 10.5, 7.5 Hz, 1H), 7.83 (dd, J = 9.8, 6.9 Hz, 1H), 7.89 (ddd, J = 13.0, 7.2, 2.5 Hz, 1H), 11.0 (s, 1H); 13C-NMR (DMSO-d6, 200 MHz) 158.9, 149.2 (JCF = 242.0, 13.1 Hz), 147.3 (JCF = 237.0, 13.7 Hz), 145.5 (JCF = 238.0, 14.7 Hz), 144.8 (JCF = 239.0. 13.5 Hz), 142.1 (JCF = 12.6 Hz), 138.0 (JCF = 11.5, 1.5 Hz), 135.4 (JCF = 13.2, 1.8 Hz), 117.8 (JCF = 17.8 Hz), 114.0 ((JCF = 5.7, 3.1 Hz), 106.6 (JCF = 22.1 Hz), 104.9 (JCF = 21.7 Hz), 99.5 (JCF = 24.1 Hz) ppm, LR-MS (FAB) m/z 283 (M+H)+; HR-MS (FAB) calcd for C13H7F4N2O (M+H)+ 283.0495, found 283.0505.
실험예 1. 화합물의 안정성 평가
실시예 1의 각 KS화합물은 10mM DMSO에 녹여 사용하였고, 표준물질로 사용된 톨부타마이드(tolbutamide)는 10mM농도로 메탄올(methanol)에 녹여 사용하였다.
유리시험관(13×100 mm)에 0.1 M KH2PO4 (147.5 ㎕), 0.1 M MgCl2 (25 ㎕), corning life science에서 구입한 0.5 mg/ml 농도의 사람 간 마이크로좀(mixed-gender pool) 50 ㎕에 각 KS화합물 용액을 최종 1 μM이 되도록 혼합하여 진탕 항온 수조(shaking water bath, 37℃, 40rpm)에서 3분간 전배양(pre-incubation)한 다음, 10 mM NADPH, 25 ㎕를 가하거나 가하지 않은 조건에서 30분간 배양(incubation) 하였다.
반응 전과 반응 후 50 ㎕씩 시료를 취한 다음, 2 ㎖의 아세토니트릴(acetonitrile)를 첨가하여 반응을 멈추고 1분간 볼텍싱(vortex)을 하였다. 혼합액을 20분간 원심분리(4,000rpm, 4℃)후 각각의 상층액을 새로운 유리시험관으로 옮겨 담고, 원심농축기를 사용하여 2시간 동안 건조시켰다. 완전히 건조된 것을 확인하고 각각의 유리시험관에 200 ㎕의 40% 아세토니트릴을 첨가한 후 1분간 볼텍싱하여 재부유 시켰다. 재부유 용액은 10분간 원심분리(4,000rpm, 4℃)후 150 ㎕의 상층액을 취하여 HPLC-UV 분석에 사용하였다. HPLC-UV 분석은 Agilient 1200 series를 사용하였고, MS/MS 분석은 Agilient 6410을 사용하였다. 분석에 사용된 조건은 아래와 같다.
HPLC로 분석하기 위한 조건
LC Conditions
Column Atlantis dC18 100Å (50 × 2.1 mm i.d., 3.0 μm; Waters, Milford, MA, USA)
Column Temp R.T. (23 ℃)
Mobile phase (A) 0.1 % Formic acid in Water
Mobile phase (B) 0.1 % Formic acid in Acetonitrile
Autosampler Temp 10 ℃
Injection Volume 5 μL
　　
Isocratic Time (min) Flow rate
(μL/min)		 A (%) B (%)
0 200 30 70
3 200 30 70
LC-MS/MS로 분석하기 위한 조건
MS Conditions
Ionization mode: Electrospray
Scan mode: Multiple Reaction Monitoring (MRM)
　　
Analyte Ion Transition
(m/z)		 Polarity Retention Time
(min)		 Fragmentor
(eV)		 CE
(eV)
KS101 247.2 >
80.0		 Positive 1.69 135 35
KS102 265.0 >
98.1		 Positive 1.79 135 40
KS103 265.0 >
128.0		 Positive 1.79 135 30
KS104 283.3 >
141.0		 Positive 1.91 135 40
IS_Tolbutamide 271.1 >
155.0		 Positive 1.23 135 15
　
MS parameters
Capillary voltage (V): 4500
Drying Gas Temp (℃): 350
Neubulizing pressure (psi): 45
Drying gas flow (L/min): 11
　　
도 1은 사람의 간 마이크로좀과 함께 배양된 KS화합물을 MS/MS분석을 통해 정량적으로 확인한 것이다. Microsome의 효소는 조효소 NADPH(+)에 의존적으로 작동하므로 NADPH(+)가 첨가된 반응에서만 화합물의 대사가 일어났다. KS 화합물들은 control로 사용된 tolbutamide보다 높은 안정성을 나타내었으며, 특히 KS104의 microsomal stability가 가장 우수한 것으로 확인되었다.
실험예 2. Klotho 유전자 발현 효과 비교
실시예 1의 각 KS화합물을 농도별로 사람의 신장세뇨관상피세포(RPTEC)에 처리하고 6시간 뒤 mRNA를 세포로부터 모아 klotho 유전자의 mRNA 발현을 PCR로 확인하였다. 신장세뇨관상피세포 (Renal Proximal Tubular Epithelial Cell, RPTEC)는 Lonza 사에서 구입하여 37℃, 5% CO2 조건에서 배양하여 실험에 사용하였다. 각 KS 화합물을 세포의 배지에 넣고 6시간 노출시킨 후 세포로부터 RNA를 분리하고 역전사효소(reverse transcriptase)를 이용하여 cDNA로 전환하여 PCR 방법으로 klotho를 증폭시켜 발현량을 확인하였다. 대조군으로는 화합물 대신 DMSO를 첨가하였다.
실험에 사용된 프라이머의 정보는 아래와 같다.
KL-F : GATAGAGAAAAATGGCTTCCCTCC (서열번호 1)
KL-R : GGTCGGTAAACTGAGACAGAGTGG (서열번호 2)
GAPDH-F : TGACAACTTTGGTATCGTGGAAGG (서열번호 3)
GAPDH-R : AGGGATGATGTTCTGGAGAGCC (서열번호 4)
도 2 는 klotho 유전자의 발현을 PCR로 확인한 결과이다. 젤 사진과 젤 사진에서 나타난 밴드의 발현 정도를 Image J를 이용하여 정량화해서 그래프로 나타내었다. 젤 사진에서 위의 밴드는 secreted form의 klotho를 나타내고, 아래 밴드는 membrane form의 klotho를 나타낸다. 정량 그래프는 두 밴드를 합하여 나타내었다. KS104의 발현 효과가 가장 우수한 효과를 나타내었으며 KS101뿐만 아니라 다른 fluorine 결합 화합물에 비해 klotho 유전자를 발현시키는 능력이 2배 이상 높아진 것으로 확인되었다.
실험예 3. 세포독성(cytotoxicity) 평가
배양 중인 사람의 망막상피세포(ARPE)에 실시예 1의 KS화합물을 각각 농도별로 처리하고 24시간 배양한 뒤 GOGEN 사의 EX-cytox를 넣어 1시간 반응시킨 뒤 흡광도의 변화를 측정하였다. 흡광도가 감소할수록 세포가 독성으로 파손된 것을 나타낸다. 도 3에서 나타내는 바와 같이, KS104의 세포 독성이 가장 낮은 것으로 확인되었다.
실험예 4. 세포 내 활성산소(Reactive Oxygen Species, ROS) 분석
신장세뇨관 상피세포 (RPTEC)에 실시예 1의 KS화합물을 각각 처리 후 세포 내 활성산소(Reactive Oxygen Species, ROS)의 양 변화가 어떻게 변하는지 확인하였다.
배양 중인 RPTEC세포에 각 KS화합물을 2.5 μM씩 넣고 6시간 배양한 뒤 세포 내에 존재하는 ROS의 양을 Invitrogen 사의 Reactive Oxygen Detection Reagents를 넣고 1시간 배양한 뒤 형광의 변화를 spectrophotometer를 이용하여 측정하였다.
도 4는 RPTEC세포 내 남아있는 ROS의 양을 나타낸 그래프이다. KS103 화합물 및 KS104 화합물을 처리한 세포에서는 용매(DMSO)만 처리한 세포에서보다 ROS의 양이 30% 정도 감소된 것을 확인할 수 있다.
실험예 5. 산화스트레스 관련 유전자의 발현 변화 확인
상대적으로 노화가 진행된 7 계대(#7) 신장세뇨관 상피세포(RPTEC)세포에 각 화합물을 2.5 μM씩 넣고 6시간 배양한 뒤 mRNA를 모아서 전체 유전자 발현을 차세대 염기서열 분석기 (next generation sequencer, NGS)로 확인하였다. 노화에 의한 유전자 발현 변화를 확인하기 위해 상대적으로 젊은 4 계대(#4) RPTEC세포와의 유전자 발현 비교를 통해, 젊은 세포에서 발현이 증가된 유전자(TXN, AKT1, NR4A3, NLRP3, FOXP3 유전자)를 확인하였다. 해당 유전자들의 젊은 세포에서의 발현 정도를, 실시예 1의 화합물 처리(노화가 진행된 세포에 실시예 1의 화합물 처리)에 의한 발현 변화 값과 비교하였다. 확인 결과, 노화가 진행된 세포에 KS104 화합물 처리시 젊은 세포보다 해당 유전자의 발현이 더 크게 유도되는 것을 확인하였다 (도 5, 도 6).
실험예 6. 망막색소상피세포 보호 효과
실시예 1의 KS 화합물들의 황반변성에 대한 예방 또는 치료 효과를 확인하기 위해, 산화스트레스로부터 망막색소상피세포 보호 효과를 확인하였다.
먼저, 사람의 망막색소상피세포는 미국의 ATCC에서 구입한 망막색소상피세포(ARPE)를 이용하여 실험하였다. 각 웰당 동일하게 10,000개의 ARPE세포를 넣고 18시간 배양 후 혈청(FBS)이 들어있지 않은 DMEM F-12 배지로 바꾸어 주었다.
이때 각 KS 화합물을 2.5 μM 농도로 넣어주고, 여기에 산화스트레스를 일으키기 위해 부티오닌 설폭시민(buthionine sulfoximine, BSO)를 50 mM 농도로 6시간 처리하였다. 이 세포들의 생존율(viability)를 측정하기 위해 Cyto X(Cell viability assay kit)를 넣어주고 시간 변화에 따른 흡광도를 450nm에서 측정하였다.
그 결과, KS103 화합물 및 KS104 화합물 모두 산화스트레스로 인한 세포 사멸을 억제하는 것을 확인하였다 (도 7).

Claims (6)

  1. 하기 화학식 1-1D로 표시되는 화합물 또는 이의 약학적으로 허용가능한 염:
    [화학식 1-1D]
    Figure PCTKR2022017991-appb-img-000023
  2. 하기 화학식 1-1C로 표시되는 화합물 또는 이의 약학적으로 허용가능한 염:
    [화학식 1-1C]
    Figure PCTKR2022017991-appb-img-000024
  3. 청구항 1 또는 청구항 2에 있어서,
    상기 화합물은 클로소(Klotho) 유전자의 발현을 증가시키는 것을 특징으로 하는, 화합물 또는 이의 약학적으로 허용가능한 염.
  4. 청구항 1 또는 청구항 2에 있어서,
    상기 화합물은 산화스트레스로부터 망막색소상피세포를 보호하는 것을 특징으로 하는, 화합물 또는 이의 약학적으로 허용가능한 염.
  5. 청구항 1 또는 청구항 2에 있어서,
    상기 화합물은 황반변성 예방 또는 치료용 약학 조성물로 사용되는 것을 특징으로 하는, 화합물 또는 이의 약학적으로 허용가능한 염.
  6. 청구항 1 또는 청구항 2에 있어서,
    상기 화합물은 황반변성 예방 또는 개선용 식품 조성물로 사용되는 것을 특징으로 하는, 화합물 또는 이의 약학적으로 허용가능한 염.
PCT/KR2022/017991 2022-03-22 2022-11-15 항노화 유전자 klotho의 발현을 유도하는 신규 화합물 WO2023182606A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20220035142 2022-03-22
KR10-2022-0035142 2022-03-22

Publications (1)

Publication Number Publication Date
WO2023182606A1 true WO2023182606A1 (ko) 2023-09-28

Family

ID=86378964

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/017991 WO2023182606A1 (ko) 2022-03-22 2022-11-15 항노화 유전자 klotho의 발현을 유도하는 신규 화합물

Country Status (2)

Country Link
KR (2) KR102530601B1 (ko)
WO (1) WO2023182606A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2018510182A (ja) * 2015-03-31 2018-04-12 株式会社アモーレパシフィックＡｍｏｒｅｐａｃｉｆｉｃ Ｃｏｒｐｏｒａｔｉｏｎ コウジ酸誘導体を有効成分として含む長寿遺伝子活性化用組成物
KR20180138109A (ko) * 2017-06-20 2018-12-28 한국식품연구원 망막 질환 예방, 개선, 완화 또는 치료용 조성물
KR20190041897A (ko) * 2017-10-13 2019-04-23 이화여자대학교 산학협력단 벤즈옥사졸 유도체, 이의 제조 방법 및 이를 포함하는 약학적 조성물
KR102016421B1 (ko) * 2016-10-28 2019-08-30 부산대학교 산학협력단 치자 추출물로 표면 처리된 금 나노입자를 유효성분으로 함유하는 황반변성 예방 또는 치료용 조성물
KR20210056309A (ko) * 2019-10-02 2021-05-18 주식회사 클로소사이언스 항노화 유전자 klotho의 발현을 유도하는 화합물 및 이의 용도

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2018510182A (ja) * 2015-03-31 2018-04-12 株式会社アモーレパシフィックＡｍｏｒｅｐａｃｉｆｉｃ Ｃｏｒｐｏｒａｔｉｏｎ コウジ酸誘導体を有効成分として含む長寿遺伝子活性化用組成物
KR102016421B1 (ko) * 2016-10-28 2019-08-30 부산대학교 산학협력단 치자 추출물로 표면 처리된 금 나노입자를 유효성분으로 함유하는 황반변성 예방 또는 치료용 조성물
KR20180138109A (ko) * 2017-06-20 2018-12-28 한국식품연구원 망막 질환 예방, 개선, 완화 또는 치료용 조성물
KR20190041897A (ko) * 2017-10-13 2019-04-23 이화여자대학교 산학협력단 벤즈옥사졸 유도체, 이의 제조 방법 및 이를 포함하는 약학적 조성물
KR20210056309A (ko) * 2019-10-02 2021-05-18 주식회사 클로소사이언스 항노화 유전자 klotho의 발현을 유도하는 화합물 및 이의 용도

Also Published As

Publication number Publication date
KR20230137816A (ko) 2023-10-05
KR102530601B1 (ko) 2023-05-11

Similar Documents

Publication Publication Date Title
US9713613B2 (en) Methods and compositions for the treatment of cancer and related hyperproliferative disorders
US20130012538A1 (en) Compositions and methods for the treatment of metabolic disorders
JP2016534124A (ja) 代謝並びに体重関連疾患の処置のための組成物および方法
US9085566B2 (en) Compositions and methods for the treatment of metabolic and related disorders
WO2019098699A1 (ko) 다이터펜계 화합물을 포함하는 신경퇴행성 질환 예방 또는 치료용 조성물
WO2022225108A1 (ko) 이소퀴놀린 유도체 화합물을 유효성분으로 포함하는 미토콘드리아 기능이상으로 인한 질환의 예방 또는 치료용 조성물
WO2022131791A1 (ko) 다중구리 산화효소 펩타이드를 포함하는 구리대사 관련 신경계 질환의 예방 또는 치료용 조성물
WO2023182606A1 (ko) 항노화 유전자 klotho의 발현을 유도하는 신규 화합물
WO2013054998A1 (ko) 신규한 칼콘 유도체 및 이를 유효성분으로 하는 항암제 조성물
WO2023182735A1 (ko) 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 황반변성의 예방 또는 치료용 조성물
KR102334943B1 (ko) 신규 이소퀴놀린 유도체, 이의 제조방법, 및 이를 유효성분으로 함유하는 오토파지 관련 질환의 예방 또는 치료용 약학적 조성물
WO2014098306A1 (ko) 치매 예방 또는 치료용 약학적 조성물
KR102375097B1 (ko) 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물
WO2021034111A1 (ko) 신규 세스퀴테르펜 유도체 및 이의 용도
WO2015072667A1 (ko) 퇴행성 뇌신경질환의 예방 또는 치료용 약학적 조성물
WO2021182896A1 (ko) 이소리퀴리티제닌 유도체를 포함하는 갈색 지방 유도화 분화 조성물
WO2024080768A1 (ko) 이소퀴놀린 유도체를 유효성분으로 포함하는 말초신경병증의 예방 또는 치료용 조성물
WO2023214836A1 (ko) 신규 베르베린 유사체 및 이의 용도
WO2017171374A1 (ko) 3-(4-클로로페닐)벤조[4, 5]이미다조[2, 1-ｂ]싸이아졸-6-카복실산의 МСН 신호전달 억제
WO2022060169A4 (ko) 디메틸칼콘 유도체를 포함하는 대사질환 예방 또는 치료용 조성물
WO2022197028A1 (ko) 신규 이중환형 화합물, 이의 광학 이성질체 또는 이의 약학적으로 허용가능한 염, 이의 용도 및 이의 제조방법
WO2022186658A1 (ko) D-리보-2-헥술로스를 유효성분으로 포함하는 사코페니아 예방, 개선 또는 치료용 조성물
WO2024085618A1 (ko) 이소퀴놀린 유도체를 유효성분으로 포함하는 멜라스증후군의 예방 또는 치료용 조성물
WO2023214838A1 (ko) 이소퀴놀린 유도체 화합물을 유효성분으로 포함하는 미토파지 활성 촉진용 조성물 및 이의 용도
WO2024080708A1 (ko) 이소퀴놀린 유도체를 유효성분으로 포함하는 파킨슨병의 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22933775

Country of ref document: EP

Kind code of ref document: A1